ID: 1133008728

View in Genome Browser
Species Human (GRCh38)
Location 16:2898474-2898496
Sequence CACCAGGAGGTCCCTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 6, 3: 26, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133008720_1133008728 23 Left 1133008720 16:2898428-2898450 CCTGTGGGAGGCAGGGCTCAGAG 0: 1
1: 1
2: 3
3: 63
4: 437
Right 1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG 0: 1
1: 1
2: 6
3: 26
4: 291
1133008717_1133008728 30 Left 1133008717 16:2898421-2898443 CCCATGGCCTGTGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 405
Right 1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG 0: 1
1: 1
2: 6
3: 26
4: 291
1133008719_1133008728 29 Left 1133008719 16:2898422-2898444 CCATGGCCTGTGGGAGGCAGGGC 0: 1
1: 0
2: 8
3: 67
4: 587
Right 1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG 0: 1
1: 1
2: 6
3: 26
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133008728 Original CRISPR CACCAGGAGGTCCCTGCAGA GGG Intronic
900576240 1:3383860-3383882 CACCAGGACACACCTGCAGAAGG + Intronic
900576247 1:3383894-3383916 CACCAGGACACACCTGCAGAAGG + Intronic
900718561 1:4160490-4160512 CACCAGCAAGACCCTGCAGAGGG - Intergenic
900878990 1:5367002-5367024 GAACAGGAGTGCCCTGCAGAAGG + Intergenic
901090439 1:6637369-6637391 CACAAGGAGGTGCCTGGAGGAGG - Intronic
901142485 1:7044116-7044138 CTCCTGGATGTCTCTGCAGAAGG + Intronic
901183266 1:7356252-7356274 CCCCAGGAACTGCCTGCAGAGGG - Intronic
901494979 1:9615614-9615636 CATCAGGAGCTTCCTGCAGCGGG + Intergenic
901636556 1:10673095-10673117 GACCGGGAGGGCCCTGCGGAGGG + Intronic
901718778 1:11178269-11178291 AACCAGGAGATGCCTGGAGACGG - Intronic
902128776 1:14240445-14240467 CACCAGGAGGTCACACCAGGGGG + Intergenic
902249954 1:15147806-15147828 CCCCAGCAGGTCCCTGCAGCAGG - Intergenic
902554829 1:17240769-17240791 CCCCAGCAGGACCCTGCACAAGG - Intronic
902607306 1:17575874-17575896 CAGGAGGTGGGCCCTGCAGAGGG + Intronic
903888179 1:26553349-26553371 GAAGAGGAGGTCCCTGCTGAAGG + Intronic
903888913 1:26556927-26556949 CACCAGGAGCCCCATGCAGGAGG - Intronic
903945031 1:26957300-26957322 TTCCAGAAGGTCCCTGGAGAAGG - Intronic
904289265 1:29473666-29473688 CCCCAGGAAGGGCCTGCAGATGG - Intergenic
904602818 1:31683235-31683257 GTCCCGGAAGTCCCTGCAGATGG + Exonic
905562896 1:38941526-38941548 CACCAGGAGGTCACTCCAGAAGG + Intronic
906087800 1:43150799-43150821 AACCTGGAGGAACCTGCAGATGG + Exonic
906300471 1:44677966-44677988 TACCAGGAGGGCCATGCAGAAGG + Intronic
913412132 1:118563740-118563762 CTCCAGGGGGACCCTGGAGATGG + Intergenic
913579688 1:120213795-120213817 CAGCAGGGGGCACCTGCAGATGG + Intergenic
913628486 1:120684593-120684615 CAGCAGGGGGCACCTGCAGATGG - Intergenic
914561622 1:148825222-148825244 CAGCAGGGGGCACCTGCAGATGG + Intronic
914611210 1:149304986-149305008 CAGCAGGGGGCACCTGCAGATGG - Intergenic
915594788 1:156890296-156890318 CACCAAGAGGCTCCAGCAGAGGG - Intergenic
920269911 1:204755057-204755079 CACCAAGGGGTCCCGGCAGCTGG + Intergenic
