ID: 1133011165

View in Genome Browser
Species Human (GRCh38)
Location 16:2912420-2912442
Sequence CCCGCCCAGCGCTGCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 498}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133011152_1133011165 28 Left 1133011152 16:2912369-2912391 CCCCACATCAAGGATCCCCGCAC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011156_1133011165 12 Left 1133011156 16:2912385-2912407 CCCGCACTCGTCCGCCGTTTCCT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011154_1133011165 26 Left 1133011154 16:2912371-2912393 CCACATCAAGGATCCCCGCACTC 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011160_1133011165 1 Left 1133011160 16:2912396-2912418 CCGCCGTTTCCTGGCGGTGTCTG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011162_1133011165 -8 Left 1133011162 16:2912405-2912427 CCTGGCGGTGTCTGCCCCGCCCA 0: 1
1: 0
2: 0
3: 22
4: 249
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011153_1133011165 27 Left 1133011153 16:2912370-2912392 CCCACATCAAGGATCCCCGCACT 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011151_1133011165 29 Left 1133011151 16:2912368-2912390 CCCCCACATCAAGGATCCCCGCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011155_1133011165 13 Left 1133011155 16:2912384-2912406 CCCCGCACTCGTCCGCCGTTTCC 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011161_1133011165 -2 Left 1133011161 16:2912399-2912421 CCGTTTCCTGGCGGTGTCTGCCC 0: 1
1: 0
2: 3
3: 12
4: 157
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498
1133011157_1133011165 11 Left 1133011157 16:2912386-2912408 CCGCACTCGTCCGCCGTTTCCTG 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG 0: 1
1: 1
2: 2
3: 30
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133011165 Original CRISPR CCCGCCCAGCGCTGCCTTCC TGG Intronic
900226035 1:1534115-1534137 CCCTCCCACCCCTGCCTTGCCGG + Exonic
900420135 1:2552703-2552725 GCCACCGGGCGCTGCCTTCCAGG - Intergenic
900575070 1:3379040-3379062 CCCTCCCAGCGCGCCCTTCCTGG + Intronic
900784326 1:4638198-4638220 CTCCCCCAGCGCAGCCTGCCTGG - Intergenic
901147427 1:7075527-7075549 GCAGCCCATCGCTCCCTTCCCGG + Intronic
901198730 1:7454713-7454735 CCCGCCCAGCACTGCTGTCCAGG - Intronic
901880800 1:12192683-12192705 CCCACCCAGTCCTGCCTTCCAGG - Intronic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
902856545 1:19210289-19210311 CCGGCCCAGCGCCGCCTCCCAGG + Intergenic
903036734 1:20497997-20498019 CCTGCCCAACGCTGGCTGCCTGG + Intergenic
903148114 1:21388001-21388023 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
903526305 1:23994324-23994346 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
903603040 1:24556082-24556104 GCCGCCCGGCGCTGCCACCCTGG - Intergenic
903676873 1:25069928-25069950 CCTTCCCAGAGATGCCTTCCCGG + Intergenic
903742582 1:25566826-25566848 CTCACACAGCTCTGCCTTCCAGG + Exonic
904044893 1:27603186-27603208 CCTTCCCGGCGCTGCCTGCCAGG + Intronic
904077389 1:27853037-27853059 CCCGGCCAGCCGTGCCGTCCAGG + Intergenic
904795014 1:33051957-33051979 CCCGGCCAGCCGTGCCATCCGGG + Intronic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
905699380 1:39999970-39999992 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
906106132 1:43293769-43293791 CCCTCCCAGCCCTGCCTGCCTGG + Intergenic
906486845 1:46241117-46241139 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
907038383 1:51236505-51236527 CCCCCCCATCGCTGCCTCGCAGG + Exonic
907270423 1:53287900-53287922 CCCGCCCACCCCTGCCCTCTTGG - Intronic
907522493 1:55033341-55033363 CCAGCCCAGCTCTTCCTTGCAGG + Intergenic
910343851 1:86216080-86216102 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
912298454 1:108489849-108489871 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
912825291 1:112898675-112898697 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
912844852 1:113069431-113069453 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
912890140 1:113521479-113521501 CTCACTCAGCTCTGCCTTCCGGG + Intronic
916717154 1:167455595-167455617 CCTGTCGAGCGCTGCCATCCAGG + Intronic
917130973 1:171741942-171741964 CCCGCCCAGCACCGCCAGCCCGG - Exonic
917376020 1:174350107-174350129 CCCGGCCAGCCGTGCCGTCCGGG - Intronic
918228695 1:182509687-182509709 CCCGGCCAGCCGTGCCGTCCGGG - Intronic
918228718 1:182509736-182509758 CCCGGCCAGCCGTGCCATCCGGG - Intronic
922583032 1:226712577-226712599 CCAGCCGAGCGCTCCCTTCACGG - Intronic
922787931 1:228292514-228292536 CCTTCCCAGCTCTGCCTGCCAGG + Exonic
923171479 1:231421589-231421611 CCGGCGCGCCGCTGCCTTCCTGG + Exonic
923710856 1:236386890-236386912 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
923740283 1:236648280-236648302 CCCTCCCACCTCAGCCTTCCGGG - Intergenic
1063467365 10:6255881-6255903 CCCCGCCAACGCTCCCTTCCAGG - Intergenic
1063636534 10:7787992-7788014 CCCGCCCACCGCCGCCAGCCCGG - Intergenic
1064663540 10:17629175-17629197 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1065560612 10:26960386-26960408 CCAGCTGAGCGCAGCCTTCCAGG + Intergenic
