ID: 1133009686

View in Genome Browser
Species Human (GRCh38)
Location 16:2904345-2904367
Sequence GAGGGCGCGCGCGGACTCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133009680_1133009686 -1 Left 1133009680 16:2904323-2904345 CCGATGCTCCTGACGGCCGGGAG No data
Right 1133009686 16:2904345-2904367 GAGGGCGCGCGCGGACTCAGCGG No data
1133009683_1133009686 -9 Left 1133009683 16:2904331-2904353 CCTGACGGCCGGGAGAGGGCGCG No data
Right 1133009686 16:2904345-2904367 GAGGGCGCGCGCGGACTCAGCGG No data
1133009676_1133009686 21 Left 1133009676 16:2904301-2904323 CCGGAATCTGGAGACGTTCTGGC No data
Right 1133009686 16:2904345-2904367 GAGGGCGCGCGCGGACTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133009686 Original CRISPR GAGGGCGCGCGCGGACTCAG CGG Intergenic