922412785 1:225392079-225392101 CACCAGGAGGCTCCTGCAGCTGG + Intronic
922482738 1:225950501-225950523 CAGGAGCAGGTTCCTGCAGATGG - Intergenic
922721198 1:227901162-227901184 CACTAGGAGATCCCTCCCGATGG - Intergenic
923032858 1:230263629-230263651 TATCAGCAGGTCCCTCCAGATGG - Intronic
924644217 1:245862058-245862080 AAGCAGGAGGTCCCTGCTCATGG - Intronic
1062973842 10:1668873-1668895 CACCAGGAGCTCACAGAAGATGG - Intronic
1065504066 10:26411545-26411567 CACCAGGATGTCACTGCAGAAGG + Intergenic
1067037481 10:42931019-42931041 CAGCAGGAGGCCCCTGGAGTGGG - Intergenic
1068449859 10:57171950-57171972 CACCAGGACCTACCTGCAGGTGG + Intergenic
1069535584 10:69250326-69250348 CACCAGGAGGACCCGGAAGTTGG - Exonic
1069781694 10:70960228-70960250 CACTAAAAGGTCCCTGCAGCAGG - Intergenic
1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG + Intergenic
1070304766 10:75233826-75233848 CAGCTGGAGGTTCCTGCAGTTGG + Intergenic
1072199430 10:93145092-93145114 CAGGAGAAGGTCCCTGGAGATGG + Intergenic
1072605467 10:96978138-96978160 CAGGAGGAGGCCCCTGCTGAAGG - Intronic
1072625250 10:97107194-97107216 CTCCAGGAGGCCCCTGCAGCTGG - Intronic
1073084109 10:100877390-100877412 TACCAGGAGGCCCCGGAAGATGG + Intergenic
1073326184 10:102645000-102645022 CACCAGGAGGTGCCCGCGGGCGG - Exonic
1073486772 10:103824154-103824176 CACCTGGAGGTTTCTGCAGAAGG - Intronic
1075445844 10:122512287-122512309 CTCCACGAGGACCCTCCAGATGG + Intronic
1075969224 10:126638560-126638582 CACCAGGAGGGCCTGGCAGGGGG - Intronic
1076308273 10:129480917-129480939 CACCAGGAGGGCTCCGCAAATGG - Intronic
1076849019 10:133083927-133083949 CATCAGGACGTCCCCTCAGAGGG + Intronic
1076855646 10:133114458-133114480 CACCAGCTGTACCCTGCAGACGG - Intronic
1077215104 11:1392082-1392104 CACCGGGAGGGCCCTGGAGAAGG + Intronic
1077367093 11:2165665-2165687 CACCAGGAGCTCCCCGTAGGAGG + Exonic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1079041406 11:17063593-17063615 CACCAGGAAGCCCCACCAGAGGG - Intergenic
1083200841 11:61120075-61120097 CCCCAAGAGGGCTCTGCAGAGGG + Intronic
1083638100 11:64131106-64131128 CCCCAGGAGGTCCCTGTGCAGGG + Intronic
1083942362 11:65903287-65903309 CACAAGGAGGTCCTTTCAGAGGG + Intergenic
1086404902 11:86491367-86491389 CTCCAGGAGGACCCGGCAGAGGG - Intronic
1090274233 11:125408481-125408503 CACCAGGAGGCCCGTGCGGCAGG + Intronic
1090808141 11:130215657-130215679 AGCCAGGAGGTGCCTGCAGAGGG + Intergenic
1091547271 12:1509855-1509877 CACCATGGGGTCCATGCAAAGGG - Intergenic
1091644991 12:2266422-2266444 CACGAGAGGGTCACTGCAGAAGG - Intronic
1095981175 12:47975593-47975615 TTCCAGGAGGACCCTGCAGCAGG + Exonic
1096539237 12:52295536-52295558 AACCTGCAGGGCCCTGCAGAGGG - Intronic
1096623616 12:52879682-52879704 CAGCAGGGGCTCCCCGCAGAGGG - Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1097279985 12:57839137-57839159 CAGCAGAATGTCCCTGGAGATGG - Intronic
1100293791 12:93241885-93241907 CAACAGGAAGTACCAGCAGACGG + Intergenic
1101974773 12:109347527-109347549 CAGCAGGAGTTCCCTGGAGCTGG + Intergenic