1067060989 10:43077802-43077824 CTCCCCCAGCTCTGCCGTCCTGG + Intronic
1067068282 10:43115625-43115647 CCAGACCAGTGCGGCCTTCCTGG - Intronic
1069567720 10:69474716-69474738 CCCACCCAGCTCTTCATTCCTGG + Intronic
1069594144 10:69659750-69659772 CTCGGCCAGCTCTGCCCTCCCGG + Intergenic
1070427457 10:76303463-76303485 CCCGTCCAGCGCTCACTTGCTGG + Intronic
1070518451 10:77229583-77229605 CCTGCCCAAGGCTACCTTCCTGG + Intronic
1071495386 10:86164317-86164339 CCACCCCAGCGCTGGCATCCTGG - Intronic
1072116599 10:92375174-92375196 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1072149990 10:92675384-92675406 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1072648265 10:97275721-97275743 CCCGGCCAGCTGTGCCATCCGGG + Intronic
1072949564 10:99838702-99838724 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1072980242 10:100093157-100093179 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1073207218 10:101775669-101775691 CCCGACCGGCGCTGCCCACCCGG + Intronic
1073271656 10:102269952-102269974 CACTGCCAGCTCTGCCTTCCGGG + Intronic
1074157083 10:110808510-110808532 CCTGCCCAGTGCTGAGTTCCTGG + Intronic
1074704000 10:116115491-116115513 CCAGCCCTGCCCTGCCCTCCAGG + Intronic
1075079239 10:119371624-119371646 CCTGCCCTGCCCTGCCCTCCCGG + Intronic
1075287739 10:121201794-121201816 CCTTCCCAGAGCTGCCTACCTGG + Intergenic
1075792662 10:125096019-125096041 CACTCCCTGCGCTCCCTTCCTGG - Intronic
1075915150 10:126160527-126160549 CCTTCCCAGCTCTCCCTTCCAGG + Intronic
1076081059 10:127580912-127580934 CCTGCACAGCCCTCCCTTCCGGG + Intergenic
1076480943 10:130784983-130785005 CCCGCCCAGCTCAGCCTCTCTGG + Intergenic
1076693621 10:132236544-132236566 CCCCTCCTGGGCTGCCTTCCTGG - Intronic
1077008448 11:369720-369742 CCCGCCCCGCGCCGCATCCCCGG - Intergenic
1077179007 11:1203952-1203974 CCTGCCCGGCGCTCCCTGCCTGG + Intergenic
1079039831 11:17050607-17050629 CCCGGCCAGCCATGCCATCCGGG - Intergenic
1079353509 11:19712858-19712880 CGCAGCCAGCGCAGCCTTCCCGG + Intronic
1080097997 11:28430294-28430316 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1080098018 11:28430343-28430365 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1081758968 11:45563710-45563732 TCAGCACAGCCCTGCCTTCCAGG - Intergenic
1083382360 11:62278898-62278920 CCCGGCCAGCTGTGCCATCCGGG + Intergenic
1083646129 11:64172476-64172498 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1083656135 11:64230618-64230640 CCTTCCCAGCGCTGGCTTCGGGG - Exonic
1083796910 11:65022083-65022105 CCCGCCCAGCCCTCTCTTCTTGG - Exonic
1083920886 11:65780970-65780992 CCCGCCCCGCGCCGCCAGCCCGG - Intergenic
1084192668 11:67505889-67505911 CTCCCCCACCTCTGCCTTCCGGG + Intronic
1084276560 11:68054291-68054313 CCAGCCCAGCCCTGCCTCTCAGG + Intronic
1084889373 11:72229126-72229148 CCAGCCCATAGCTGCCTTTCAGG - Exonic
1085513314 11:77098748-77098770 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1087057328 11:93947315-93947337 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1087165454 11:94998472-94998494 CAGGCCCAGCGCTGCTCTCCTGG - Exonic
1087198262 11:95321134-95321156 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1089325010 11:117651022-117651044 CCCACCCAGGGTTGCTTTCCAGG - Intronic
1089329550 11:117680132-117680154 CCAGCCTAGCTCTGCCATCCAGG + Intronic
1090322971 11:125863185-125863207 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
1090322994 11:125863234-125863256 CCCGGCCAGCCATGCCGTCCGGG + Intergenic
1091980163 12:4858243-4858265 CCAGCCCAGCCCTCCCTTGCTGG - Intergenic
1092150374 12:6244124-6244146 TTCGCACAGTGCTGCCTTCCAGG + Intergenic
1092242162 12:6841641-6841663 CCCCCCATGCCCTGCCTTCCGGG - Intronic
1092250257 12:6891146-6891168 CCCGCCCCGCGCAGCCGCCCAGG + Intronic
1095068760 12:37814937-37814959 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1095160043 12:38905468-38905490 CCAGCTGAGCGCTGCCATCCCGG - Exonic
1096022305 12:48333162-48333184 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1097190180 12:57216090-57216112 CCCTCTCAGCGCCGCCTGCCTGG - Intergenic
1098405092 12:70116612-70116634 CACGCCAAGCTCCGCCTTCCGGG - Intergenic
1099198555 12:79648679-79648701 CCCTCCCACCTCTGCCTCCCTGG - Intronic
1101467235 12:104960456-104960478 CCCGCCCACCTCTCCCTCCCAGG - Intergenic
1102950372 12:117027049-117027071 CTGGCCCATCGCTGCCTCCCTGG - Intronic
1103521040 12:121537234-121537256 CCCGCCCCGCGCTGGCTCCGGGG + Intronic
1103572352 12:121853544-121853566 CACTGCAAGCGCTGCCTTCCGGG - Intronic
1104033085 12:125079188-125079210 GCCCCCCAGCTCAGCCTTCCTGG - Intronic
1104775272 12:131387139-131387161 CCCGCCCAGTGCTGCCCTTTAGG - Intergenic
1104953457 12:132452835-132452857 CCCTCCCAGCTCTGACTGCCAGG + Intergenic
1105000656 12:132687855-132687877 CCGGCCCGGCGCTCCCGTCCAGG - Intronic
1105206865 13:18232844-18232866 GCCGTCCAGGGCTGCCGTCCAGG + Intergenic
1105223990 13:18410032-18410054 CACTCCAAGCTCTGCCTTCCAGG - Intergenic
1105367765 13:19779348-19779370 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
1105661170 13:22497016-22497038 CCCACCCAGCGCGGCCTGGCAGG + Intergenic
