ID: 1133012384

View in Genome Browser
Species Human (GRCh38)
Location 16:2921363-2921385
Sequence TTGCTTCTAAAGCCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133012378_1133012384 17 Left 1133012378 16:2921323-2921345 CCAAGTATCACCACCATCAATTT 0: 2
1: 0
2: 3
3: 17
4: 181
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158
1133012381_1133012384 4 Left 1133012381 16:2921336-2921358 CCATCAATTTTAGGACTTTTTTT 0: 1
1: 0
2: 12
3: 102
4: 945
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158
1133012380_1133012384 7 Left 1133012380 16:2921333-2921355 CCACCATCAATTTTAGGACTTTT 0: 2
1: 1
2: 33
3: 305
4: 883
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133012384 Original CRISPR TTGCTTCTAAAGCCAGAGGG AGG Intronic