1102578272 12:113870968-113870990 CAGCAGGAGGCCCCTGCATATGG + Intronic
1102934858 12:116887817-116887839 TACAAGGACGTCCCTGGAGAAGG - Intergenic
1103016716 12:117500384-117500406 CACCACGAGGACTCTGCTGAAGG + Intronic
1103043452 12:117715265-117715287 CACCCGGGGATCCCTGCAGCAGG + Intronic
1104689894 12:130818001-130818023 CCCCAGGAAGGCCCTGCAGTGGG + Intronic
1104755484 12:131266720-131266742 GACCAGGCTGTCCCTGCCGATGG + Intergenic
1104818092 12:131660116-131660138 CACCTGGAGGCTCCTGCAGTTGG - Intergenic
1104983185 12:132582961-132582983 CTCCAGGAGGTCCCTGGGGGCGG - Exonic
1105650523 13:22372213-22372235 CACCTGGATGTCCAGGCAGAAGG - Intergenic
1106888888 13:34220995-34221017 CACCAGGTGGTCCCAACAAATGG + Intergenic
1107689065 13:42933850-42933872 AACCAGGAAGTCCATGCAGGGGG - Intronic
1110056918 13:70985447-70985469 CTCCATGAGGTCCCTGCCCATGG + Intergenic
1110704070 13:78585113-78585135 TGCCAAGAGGTCACTGCAGATGG - Intergenic
1119195471 14:72714216-72714238 CCCCAGGGGGTTTCTGCAGAGGG - Intronic
1119479201 14:74949295-74949317 CACTAGAAGGTACCTGGAGAGGG - Intronic
1119492825 14:75051305-75051327 CACCAGAAGGGCCCTGATGATGG - Intronic
1121413167 14:93761798-93761820 CAGCGGGAGGTCACTGCAGGTGG - Intronic
1121414734 14:93771560-93771582 CACCTGGAGGTCCCTGCTTGGGG - Intronic
1121837037 14:97101462-97101484 CACCAGGAGGTTCTAGCAGCAGG - Intergenic
1122156071 14:99751181-99751203 CTCCAGGAGCTCACAGCAGATGG + Intronic
1122202885 14:100133112-100133134 CTCCAGGAGTACACTGCAGAGGG + Intronic
1122269611 14:100562688-100562710 CACCAGGAGGTCCAGGCAGAGGG - Intronic
1123009022 14:105338381-105338403 CTCCCGGAAGTCCCTGCCGAGGG + Intronic
1123032281 14:105457545-105457567 CCCCAGAAGGTCCCTGGAGGTGG + Intronic
1123435096 15:20248575-20248597 CACAGAGAGGTCCCTGAAGAGGG - Intergenic
1123467884 15:20529654-20529676 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1123650228 15:22471388-22471410 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1123728199 15:23124863-23124885 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1124278631 15:28345645-28345667 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1124304069 15:28565963-28565985 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1124364819 15:29063982-29064004 ATTCAGGAGGGCCCTGCAGAGGG - Intronic
1124532951 15:30522435-30522457 CTCCAGGGGCTCCCTGCAGGAGG - Intergenic
1124765706 15:32485209-32485231 CTCCAGGGGCTCCCTGCAGGAGG + Intergenic
1124832012 15:33158121-33158143 CACCAGGAGTTCACTACAGCTGG + Intronic
1125887734 15:43241089-43241111 CTCCAGCATGTTCCTGCAGATGG - Intronic
1129350764 15:74954939-74954961 CTCCTGGAGGTCACTGCAAAGGG - Exonic
1129819198 15:78585302-78585324 CTCCATGAGGTCCCTGCATGGGG - Intronic
1130044320 15:80431843-80431865 CACCAGGAGGTCCTGAGAGAGGG - Intronic
1130566445 15:85000251-85000273 CACCAGTGGGTCACTGGAGAAGG + Intronic
1130653930 15:85778757-85778779 CACCAGCAGGTCCCAGCACCAGG + Intronic