1105765495 13:23554657-23554679 TCCACCCACCTCTGCCTTCCAGG - Intergenic
1106072021 13:26421877-26421899 CACGGCCACCTCTGCCTTCCAGG + Intergenic
1106454192 13:29912156-29912178 TCCCCCCAGCCCTTCCTTCCAGG - Intergenic
1106709535 13:32315405-32315427 CCCACCCAGGCCTGACTTCCGGG + Intergenic
1106862187 13:33921694-33921716 CCCTCCCAGGGCTCCATTCCAGG - Intronic
1106918648 13:34540809-34540831 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1107133565 13:36920498-36920520 CCAGCCCCGCGCTGCCCTCTCGG + Intronic
1108351389 13:49593118-49593140 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
1113379211 13:109787006-109787028 CCCGCCCGGCGCCCCCTCCCCGG - Intergenic
1113660319 13:112103215-112103237 GCCTCCCAGGGCTGCCTCCCAGG - Intergenic
1113897477 13:113775474-113775496 GCCGCCCAACACTGCCATCCAGG - Intronic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1114626912 14:24136163-24136185 CGCACCCAGCTCCGCCTTCCTGG - Intronic
1115346452 14:32348102-32348124 CCCACCCAGCTGTGTCTTCCAGG - Intronic
1115609729 14:35039147-35039169 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
1116480410 14:45389337-45389359 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1118059277 14:62117370-62117392 CCCGCCTAGCGCTGCGAACCCGG + Intergenic
1118373361 14:65156592-65156614 CCCGCAAAGCGCTGGCCTCCAGG + Intergenic
1118776872 14:68978880-68978902 CCCGACCCGCTCTGCCTGCCGGG - Intronic
1118817485 14:69323507-69323529 CCCTCCCAGTGCTGACCTCCAGG - Intronic
1121042137 14:90758317-90758339 CCCGCCCCGCCCCGCCGTCCTGG - Intronic
1121278692 14:92685250-92685272 GCCGCCCAGCCCTGCCTTAGGGG + Intronic
1121799515 14:96762719-96762741 CCAGCCCTGTGCTGCCTACCCGG - Intergenic
1122157579 14:99759443-99759465 CCGGCCCGGGGCTGCCCTCCAGG - Intronic
1122205416 14:100145734-100145756 CCAACCCAGCCCTGCCCTCCAGG + Exonic
1122343642 14:101044865-101044887 CATCCCCAGCGCTGCCTTCATGG - Intergenic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1122963859 14:105112136-105112158 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1123036760 14:105474781-105474803 CGCGCCCAGCCCCGCCTGCCCGG - Intronic
1123438487 15:20272867-20272889 CTCGCCCTGCCCAGCCTTCCTGG - Intergenic
1125079236 15:35656207-35656229 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1125500762 15:40239223-40239245 CGCGCCCAGGGCTGCCTGGCAGG - Intronic
1125659199 15:41382574-41382596 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1125677790 15:41511857-41511879 CCCGCCCAGCGCCGCGACCCCGG + Exonic
1127185910 15:56480376-56480398 CACGGCAAGCTCTGCCTTCCGGG - Intergenic
1127616790 15:60694216-60694238 CTGGCCCAGCTCTGCCTTACAGG - Intronic
1128336086 15:66786623-66786645 ACCTCCCTGAGCTGCCTTCCAGG - Intergenic
1129190038 15:73931760-73931782 CCTGCCCACCTCTGCCCTCCAGG + Intronic
1129428454 15:75481407-75481429 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1130517166 15:84634142-84634164 CCGGCGCCTCGCTGCCTTCCTGG - Intergenic
1131001393 15:88941856-88941878 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1131125278 15:89854088-89854110 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1132063790 15:98713913-98713935 ACAGCCCGGCCCTGCCTTCCTGG - Intronic
1132931174 16:2459963-2459985 CCCGCCCACTCCTGCCTCCCAGG - Intergenic
1133006344 16:2883635-2883657 CGCGCCCAGCGCTGCCTTCCCGG + Intronic
1133011165 16:2912420-2912442 CCCGCCCAGCGCTGCCTTCCTGG + Intronic
1133662017 16:7927551-7927573 ACCACCCAGGGCTCCCTTCCTGG + Intergenic
1134868265 16:17628685-17628707 CCAGCCCAGCCCAGCCTTCCTGG + Intergenic
1135990592 16:27216459-27216481 CCTGCCAAGGGCTGCCTTCCTGG - Intronic
1136080205 16:27847349-27847371 CCAGCCCAGCTCTGGCTCCCTGG - Intronic
1136552240 16:30987930-30987952 CCCGCCCATTGCTGCCCTACTGG + Exonic
1138595304 16:58026372-58026394 CCCGTCCAGCCCGGCCGTCCGGG - Exonic
1138630829 16:58293152-58293174 CCCGCCCTGCCCTGCCTCCCTGG - Intronic
1139957262 16:70699009-70699031 GCCTCCCAGCACTGCCTACCTGG + Intronic
1141580448 16:84994562-84994584 CCAGCTCAGCTCCGCCTTCCTGG + Intronic
1142077962 16:88131492-88131514 ACCTCTCGGCGCTGCCTTCCCGG + Intergenic
1142153815 16:88524241-88524263 CTCGCCGAGCGCTGCCCGCCTGG + Intronic
1142900396 17:3008013-3008035 CCGGACCAGGGCTGCCCTCCTGG + Exonic
1144701669 17:17344630-17344652 CCCTCCCAGCACTGACTGCCTGG + Intronic
1144717021 17:17442636-17442658 CCCGCCCAGGCCAGCCGTCCCGG - Intergenic
1145047215 17:19627914-19627936 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1145205857 17:20984657-20984679 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1145280862 17:21466055-21466077 CCAGCCCAGAGATGCCATCCTGG - Intergenic
1145790450 17:27623482-27623504 CCTGCCCAGCGCTGCAAACCAGG + Exonic
1145957639 17:28865559-28865581 CCCGCCCAGGGCTGTTTTCCTGG + Intergenic
1146062763 17:29615700-29615722 CCCGCCCCGCTCCGCCTGCCTGG + Exonic
1147134694 17:38428318-38428340 CCCACCCCGCGCTCCCTTCTGGG - Intergenic
1147808154 17:43147263-43147285 CACGGCAAGCTCTGCCTTCCAGG + Intergenic
1147853970 17:43464513-43464535 CCCACCTAGTCCTGCCTTCCTGG - Intergenic
1147963365 17:44180621-44180643 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1147989595 17:44324692-44324714 CCGGCCCAGTGCCGCCTACCTGG + Exonic
1148211166 17:45809544-45809566 CCAGCCCAGCCCAGCCTGCCTGG + Intronic
1148558842 17:48594480-48594502 CCCGCCCAGCCCTGCCGGCTCGG - Intronic
1148610430 17:48961158-48961180 CCCACCCAGCGCTGCCTGCCTGG + Intronic
1149430663 17:56593905-56593927 CCGGCTCCTCGCTGCCTTCCCGG - Exonic
1149677254 17:58477056-58477078 TCCTCCCAGCGCTGCCCTCGCGG + Intronic
1150250633 17:63702404-63702426 CCCGCCCATCCCTGCCATGCTGG - Intergenic
1150277048 17:63905370-63905392 CCAGCCCAACACTGCCTCCCGGG + Intergenic
1150483811 17:65530702-65530724 CCAGCCCAGCGCAGCTTCCCAGG + Intronic
1151210000 17:72537407-72537429 CACCCCCAGCCCCGCCTTCCTGG + Intergenic
1151818124 17:76481558-76481580 ACCGCCCACCGCTGCTCTCCCGG - Intronic
1152634223 17:81423859-81423881 CCCGCCCAGCCCAGCTCTCCCGG - Intronic
1152697848 17:81805414-81805436 CCCTCCCACAGCTGCCTGCCGGG - Intronic
1152704053 17:81833684-81833706 CGCGCCCAGGGCCGCCTCCCTGG - Exonic
1152706524 17:81846392-81846414 CCGGGCCAGGGCTGCCTCCCGGG - Intronic
1154529321 18:15329087-15329109 CACTCCAAGCTCTGCCTTCCAGG + Intergenic
1155556769 18:27028621-27028643 CACGGCAAGCTCTGCCTTCCGGG + Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157386582 18:47263478-47263500 CCCGGCCCGCGCTGCCCTGCAGG - Intergenic
1157582351 18:48781028-48781050 CCCCCCCATCCCTGCCTTCACGG + Intronic
1157639901 18:49202971-49202993 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1157677219 18:49577715-49577737 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1157677365 18:49578040-49578062 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1158148604 18:54343387-54343409 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1158333890 18:56393854-56393876 CCTGCCATGCTCTGCCTTCCTGG - Intergenic
1159992754 18:74929236-74929258 CCGCGCCAGCGCTTCCTTCCCGG + Intronic
1160704959 19:525293-525315 GCCGCCCAGCACTGCGCTCCCGG - Intergenic
1160707728 19:537219-537241 GCCGCCCAGCCCCACCTTCCTGG + Intronic
1160765330 19:805122-805144 CACGCCCAGACCTGCCTTCCGGG + Exonic
1160824845 19:1074735-1074757 CCCGCCCAGCCCGCCCTCCCGGG - Intronic
1160860741 19:1236428-1236450 CCTGCCCAGCGCTGAGCTCCAGG - Intronic
1160975611 19:1790865-1790887 CCCGCCCCGCACTGGCTGCCTGG + Intronic
1161051602 19:2166813-2166835 CCTGACCAGTGCTGCCGTCCAGG + Intronic
1161153535 19:2721285-2721307 CCCGCCCCGGGCCGCCTACCTGG + Exonic
1161769262 19:6222474-6222496 ACCGCCCAAGGCTGCCTTCAAGG - Exonic
1161848282 19:6724888-6724910 CCCACCCAGCCCAGCATTCCCGG + Intronic
1161948243 19:7452265-7452287 CCCGCCCTTCTCTGCCTCCCTGG - Intronic
1162016230 19:7847933-7847955 TCGGCCCAGCCCTGCCTGCCTGG - Intronic
1162328511 19:10012428-10012450 CCTGCCCTGCCCTGCCTTGCTGG + Intergenic
1162886882 19:13703418-13703440 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1162894794 19:13758846-13758868 CCTGCCCACCGCTCCCTCCCAGG + Exonic
1162918168 19:13885333-13885355 GCCACCCAGCGCTGGCTTCGAGG + Intronic
1163617952 19:18340849-18340871 CCCGCGCAGCCCAGGCTTCCTGG + Intronic
1163665884 19:18604006-18604028 CCCACCCACCGCTTCCTGCCTGG + Intronic
1163905896 19:20150062-20150084 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1164071862 19:21776044-21776066 CCCGGCCAGCCGTGCCATCCAGG + Intergenic
1164106037 19:22107742-22107764 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1164137493 19:22427777-22427799 CGCTCCCAGTGCTGCCTGCCCGG - Intronic
1164160714 19:22623918-22623940 CGCTCCCAGTGCTGCCTGCCCGG + Intergenic
1164179469 19:22806833-22806855 CGCTCCCAGTGCTGCCTGCCCGG - Intergenic
1164596035 19:29531056-29531078 CCGCCCCAGAGCTGCCTACCAGG - Intronic
1164652452 19:29899521-29899543 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1164925800 19:32129104-32129126 CCCACCAAGTTCTGCCTTCCAGG + Intergenic
1165034459 19:33022767-33022789 CTCGCCCTGCCCAGCCTTCCTGG - Intronic
1165100663 19:33436732-33436754 CCTGCCCACCCCTGCCTTCCGGG + Intronic
1165172900 19:33906242-33906264 CCCGCCCTGCGCGGCCCGCCAGG + Intergenic
1165192950 19:34079463-34079485 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1166028561 19:40108734-40108756 CCCGGCCAGCTGTGCCATCCGGG - Intergenic
1166570297 19:43791632-43791654 CCCTGCAAGCTCTGCCTTCCAGG + Intergenic
1166688330 19:44809019-44809041 CCCGCCCCGCCCCGCCCTCCAGG - Intergenic
1166741064 19:45115111-45115133 CAAGCCCGGCCCTGCCTTCCAGG + Intronic
1166751288 19:45165074-45165096 CCTGCCCAGCCCTGCCAGCCAGG + Intronic
1166817217 19:45553554-45553576 CGCGCCCAGCTCTGCAATCCCGG - Intronic
1167109995 19:47454599-47454621 CCTGCCCACCCCAGCCTTCCTGG - Intronic
1167284096 19:48589116-48589138 CCCGGCCAGCGCCGCCTCTCGGG - Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
1168677056 19:58286184-58286206 ACCACCCAGGGCTGCCATCCAGG + Exonic
1168721378 19:58556640-58556662 CCTCCTCAGCGCTGCCTGCCAGG - Intronic
925104842 2:1282632-1282654 CCCGCACAGCGCGTCCCTCCGGG + Intronic