1132038414 15:98505189-98505211 AACCAGGTGGTCCCTGAAGCAGG + Intronic
1132209622 15:100010351-100010373 AATCAGGAGGTGCCTGCACAGGG + Intronic
1132588959 16:718084-718106 AACAAGCAGGACCCTGCAGAGGG - Exonic
1132980832 16:2738016-2738038 CACCAGGAGATCCCTACAGAGGG - Intergenic
1132981024 16:2738774-2738796 CACCAGGAGGTCCCGGCAGAGGG - Intergenic
1132981912 16:2742632-2742654 CACCAGCAGGTCCCTGCAAAGGG - Intergenic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1133325791 16:4941392-4941414 CACCAGGAAGACCCTGCAGCTGG + Intronic
1134015528 16:10885481-10885503 CACGAGGAGGTCACAGGAGACGG - Intronic
1134245210 16:12534644-12534666 CTGAAGGAGTTCCCTGCAGACGG + Intronic
1134696688 16:16230100-16230122 CACTGTGGGGTCCCTGCAGAAGG - Intergenic
1136340714 16:29641209-29641231 CCCCTGGAGGTCCCTTCTGAGGG + Intergenic
1136376383 16:29867906-29867928 GACCAGGAGGTCCCCACAAACGG - Intergenic
1136518517 16:30782112-30782134 CACCAGAAAGTCCATGCAGGCGG - Exonic
1136849505 16:33602374-33602396 CACAGAGAGGTCCCTGAAGAGGG + Intergenic
1137961282 16:52884484-52884506 CAAGAAGAGTTCCCTGCAGAGGG + Intergenic
1138728592 16:59168559-59168581 CTCCCAGAGGTCCCTGGAGAGGG - Intergenic
1139583356 16:67885845-67885867 CACCCGCCGGTACCTGCAGATGG - Exonic
1139653016 16:68371966-68371988 CACCAGGAGGGCCAGGTAGATGG + Exonic
1141608911 16:85170374-85170396 GTCCAAGAGGCCCCTGCAGACGG + Intergenic
1141988580 16:87595993-87596015 CTCCAGGGGATCCCTGGAGAGGG + Intergenic
1203111214 16_KI270728v1_random:1451027-1451049 CACAGAGAGGTCCCTGAAGAGGG + Intergenic
1142722262 17:1784393-1784415 GACCAGGTGGTCCCTGCTGACGG + Exonic
1142887602 17:2922464-2922486 CACCAGGAACTCCCAGGAGAGGG - Intronic
1145065298 17:19757721-19757743 CACCAGCAGGTCCCTGGCCATGG + Intergenic
1145123930 17:20284978-20285000 CACCTGGAGGTCCTTGGTGAAGG + Intronic
1145754621 17:27381395-27381417 CGGCAGGAGGTCCCTGCATCAGG + Intergenic
1146910889 17:36647764-36647786 CTCCAGGAGGATCCTCCAGAAGG + Intergenic
1147028485 17:37609638-37609660 CGCCAGCTGGGCCCTGCAGAGGG - Intergenic
1147945365 17:44077536-44077558 GAGAAGGTGGTCCCTGCAGAGGG - Exonic
1148795482 17:50194816-50194838 CACCAACAGGGCCCTGGAGAGGG + Exonic
1150809891 17:68348037-68348059 GACCAGTGGGTCCCTGCTGAAGG - Intronic
1151337232 17:73447133-73447155 AGCCAGGTGGTCCCTGCTGATGG - Intronic
1152021886 17:77784065-77784087 CACCCGGAGGCCCCTGATGAAGG - Intergenic
1152058266 17:78049722-78049744 CACCAGGAAGGCCTTGCAGGTGG - Exonic
1152366719 17:79860642-79860664 CAACAGGACGGCCCTGAAGATGG - Intergenic
1152461879 17:80445911-80445933 TGGCAGGAGGCCCCTGCAGATGG - Intergenic
1152700252 17:81815059-81815081 CCCCGGGGGGTCCCTGCAGCAGG + Intergenic
1152713083 17:81884636-81884658 CAGCCTGAGGTCCCTGGAGAGGG - Intergenic
1153992656 18:10414133-10414155 CACCAGGAGATACCTGCTGTGGG - Intergenic
1155036118 18:22026417-22026439 AACCAGGCTGGCCCTGCAGATGG + Intergenic
1155295237 18:24378835-24378857 CACCAGGAGGTCCCAGCAAGTGG + Intronic
1158588431 18:58760266-58760288 CCCCAGGGTGTCCCAGCAGAAGG - Intergenic