925612000 2:5709380-5709402 CCCAGCCGGGGCTGCCTTCCTGG - Intergenic
927200384 2:20574708-20574730 CTTGCCCAGCACTGCCTGCCCGG - Intronic
928596967 2:32868764-32868786 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
929357168 2:41039880-41039902 ACAGCCCGGCGCTGCATTCCAGG + Intergenic
929416066 2:41747054-41747076 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
929614562 2:43297517-43297539 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
930619931 2:53633153-53633175 CAAGTCCAGTGCTGCCTTCCCGG + Intronic
931193529 2:60028309-60028331 CCCTTCCAGCCCTGCTTTCCAGG + Intergenic
931587285 2:63841734-63841756 CCCTCCCCGCGCCGCCGTCCAGG - Exonic
932469624 2:71945308-71945330 CCCGCCCAGCGCTGCAAGTCTGG + Intergenic
932573592 2:72950937-72950959 CCCGCCCCGAGCTGGCTGCCTGG - Intronic
933786516 2:85847192-85847214 CCCAGCCAGCACTGCCTTCCAGG + Intronic
933844472 2:86314376-86314398 CCAGCCCTGCAGTGCCTTCCAGG - Intronic
934772812 2:96918778-96918800 ACAGCCCAGTGCTGCGTTCCAGG + Intronic
934863896 2:97788704-97788726 TCTGCCCAGCGCTGCCTTACTGG + Intronic
935638465 2:105268812-105268834 CGTGCCCAGAGCTGCCTCCCAGG - Intronic
936075981 2:109402178-109402200 CCTGCTCTGCACTGCCTTCCTGG + Intronic
936234598 2:110732464-110732486 CCCGCCCTGCCCTGGCTTCCCGG - Intergenic
936546164 2:113394418-113394440 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
938528417 2:132160512-132160534 CACTCCAAGCTCTGCCTTCCAGG + Intronic
939839790 2:147173130-147173152 CCTGCCCAGCCCTGCCTTGCTGG + Intergenic
941814738 2:169786390-169786412 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
942630213 2:177945796-177945818 CCCGGCCAGCCGTGCCATCCGGG + Intronic
944615216 2:201452176-201452198 CCCGCCCAGTGGTGCCTGCCGGG + Intronic
945115093 2:206401286-206401308 CCCGGCCAGCCATGCCATCCGGG - Intergenic
946024084 2:216661460-216661482 CCTGCCCAGCTCTGCCATCTTGG + Intronic
946229483 2:218282645-218282667 CCAACCCAGCTCTGGCTTCCAGG - Intronic
946299269 2:218812687-218812709 CTCGCCCCGTGCTGCCTTTCTGG + Exonic
946308830 2:218871663-218871685 CCCAGGCGGCGCTGCCTTCCGGG - Exonic
946366967 2:219254324-219254346 CCCTTCCAGCCCTGCCTCCCAGG + Intronic
947636067 2:231681250-231681272 CCCGCTCCCCTCTGCCTTCCCGG + Intergenic
947858923 2:233345058-233345080 CCCTCCCAGTGCTGGCTTCCAGG + Intronic
948081307 2:235207431-235207453 CACACCCAGCCCTGCCTTCATGG + Intergenic
948945660 2:241217898-241217920 CCCGCCCCGCGCTCCCGCCCGGG - Intronic
949009721 2:241671615-241671637 CCCCACCAGCGCTGCCTGCCCGG + Intronic
1170424981 20:16227767-16227789 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1171418434 20:24999735-24999757 CCAGCCCAGAGCTGCCTCTCAGG - Intergenic
1171783756 20:29444875-29444897 CCAGCCCAGACCTGCCCTCCAGG + Intergenic
1172059099 20:32176259-32176281 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
1172141249 20:32724111-32724133 CCCGGCCAGCCGTGCCATCCAGG + Intronic
1172348584 20:34223515-34223537 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1172360861 20:34311817-34311839 CCAGCCCAGCGGTGACTTCGAGG - Intergenic
1172428657 20:34873020-34873042 TCGACCCTGCGCTGCCTTCCTGG - Intronic
1173218844 20:41114510-41114532 TCCGCCCTGTGCTACCTTCCTGG + Intronic
1173400676 20:42723397-42723419 GCCTCCCAGGGCGGCCTTCCCGG + Intronic
1173404793 20:42755100-42755122 CCCGCCCACACCTCCCTTCCTGG - Intronic
1174047191 20:47741806-47741828 CCTGCCCTGCGTTCCCTTCCAGG - Intronic
1174130909 20:48342755-48342777 CCTCCCCAGGGCTGCCTTCGAGG - Intergenic
1174400220 20:50271989-50272011 TCCGCCCACCTCTGCCTTCCTGG + Intergenic
1175521632 20:59605544-59605566 GCTGCGGAGCGCTGCCTTCCAGG - Intronic
1175553251 20:59830568-59830590 CCTGCCCAGCGCCTCCTTGCAGG - Intronic
1175773757 20:61640448-61640470 CCAGCCCTGTGCTGGCTTCCGGG + Intronic
1175900991 20:62359880-62359902 CCCGCCCTCCTCAGCCTTCCAGG + Intronic
1176023730 20:62975386-62975408 CCTGCCCAGCACTCCCTGCCGGG - Intergenic
1176035763 20:63035721-63035743 CCCGCTCTGCCCTGCCCTCCAGG - Intergenic
1176178687 20:63739924-63739946 CCCGCCCCGCGCCGCCGGCCGGG + Exonic
1176194400 20:63830835-63830857 CCCGCCCCGCGCCGCCGGCCTGG + Intronic
1176199961 20:63855676-63855698 CACCCCCAGCCCTTCCTTCCTGG - Intergenic
1176299053 21:5090056-5090078 CCGGCCCAGGGCAGCCTTCTGGG - Intergenic
1176768080 21:13039386-13039408 CACTCCAAGCTCTGCCTTCCAGG - Intergenic
1179148185 21:38787536-38787558 CCGGCCCAGCCCTCCCCTCCTGG + Intergenic
1179246390 21:39637588-39637610 CCCGCCCAGGGCTTCTTTCCTGG + Intronic
1179419177 21:41222391-41222413 ACGGCCCATCGCTCCCTTCCAGG - Intronic
1179857972 21:44171892-44171914 CCGGCCCAGGGCAGCCTTCTGGG + Intergenic
1179989632 21:44940361-44940383 TCCGCTCTGCGCTGCCGTCCTGG + Intronic
1180083481 21:45497259-45497281 CCCTCCCAGCACAGCCGTCCAGG + Intronic
1180162392 21:46003991-46004013 CTAGCCCAGCGCCACCTTCCTGG - Exonic
1180215018 21:46318279-46318301 GGCGCCCAGCGCTGGCTTCTGGG - Intronic
1180682629 22:17638904-17638926 CTCACCCAGCTCAGCCTTCCCGG - Intronic
1180985626 22:19902545-19902567 CCAGCCCTGTGCTGCCTCCCTGG - Intronic
1181725104 22:24806137-24806159 CCCGCCGAGCGGTGGCTTTCCGG + Intergenic
1181982184 22:26773401-26773423 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1182045522 22:27271053-27271075 GCCGCCCAGCGCTGTCTGCTGGG - Intergenic
1182273345 22:29169756-29169778 CAGACCCAGCCCTGCCTTCCTGG - Intergenic
1182298857 22:29327054-29327076 CACACACACCGCTGCCTTCCTGG - Intergenic
1182419230 22:30240839-30240861 CCAGTCCAGCTCTGCCTTGCCGG - Exonic
1182616777 22:31593053-31593075 CCCGGCCAGCCGTGCCGTCCGGG - Intronic
1182748328 22:32622615-32622637 CCCTCCCAGCTCTGACTTTCTGG - Intronic
1183201411 22:36387757-36387779 CCCGCCCGCCGCCGCCTGCCCGG + Intronic
1183549184 22:38471291-38471313 CCCCACCAGGGCTGCCTCCCAGG + Intronic
1183623389 22:38987426-38987448 CCAGCCCAGCGGTGACTTTCAGG - Intronic
1184385646 22:44173042-44173064 TCCACCCAGCGCTGCTTCCCGGG + Intronic
1184552600 22:45212463-45212485 CCCCCCCAGCCAAGCCTTCCCGG - Exonic
1184670421 22:46009502-46009524 CCTGCCCACCGCTGCATTCTTGG - Intergenic
1184680370 22:46069828-46069850 CCAGCCCAGCGTTGCCCTCCTGG + Intronic
1184698265 22:46151290-46151312 CCGGCCCAGCGCAGCCTGTCCGG - Intronic
1184762775 22:46554338-46554360 CGAGGCCAGCGCTGCCTTCATGG + Intergenic
1184769082 22:46587574-46587596 CCCGGCCTGGGCTGCCTGCCAGG - Intronic
1184975883 22:48061613-48061635 CCCTCCCAGCTCTGGCTTTCTGG - Intergenic
1185220847 22:49628474-49628496 ACCCCCCATCACTGCCTTCCAGG + Intronic
950106769 3:10393523-10393545 CCATCCCAGCTCTGCCTTCCTGG - Intronic
950704761 3:14772935-14772957 CCAGCCCAGCCCTGCCTCCCCGG + Exonic
953426078 3:42797925-42797947 CCCGGCCAGCCGTGCCATCCGGG + Intronic
953912256 3:46899058-46899080 CACGCCCCGCGCTGCCATCAAGG + Intronic
953912306 3:46899238-46899260 CCAGCCCAGCCCTGACTTCCCGG + Intronic
954080711 3:48211506-48211528 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
954538738 3:51380173-51380195 CCCCCCCAGCCCTCCCTGCCCGG + Exonic
954778914 3:53045479-53045501 CGCGCGCCGCGCTGCCTGCCAGG + Intronic
955297408 3:57747600-57747622 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
957091464 3:75734506-75734528 CACGGCAAGCTCTGCCTTCCAGG + Intronic
958532159 3:95348114-95348136 ACAGCCCAGTGCTGCATTCCAGG + Intergenic
959419407 3:106111996-106112018 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
959539863 3:107525222-107525244 CCGGCCCGGCGCTGCCATTCCGG - Intronic
960011001 3:112834675-112834697 CCAGCCAAGTGCTGCCTGCCAGG - Intronic
960862079 3:122164673-122164695 CCCGGCCAGCCGTGCCGTCCAGG + Intergenic
961604351 3:128082719-128082741 CCTGCCCAGCACTGCCGGCCCGG + Intronic
961619543 3:128212903-128212925 TCCTTCCAGGGCTGCCTTCCTGG + Intronic
961729280 3:128954582-128954604 CCCGGCCAGCCGTGCCATCCGGG + Intronic
962281739 3:134057319-134057341 TCCACCCAGAGATGCCTTCCTGG - Intergenic
963069003 3:141287022-141287044 CCCAACCTGTGCTGCCTTCCGGG - Intronic
967187671 3:186959319-186959341 GCCTCCCAGAGCTGCCTCCCAGG - Intronic
967959494 3:194909123-194909145 GCAGGCCAGCCCTGCCTTCCAGG + Intergenic
968449984 4:670959-670981 CCAGCCCTGCACTGCCCTCCTGG - Intergenic
968572186 4:1347536-1347558 CTCGCCTGGCGCTTCCTTCCGGG + Exonic
968775215 4:2536293-2536315 CCCGCGCCGCGCGGCCTTCTGGG - Intronic
968935525 4:3608157-3608179 TCTGCCCAGGGCTGCCTGCCAGG - Intergenic
969098373 4:4751211-4751233 CCCGCTCGGAGCTTCCTTCCTGG - Intergenic
970182579 4:13415492-13415514 CCCGGCCAGCCCTGCCGGCCCGG + Intronic
973593488 4:52465080-52465102 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
973619447 4:52712454-52712476 CCCGCCCCGCGCCGCCTCTCTGG + Intergenic
975783932 4:77867830-77867852 CACTGCCAGCTCTGCCTTCCGGG + Intronic
978062111 4:104351473-104351495 CCCTCCCAAGACTGCCTTCCTGG + Intergenic
980043664 4:127965693-127965715 CCCGCCCAGCTCCGCGTCCCCGG - Intronic
980576387 4:134687970-134687992 CCCCCCCAACGCTGCTTTGCTGG - Intergenic
981573245 4:146175966-146175988 GCCACCCAGCGGTCCCTTCCCGG - Exonic
981970495 4:150659693-150659715 CCCGGCCAGCCGTGCCATCCGGG + Intronic
983877946 4:172898847-172898869 ACAGCCCGGCGCTGCATTCCAGG + Intronic
985766671 5:1783658-1783680 CCAGCCCAGAGGTGCTTTCCTGG + Intergenic
985767504 5:1787636-1787658 CCCACACAGCCCTGCCCTCCCGG - Intergenic
985852471 5:2398680-2398702 CCAGCTTAGAGCTGCCTTCCTGG - Intergenic
985897374 5:2756615-2756637 CCCGCGCTGCGCTCCCTCCCAGG - Intergenic
986279586 5:6312423-6312445 GCCTCCCAGTGCTGCCTGCCAGG - Intergenic
987362513 5:17120103-17120125 CCCCCCCACCGCTTCCTGCCTGG - Intronic
988552055 5:32208217-32208239 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
988760602 5:34306728-34306750 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
989323619 5:40165269-40165291 CCCTCCCAAGGCTGCCTACCTGG + Intergenic
992050891 5:72939629-72939651 ACTGCCCAGCTCTGCCTCCCGGG - Intergenic
992373892 5:76171679-76171701 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
992431583 5:76715941-76715963 CCCGCCCCGCCCTGCCCTACTGG - Intergenic
992470043 5:77043598-77043620 CCCGGCCAGCCGTGCCATCCGGG - Intronic
995411011 5:111857153-111857175 CACTCCCAGCCCTGCTTTCCAGG - Intronic