1162930427 19:13954677-13954699 CACCAGGCTGGCCCTTCAGATGG + Intronic
1163472494 19:17505638-17505660 CAGCAGGAGCTCCATGGAGATGG - Exonic
1164599180 19:29549482-29549504 CCCCAGGAGGTCCCTGACGCTGG + Intronic
1164831592 19:31325777-31325799 AACCAGAATGTCCATGCAGAGGG + Intronic
1165031247 19:32999496-32999518 CACAGAGAGGTCCCTGAAGAGGG - Intronic
1165323876 19:35102822-35102844 CACTAGGAGGTCACTGCGGCTGG - Intergenic
1166471760 19:43084199-43084221 GGGCAGGAGCTCCCTGCAGAGGG + Intronic
1166492525 19:43271067-43271089 GGGCAGGAGCTCCCTGCAGAGGG + Intergenic
1167037146 19:47001217-47001239 CACCACTAGGTACCTGCTGAGGG + Exonic
1167239207 19:48333421-48333443 CACCTGGAGGTCTCTGCAAGGGG + Exonic
1167313948 19:48753106-48753128 CCCCAGGAGGACGCGGCAGAGGG - Exonic
1167763352 19:51462859-51462881 CACCAGGAGCTCCTTACTGAGGG - Intergenic
1167883725 19:52483503-52483525 CAATAGGATGTTCCTGCAGATGG - Intronic
1167887006 19:52508463-52508485 CAATAGGATGTTCCTGCAGATGG - Intronic
1167889986 19:52531572-52531594 CAATAGGATGTTCCTGCAGATGG - Intronic
1167914599 19:52730488-52730510 CAATAGGATGTTCCTGCAGATGG + Intronic
1167989778 19:53348545-53348567 CAATAGGATGTTCCTGCAGATGG - Intronic
1167993272 19:53378809-53378831 CAATAGGATGTTCCTGCAGATGG - Intronic
925035954 2:685991-686013 CACCTGGATGTCCAGGCAGAAGG + Intergenic
926125203 2:10267698-10267720 CACCGGGAGGTCCCTGTAAGAGG - Intergenic
927102743 2:19800375-19800397 CACCAGGAGATCCCAGCTGCGGG + Intergenic
928904654 2:36356324-36356346 GACCAGGAGGTGCCCGCAGCCGG - Exonic
929574113 2:43041578-43041600 CACCCGCAGGTCCATGCAGAAGG + Intergenic
929915366 2:46131244-46131266 CTTCAGGAGGGCCCTGGAGAGGG + Intronic
929944658 2:46361304-46361326 CACCAGGAAAGCTCTGCAGATGG - Intronic
932366354 2:71155929-71155951 CTCCAGGGGCTCCCTGCAGAAGG - Intergenic
933717022 2:85369113-85369135 CACAAGGAAGTCCCTGGGGATGG + Intronic
934473414 2:94576577-94576599 CATCGTGAGGTCCCTGCAGCAGG - Intergenic
935498620 2:103811024-103811046 TGCCAGGAGGTCTTTGCAGAAGG + Intergenic
935704164 2:105841470-105841492 CACGGGGAGGTTCCTGGAGAAGG - Intronic
936069023 2:109353223-109353245 CACCAGGAGGCCAGTGCAGCTGG - Intronic
937476874 2:122223511-122223533 CTAAAGGAGGTCCCAGCAGAGGG - Intergenic
937911958 2:127080146-127080168 CACCAGGAGCTCCTTGAGGATGG - Intronic
939234047 2:139468258-139468280 CACGGGGAGGTCTCTGCAGGGGG - Intergenic
940882327 2:158959234-158959256 CACAAGAAGATCCCTGCAGTAGG - Intergenic
941431855 2:165422981-165423003 CACCTGGATGTCCAGGCAGAAGG - Intergenic
942479809 2:176372813-176372835 GACCAGGAGTTCCCTGGAGCAGG - Intergenic
947840804 2:233206768-233206790 CAGCAGGAGGTCCCGGGAGAGGG - Exonic
948147120 2:235716240-235716262 TCCCAGTATGTCCCTGCAGATGG + Intronic
948283218 2:236764650-236764672 CATCTGGAGGTCCCTGAACAAGG - Intergenic
948744738 2:240080374-240080396 CACCCTGAGGACCCAGCAGAGGG + Intergenic
948863490 2:240763998-240764020 GCCCTGGAGGGCCCTGCAGATGG - Intronic
1169499861 20:6148601-6148623 CACCAGGAGGTGGTTGCATAAGG + Intergenic
1170152425 20:13239408-13239430 CTCAGGGAGGACCCTGCAGATGG - Intronic
1171986861 20:31666668-31666690 CACCAGAGGCTCCCTCCAGAGGG - Intronic
1172146769 20:32762798-32762820 CCTCGGGAGGTCCCTGGAGAGGG - Intronic
1172282297 20:33716459-33716481 CATCAGGAGGCCTTTGCAGAGGG - Intronic
1173249676 20:41357936-41357958 CACCAAGGGGTACCTGCAGTGGG + Exonic
1173325717 20:42031494-42031516 CAGCATGAGGTCCCTGTTGATGG - Intergenic
1173929462 20:46806700-46806722 CACTAGGAGCTCCCAGCAGCTGG - Intergenic
1173979931 20:47216043-47216065 CACCACGGAGGCCCTGCAGAGGG + Intronic
1174221313 20:48957782-48957804 CAGCAGAAGGTTCCTGAAGAGGG - Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175741082 20:61420213-61420235 CAGGAGGAGCTGCCTGCAGAGGG - Intronic
1175904415 20:62372460-62372482 CTCCAGGAGGTGCCCACAGACGG + Intergenic
1175939330 20:62530731-62530753 CAGCAGTGCGTCCCTGCAGAGGG - Intergenic
1178110407 21:29364322-29364344 TATCAGTAGGTCCCTGGAGAAGG - Intronic
1179084531 21:38205846-38205868 CTTCAGGAGGTCCATGTAGAAGG - Intronic
1179154141 21:38835185-38835207 CATCAAGAGGTCCATGTAGAAGG + Intergenic
1179156762 21:38857767-38857789 CACCAGCAGGTCCATGGAGAAGG + Intergenic
1180053548 21:45345055-45345077 AACAGGGAGGTCCCTGAAGATGG + Intergenic
1180701588 22:17784271-17784293 CACCCGGAGGCCCCAGCACAGGG - Intergenic
1181314997 22:21965096-21965118 CATCAGGAGGTCCCCTCAGGTGG + Intronic
1182422375 22:30254718-30254740 CAGCAGGAGACCCCTGCAGAGGG + Intergenic
1183336340 22:37249263-37249285 GACGAGGAGGCCCCTGGAGATGG - Intergenic
1184031031 22:41894847-41894869 CTCCAGCAGGTTCTTGCAGAAGG - Exonic
1184186336 22:42867693-42867715 CCTTCGGAGGTCCCTGCAGATGG - Intronic
1184616045 22:45639503-45639525 CTCCAAGAGGTCTCTGCACAGGG - Intergenic
1184642281 22:45879060-45879082 GTCCACGAGGTCCCTGCAGGAGG + Intergenic
1184642589 22:45880331-45880353 CACTAGGAGGTCACCGCAGGTGG - Intergenic
1184712638 22:46262308-46262330 CGTCAGGAGTTCCCTGCAGGCGG - Exonic
1184914889 22:47562626-47562648 GACCAGGGGCTGCCTGCAGAGGG + Intergenic
1185281804 22:49972772-49972794 CTCCAGGAGGTTCCAGCAGATGG + Intergenic
949566167 3:5246742-5246764 CACCAGGAGGTCCCTGGGCGTGG - Intergenic
950106548 3:10392440-10392462 CTCCACGAGTCCCCTGCAGAGGG + Intronic
950893024 3:16421911-16421933 GAGCAGGAGGGGCCTGCAGAAGG - Intronic
953540240 3:43811619-43811641 CTCCTGGAAGTCACTGCAGAAGG + Intergenic
954036707 3:47854737-47854759 CCCCAGGCAGGCCCTGCAGAGGG + Intronic
954036717 3:47854763-47854785 CCCCAGGCAGGCCCTGCAGAGGG + Intronic
961486553 3:127221334-127221356 CACCTGGAGGTCCATTCTGAGGG + Intergenic
964088532 3:152846952-152846974 CACCTGGATGTCCAGGCAGAAGG + Intergenic
965862610 3:173165236-173165258 CAACATGAGGTCACTGTAGATGG + Intergenic
966496711 3:180589942-180589964 CACCAGGATGTGACTGCTGAAGG + Intergenic
966771728 3:183510321-183510343 CACCAGGACCTGCCTTCAGAAGG - Intronic
969254046 4:5990580-5990602 CTCCAGGAGGTTCCCTCAGATGG - Intergenic