997472808 5:134126111-134126133 CCCACCCACCTCTGCCTGCCTGG - Intronic
998432127 5:142076361-142076383 CCCGGCCAGCCGTGCCGTCCGGG - Intergenic
1001288328 5:170439387-170439409 CCCGGGCTGGGCTGCCTTCCAGG + Intronic
1001328245 5:170744770-170744792 CCAGCCCAGCGCCGGCTTCAGGG + Intergenic
1001542806 5:172551166-172551188 CACTCCCAGCCCTTCCTTCCCGG + Intergenic
1002013683 5:176305113-176305135 CCCGGCCAGCCGTGCCATCCAGG + Intronic
1002013778 5:176305334-176305356 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1002059878 5:176620017-176620039 CCCTCCCCGACCTGCCTTCCGGG + Intergenic
1002115832 5:176961608-176961630 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1002399862 5:178985625-178985647 CCCTGCAAGCTCTGCCTTCCGGG - Intronic
1002458794 5:179362156-179362178 CCCTCCCATCTCTGCCTCCCTGG + Intergenic
1002618064 5:180467714-180467736 CCCGACCTGCCCTGCCTGCCTGG - Intergenic
1002662778 5:180802850-180802872 CCCGCCCCGCCCCGCCTGCCGGG - Intronic
1003108246 6:3231525-3231547 CCCGCACTGCGCTGCGTTCGTGG - Intronic
1003325314 6:5086051-5086073 CCCTTTCAGCGCCGCCTTCCCGG + Exonic
1004042481 6:11994349-11994371 TCCGCCCACCTCGGCCTTCCAGG - Intergenic
1004388129 6:15189105-15189127 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1005971274 6:30763842-30763864 CCAGCCCCGAGCTGCCTGCCTGG - Intergenic
1006151617 6:31993003-31993025 CCTGCCCAGCCCTTCCTGCCCGG - Intronic
1006157918 6:32025741-32025763 CCTGCCCAGCCCTTCCTGCCCGG - Intronic
1006492316 6:34397637-34397659 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
1006503041 6:34470035-34470057 CCAGCCCAGCCCTCCCCTCCAGG - Intronic
1006505595 6:34486681-34486703 CCCCTGCAGGGCTGCCTTCCGGG + Intronic
1007475671 6:42118318-42118340 CAAGCCCAGCCCTGCCTGCCTGG - Intronic
1007625440 6:43243781-43243803 GCCTCCCAGCGCAGCCTTCTTGG + Intronic
1007816287 6:44527755-44527777 CCCTCCCTGGGCTGCCTTCATGG - Intergenic
1007825102 6:44594471-44594493 CCCTCCCAGGGCTACCCTCCCGG - Intergenic
1008841514 6:55909966-55909988 CCCGGCCAGCCGTCCCTTCCGGG - Intergenic
1010141737 6:72621536-72621558 ACAGCCCTGCCCTGCCTTCCAGG - Intergenic
1013612263 6:111806397-111806419 TCGGCCCAGCTCTGCCCTCCTGG + Intronic
1014551030 6:122789659-122789681 CCCGCCCAGCCCCGGCCTCCCGG - Intronic
1015476725 6:133664949-133664971 CCCGGCCAGCCATGCCGTCCGGG + Intergenic
1015879024 6:137852330-137852352 CCCACCCAGTGCTGCTTCCCAGG + Intergenic
1015924030 6:138291949-138291971 CCCGACCCCGGCTGCCTTCCCGG - Exonic
1016386767 6:143537096-143537118 CCTGCCCTGCGCTGGCTTCCCGG + Intronic
1018458273 6:163972121-163972143 CTGGCCCAGCGCCCCCTTCCAGG - Intergenic
1019128066 6:169854440-169854462 CCAGCCCACAGCTGCCTCCCTGG + Intergenic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1019587338 7:1812747-1812769 CCTGCCCAGCCCTGGCTGCCGGG - Intergenic
1019620350 7:1988746-1988768 GGCGGCCAGGGCTGCCTTCCAGG + Intronic
1019669174 7:2268518-2268540 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1020010550 7:4803692-4803714 CCTGCCCAGCGACGGCTTCCAGG - Exonic
1020096970 7:5374690-5374712 CACCCCCAGCGCTGCCTTTTGGG - Intronic
1020616472 7:10465901-10465923 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1021704507 7:23353335-23353357 CTTGCCCAGGTCTGCCTTCCAGG - Intronic
1021872333 7:25018622-25018644 CCCGGCCAGCCGTGCCGTCCGGG + Intergenic
1023417635 7:39948163-39948185 CCCACCCAGGCCTGCCCTCCTGG + Intergenic
1023817581 7:43962222-43962244 CCTGCACAGCTCTGCCTCCCAGG + Intergenic
1023879228 7:44309047-44309069 CCTGCCCAGCACTGCCCGCCTGG + Intronic
1023987100 7:45103106-45103128 ACCCCCCAGCGCTGCCTGGCAGG + Intronic
1024989129 7:55220208-55220230 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1026783376 7:73284341-73284363 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1027371133 7:77509347-77509369 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1027373720 7:77533499-77533521 CCCGGCCAGCCGTCCCTTCCGGG - Intergenic
1029468896 7:100741885-100741907 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1029525759 7:101092640-101092662 CCCGGCCAGCCGCGCCTTCCGGG + Intergenic
1029712583 7:102307721-102307743 CCCTCCCAGCTCTGTCATCCTGG + Intronic
1030063153 7:105639118-105639140 CCCCTCCAGGGCTGCCTTTCAGG + Intronic
1030278341 7:107743781-107743803 CCCGCGGAGAGCTGCCTTCTGGG - Exonic
1032011899 7:128352358-128352380 CCCGCCCGGCGCCCCCTGCCTGG - Exonic
1032463102 7:132126295-132126317 CCCACCCAAAGCTGCCTTCCTGG - Exonic
1033220585 7:139524212-139524234 CGCTCCCAGCGCTCCCCTCCGGG - Intronic
1033319564 7:140327317-140327339 CCCTCGCAGCCCCGCCTTCCTGG + Intronic
1034266433 7:149783313-149783335 CCTGCACAGCTCTGTCTTCCAGG + Intergenic
1034324793 7:150220569-150220591 TCTGCCCAGTGCTGCCTCCCCGG + Intergenic
1034443890 7:151101867-151101889 CCGGCCCACCTTTGCCTTCCAGG - Intronic
1034670141 7:152851627-152851649 CCCAGCCAGCACTGCCCTCCAGG - Intronic
1034768398 7:153748662-153748684 TCTGCCCAGTGCTGCCTCCCCGG - Intergenic
1035507920 8:149947-149969 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1035786591 8:2266148-2266170 ACAGCCCAGCGGTGCCCTCCAGG - Intergenic
1035806216 8:2455568-2455590 ACAGCCCAGCGGTGCCCTCCAGG + Intergenic
1035869470 8:3121517-3121539 GCTGCCCAGCGCTTCCCTCCAGG - Intronic
1036578927 8:10054737-10054759 CCAGCCCACGGCTTCCTTCCGGG - Intronic
1036794343 8:11744416-11744438 CCCACCCAGTGCTGGCATCCCGG - Intronic
1038414027 8:27380188-27380210 TCTGCCCAGCCCTGGCTTCCTGG + Intronic
1040918344 8:52587205-52587227 GCCTCCCAGAGCTGCGTTCCTGG + Intergenic
1041796609 8:61753148-61753170 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1042048981 8:64685795-64685817 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1042049002 8:64685844-64685866 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1044660655 8:94590873-94590895 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1044977661 8:97681733-97681755 TCCGCCCACCTCAGCCTTCCAGG + Intronic
1045438256 8:102185908-102185930 CCCCCCCAGCTCTCCTTTCCTGG + Intergenic
1045547417 8:103141002-103141024 GCCGCCCAGCGCCGCCGCCCCGG + Exonic
1047848093 8:128826524-128826546 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1047998700 8:130359008-130359030 TGCGCCCAGCGCTTCCTTCGCGG - Intronic
1048209293 8:132441476-132441498 CACGGCAAGCTCTGCCTTCCGGG - Intronic
1049552510 8:143267138-143267160 CCGGCCCCGCGCTGGCTCCCCGG + Intronic
1049592254 8:143467999-143468021 CCCTATCAGCGCTGCTTTCCGGG + Intronic
1049611649 8:143558702-143558724 CCCGCCCCCAGCTGCCTTCTGGG + Intronic
1049720490 8:144113320-144113342 CCAGTCCAGCTCTGCCTGCCAGG - Intronic
1049732237 8:144184675-144184697 CCAGCTCAGGGCTGCCCTCCGGG - Intronic
1049780790 8:144427965-144427987 CCGGCTCAGCGCTGCTCTCCCGG - Intronic
1049798912 8:144508882-144508904 CGCGCCCAGCACTGCCGGCCGGG - Intergenic
1049924588 9:396463-396485 CCAGCTCAGGTCTGCCTTCCAGG + Intronic
1054454659 9:65423700-65423722 TCTGCCCAGGGCTGCCTGCCAGG + Intergenic
1055137503 9:72841479-72841501 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1055317017 9:75043745-75043767 CCCTGCCACCTCTGCCTTCCAGG - Intergenic
1055414282 9:76064428-76064450 CCCGGCCAGCCGTGCCATCCGGG - Intronic
1055948337 9:81710481-81710503 CCCGGCCAGCTGTGCCATCCGGG + Intergenic
1056791386 9:89627554-89627576 CCGGCCCAGCGCTCCTTCCCGGG - Intergenic
1057869903 9:98709340-98709362 CCCGCCGACCGCTGACCTCCAGG + Intergenic
1058659882 9:107257525-107257547 CCCGGCCAGCCGTGCCATCCGGG - Intergenic
1058722587 9:107776333-107776355 CCCGGCCAGCCGTGCCATCCGGG + Intergenic
1058785055 9:108378783-108378805 TCTGCCCAGCTCTACCTTCCTGG - Intergenic
1058799352 9:108530243-108530265 GCCGGCCAGCGCTGCCGGCCCGG + Intergenic
1059211051 9:112514369-112514391 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1059801057 9:117749992-117750014 CCTCCCCAGTGCAGCCTTCCAGG + Intergenic
1060051974 9:120384248-120384270 CCTGCCCAGTGCTGCCCTCTCGG + Intergenic
1060064970 9:120495722-120495744 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1060661406 9:125407423-125407445 ACCGCCCACCACTGCCTACCGGG - Intergenic
1060687122 9:125623775-125623797 CCCGGCCAGCCGTGCCGTCCGGG + Intronic
1060803007 9:126556675-126556697 TCCCCCCAGGGCTGCCATCCTGG - Intergenic
1060812133 9:126615802-126615824 CCGGCCCAGCGCAGGATTCCGGG - Intronic
1061293553 9:129665711-129665733 CCCGCCCGGCGCTGACGTCGGGG - Exonic
1061293727 9:129666194-129666216 CCCGCCCCGCGCCGGCTCCCCGG - Intronic
1061909200 9:133713902-133713924 CCTGCTCAGCGCTGCCTCCCAGG - Intronic
1062102204 9:134734158-134734180 CTTGCCCACTGCTGCCTTCCCGG - Intronic
1062220483 9:135412625-135412647 CGAGCCCAGCGCAGCCTCCCGGG + Intergenic
1062351519 9:136141984-136142006 CCTGCCCAGCTCTGGCCTCCTGG + Intergenic
1062423800 9:136496959-136496981 CCCACCCAGCGCCGCCATCTCGG + Exonic
1062448595 9:136606163-136606185 CCAGCCAAGAGCTGCCGTCCAGG - Intergenic
1062568763 9:137174896-137174918 CCCGCCAGGCGCTGCCCTGCAGG - Exonic
1062633290 9:137477067-137477089 CCAGGCCAGGGCTGCCTTCTGGG - Intronic
1062717784 9:138019650-138019672 CCTGCCCAGTGCTTCCTTGCTGG + Intronic
1062732927 9:138119648-138119670 CCCGCCCAGTGGTACCCTCCTGG + Intronic
1203444387 Un_GL000219v1:41791-41813 CCAGCCCAGACCTGCCCTCCAGG + Intergenic
1185469344 X:373459-373481 CCCGGCGAGCCCTGCCCTCCCGG - Intronic
1185513626 X:681380-681402 CCCACCCAGGGCTGGCTTCGTGG - Intergenic
1188107272 X:26160125-26160147 CCTGCCCAGCACTTCTTTCCGGG - Intergenic
1188477138 X:30602420-30602442 CCCGGCCAGCCATGCCATCCGGG + Intergenic
1190233947 X:48601895-48601917 CCCGCCCAGAGCAGCCGGCCAGG - Exonic
1190598295 X:52067218-52067240 CCGGCCCAGCACAGCCTTCCTGG - Exonic
1190610529 X:52186855-52186877 CCGGCCCAGCACAGCCTTCCTGG + Exonic
1192205272 X:69091621-69091643 CCCGCCCTGCACTGGCTTCTTGG + Intergenic
1192621259 X:72681464-72681486 CCCGGCCAGCCGTGCCATCCGGG + Intronic
1195088061 X:101431617-101431639 CCCTGCAAGCTCTGCCTTCCGGG + Intronic
1195158070 X:102142456-102142478 CCCGCCCAGCGGTCCGGTCCAGG - Exonic
1195275395 X:103276124-103276146 CCCGCCTCCCGCTGCCTTGCAGG + Intronic
1196869728 X:120101329-120101351 ACAGCCCAGCACTGCATTCCAGG + Intergenic