969702379 4:8774534-8774556 TACCAGGAGGTCCGTTCAGTAGG - Intergenic
973126088 4:46586726-46586748 CCCCAGGGTGTCCCTGCATAGGG + Intergenic
977564754 4:98569450-98569472 TAATAGGACGTCCCTGCAGATGG - Intronic
981772601 4:148327580-148327602 CATTAGGAGGTCATTGCAGAGGG - Intronic
982880650 4:160710369-160710391 CACAAGGAGGTCTCAGCACAGGG + Intergenic
983709124 4:170692987-170693009 CACATGGAGGTTCCTGGAGAGGG - Intergenic
984081731 4:175255459-175255481 CTCCAGGGGGACCATGCAGATGG - Intergenic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
986723249 5:10575612-10575634 CAGCAGAAGGTCTCTGGAGATGG - Intronic
987088143 5:14488050-14488072 CCCCAGCAGCCCCCTGCAGAAGG + Exonic
988490086 5:31698787-31698809 CACGAGGAAGTACCTGCACAAGG + Intronic
991007559 5:61844782-61844804 AACAAGAAGGCCCCTGCAGATGG + Intergenic
992760455 5:79947012-79947034 CATCAGGAGTGCTCTGCAGAGGG + Intergenic
995882062 5:116854172-116854194 CTTCAGGAGGTCACTGCAGGAGG - Intergenic
997574745 5:134966049-134966071 CCCCAGGAGGCCCCTGTGGATGG + Exonic
998880735 5:146642255-146642277 CACCAGGAGGTCACTCCTTAAGG + Intronic
1000621313 5:163489587-163489609 CACCAGGAGGTTACTCAAGAGGG - Intronic
1002700172 5:181118564-181118586 GCCCAGGCGGCCCCTGCAGAGGG - Intergenic
1003168973 6:3705394-3705416 GATCAGGAGCTCCCTGTAGAGGG + Intergenic
1003257170 6:4484654-4484676 CCACACGAGGTCCCTGCAGGAGG + Intergenic
1005913162 6:30327964-30327986 TTCCAGTAGGTCCCTGGAGAAGG + Intronic
1006898393 6:37484846-37484868 TCACAGGAGGTCCCTGGAGAAGG - Exonic
1007947292 6:45837946-45837968 AACCAGGAGCTCCCTGCAGGAGG + Intergenic
1011626866 6:89290297-89290319 CCACAGCAGGTCCCTGCACAGGG + Intronic
1013450612 6:110276722-110276744 CACTGGGAAATCCCTGCAGAAGG - Intronic
1016094435 6:140018898-140018920 CAACAGGTGGTCCCAGCAGTTGG + Intergenic
1017816098 6:158017762-158017784 CACCTGCAGGTTCCTGCAGGAGG - Intronic
1017947032 6:159104281-159104303 AACCACGGGCTCCCTGCAGAGGG - Intergenic
1018620878 6:165728374-165728396 CACCAGCATGTCCCTACTGAAGG - Intronic
1019435646 7:1020927-1020949 CACCAGGTGGAGCCTTCAGATGG + Intronic
1019544848 7:1569238-1569260 CACCAGGATGTGACTGCTGAAGG + Exonic
1019611919 7:1941035-1941057 CACCTGGAGGTCCCTTCAGGAGG - Intronic
1021111043 7:16694941-16694963 CACCAGGAAGGAACTGCAGAAGG + Exonic
1023697881 7:42865951-42865973 CAGCAGGAGATCCCAGCAGGAGG + Intergenic
1023818243 7:43966158-43966180 CAGAAGGAGGTCCCTGAGGATGG + Intergenic
1024517328 7:50269894-50269916 CACCAGGCCGGCACTGCAGAAGG + Intergenic
1024747641 7:52426985-52427007 CACCAGTAGGAACCAGCAGATGG + Intergenic
1026321626 7:69273500-69273522 CACTAGCAGGTACCTGCAGCTGG - Intergenic
1027185397 7:75967999-75968021 CACCAGCAGGGGCCAGCAGATGG - Intronic
1027508737 7:79052453-79052475 CATGAGGCTGTCCCTGCAGAAGG + Intronic
1031257596 7:119474919-119474941 CAACAGGAAGTCACTGCAAATGG - Intergenic
1032013133 7:128359796-128359818 CAGCAGCAGGTCCCCGAAGATGG + Exonic
1034540640 7:151755931-151755953 CACCATGAGGTTCCTCCAGGAGG + Intronic
1034630593 7:152527470-152527492 CTCCAGGAGATCCCTAGAGAGGG - Intergenic
1034787425 7:153937803-153937825 CACCAGGAGATTCCTGCCCAGGG + Intronic
1035238899 7:157517457-157517479 CACCAGCCGGGCCCCGCAGAGGG - Intergenic
1035303001 7:157909655-157909677 GAACAGGAGGACCATGCAGATGG - Intronic
1035446310 7:158945297-158945319 CCCCAGCAGGTCCCTGGAGAAGG - Intronic
1035463657 7:159062026-159062048 CATCCCGAGGGCCCTGCAGAGGG + Intronic
1035619382 8:1026003-1026025 CACCAGGGATTCCCGGCAGAAGG + Intergenic
1035635761 8:1143036-1143058 CACCCTGAGGCCCCTGCAGAGGG - Intergenic
1037643371 8:20769067-20769089 GATCAGGAGATGCCTGCAGAAGG - Intergenic
1039822537 8:41146522-41146544 TACCAGGAGGGACCTGCAGGTGG + Intergenic
1039887236 8:41661862-41661884 CACGAGGAGGTGACTGTAGAGGG - Exonic
1041705792 8:60844935-60844957 CACCAGGATGGTTCTGCAGATGG - Exonic
1042708516 8:71688320-71688342 AACCAGTAGGTTCCTGCAGCTGG - Intergenic
1048808826 8:138266237-138266259 CACTAGGAAGTCCTTGTAGAAGG - Intronic
1049455145 8:142682847-142682869 AAGGAGGACGTCCCTGCAGAGGG + Intergenic
1049670389 8:143866794-143866816 CACCAGACGGGCACTGCAGACGG - Exonic
1049696019 8:143984723-143984745 CACCATGGGGTCTCTGGAGAAGG - Exonic
1051065791 9:13101110-13101132 CACCTGGAGGGCTATGCAGATGG - Intergenic
1051105771 9:13578419-13578441 CACCAGGAGGTCCCTAGCCAAGG + Intergenic
1051466639 9:17385343-17385365 CACCACCAGGCCTCTGCAGAGGG - Intronic
1051984242 9:23063625-23063647 CACCTGGATGTCCAAGCAGAAGG - Intergenic
1053428690 9:38027727-38027749 CACCAGGAGCTCCCAGGAGTTGG - Intronic
1053934881 9:43140208-43140230 CATCGTGAGGTCCCTGCAGCAGG + Intergenic
1054786799 9:69217974-69217996 CACCAGGAGGTACTTGATGACGG - Intronic
1056490644 9:87103483-87103505 CACCACGAGATCTCTGCACATGG - Intergenic
1058930667 9:109715683-109715705 CACCAGAAAGTCCTTTCAGAAGG - Intronic
1059100823 9:111470101-111470123 GAGCAGGAGGTCCCTGCTGATGG + Intronic
1060019374 9:120115980-120116002 AACCAGGATGTCCCAGCAGCTGG + Intergenic
1060958778 9:127664302-127664324 AACCAGGAGGCCACTGCAGGAGG + Intronic
1061261098 9:129481605-129481627 CACCAGCCTGGCCCTGCAGAAGG - Intergenic
1061853735 9:133430082-133430104 CACCAGGTGCTCCCTGGCGAAGG - Exonic
1062453495 9:136625222-136625244 CAGCACGAGATTCCTGCAGATGG - Intergenic
1203773362 EBV:60315-60337 CACCAGGAGGCGCCTTCTGAGGG + Intergenic
1187176186 X:16898167-16898189 CACCCGGACATTCCTGCAGAAGG - Intergenic
1188274892 X:28187981-28188003 CACCAAAAGCTCCTTGCAGATGG + Intergenic
1189213545 X:39304375-39304397 GTCCAGGAGGTCCCTGAAGTTGG + Intergenic
1189284277 X:39840494-39840516 CACCAGCGGGTCCTTGCAGGAGG + Intergenic
1189442073 X:41046240-41046262 CAGAAGGAGCTCCCTGCAAAGGG - Intergenic
1189850959 X:45176030-45176052 AGCCAGGAGGTCTATGCAGAAGG + Intronic
1194943676 X:100042906-100042928 CGCCAGGAGGTATCTGAAGAAGG - Intergenic
1195676737 X:107512473-107512495 CAAGAGGAGGGCCTTGCAGACGG - Intergenic
1199532604 X:148867321-148867343 CACCTGGAGGTCCCTGGAGAAGG + Intronic