ID: 1133012384

View in Genome Browser
Species Human (GRCh38)
Location 16:2921363-2921385
Sequence TTGCTTCTAAAGCCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133012381_1133012384 4 Left 1133012381 16:2921336-2921358 CCATCAATTTTAGGACTTTTTTT 0: 1
1: 0
2: 12
3: 102
4: 945
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158
1133012378_1133012384 17 Left 1133012378 16:2921323-2921345 CCAAGTATCACCACCATCAATTT 0: 2
1: 0
2: 3
3: 17
4: 181
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158
1133012380_1133012384 7 Left 1133012380 16:2921333-2921355 CCACCATCAATTTTAGGACTTTT 0: 2
1: 1
2: 33
3: 305
4: 883
Right 1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133012384 Original CRISPR TTGCTTCTAAAGCCAGAGGG AGG Intronic
900751020 1:4397595-4397617 TTCCTTTTAAAACCAGAGTGAGG + Intergenic
902037168 1:13466433-13466455 TAGCTCCAGAAGCCAGAGGGAGG + Intergenic
902817368 1:18923998-18924020 TTATTTCCAAAGCCAGACGGGGG + Intronic
906899992 1:49824539-49824561 TTGCTTCTGAAACCATAGGTTGG - Intronic
908061377 1:60353520-60353542 TTGCTTTAAAAGACAGAAGGTGG - Intergenic
910429847 1:87149703-87149725 TTGTTTATAAGGCCAGAGTGAGG - Intronic
910587559 1:88896194-88896216 TTGCTTCTAAAGGCTTAGAGAGG + Intergenic
912213956 1:107585946-107585968 GTGCTTCTAGAGCCAGTGGCTGG + Intronic
912940755 1:114042586-114042608 TAGCAACTAAAGCCAGAGGTAGG - Intergenic
918636084 1:186775977-186775999 GAGCCTCTGAAGCCAGAGGGAGG - Intergenic
919677949 1:200405262-200405284 TAGCTGCTAAAGCTAAAGGGAGG + Exonic
921586245 1:216949178-216949200 TTTCATCTAAATCCAGAAGGAGG - Intronic
924588057 1:245377209-245377231 TTGCTTTTAAAGCCACAGGCTGG - Intronic
1063032764 10:2252638-2252660 TTTCTTCTAAAGAAAGAGGGAGG - Intergenic
1064190542 10:13201956-13201978 TTGAGTCTCAAGCCAGAGTGTGG + Intronic
1064799820 10:19057146-19057168 TTGATAATAAAGCCAGATGGGGG - Intronic
1066233906 10:33467189-33467211 TTTCTTTTAGAGTCAGAGGGAGG + Intergenic
1074065684 10:110010754-110010776 TTGGTTCTGAAGCCAGAGTCTGG + Intronic
1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG + Intergenic
1074558320 10:114512431-114512453 CTGCTTCTGAATCCAGAGGAAGG + Intronic
1076723365 10:132402309-132402331 TGGCTACGACAGCCAGAGGGAGG - Intronic
1080625783 11:34029430-34029452 TTGCCACCAAAGCCAGAGGTAGG + Intergenic
1084201475 11:67561486-67561508 TAGAGTCTAAAGCCTGAGGGTGG - Intergenic
1085759286 11:79227953-79227975 GTCCTTCTAAACCCAGTGGGTGG + Intronic
1088599144 11:111460174-111460196 TGGTTTCTAAAGCCAGTGGTGGG + Intergenic
1088749401 11:112831178-112831200 TTGCTTGTAGAGCAAGATGGTGG - Intergenic
1089527401 11:119106510-119106532 TGGCTTCTGAGGCCAGAGGTTGG + Intronic
1089975574 11:122728896-122728918 TTACTTCCAAAGTGAGAGGGAGG - Intronic
1090621417 11:128564204-128564226 TTGCTGATCAAGCCTGAGGGTGG + Intronic
1093302296 12:17472101-17472123 TTGCTTCTTAATCAATAGGGAGG + Intergenic
1095636271 12:44437209-44437231 TCACCTCTAAAGCCAGATGGTGG - Intergenic
1098813219 12:75122566-75122588 TTGATTCTAAAGCCATGTGGAGG - Intronic
1099151637 12:79121494-79121516 TTGCTTCTAGAATCAGAGAGAGG - Intronic
1100662623 12:96716713-96716735 TTGCCTAGAAAGCCATAGGGTGG + Intronic
1105684498 13:22765657-22765679 TTGCTTCTAAAAGCAGGGTGTGG - Intergenic
1108992713 13:56682083-56682105 TTGCCTCTAAAAGCAGAGGTTGG - Intergenic
1109388356 13:61663577-61663599 TTGCTTTTAAAGCCATAAGGTGG - Intergenic
1111236364 13:85413980-85414002 TTGTTTCTAAATCCAGATAGAGG - Intergenic
1112764634 13:102727775-102727797 GTGCTTCGAAAGCCTGAGGTGGG + Intergenic
1114690353 14:24574808-24574830 TTGCTGCAAAAGCAAGAGGTAGG + Exonic
1114810462 14:25892933-25892955 TTGCTTCTAGCCTCAGAGGGTGG - Intergenic
1115834565 14:37385381-37385403 TTGCTTTAAAAAACAGAGGGCGG + Intronic
1115846583 14:37542386-37542408 TTGCAACTGAAGCCAGAGGAGGG - Intronic
1117007909 14:51441152-51441174 CTCCTTCTGCAGCCAGAGGGCGG + Intergenic
1117928237 14:60808018-60808040 ATGCTTTTAAAGCTAGAGAGGGG + Intronic
1124515022 15:30360627-30360649 TTGCTTCTAATCCCTGAGGTGGG - Intergenic
1124727900 15:32170100-32170122 TTGCTTCTAATCCCTGAGGTGGG + Intronic
1124919901 15:34015590-34015612 TAGCTCCTAAAGACCGAGGGTGG - Intronic
1125736879 15:41933148-41933170 TTCCTTAGAAAGACAGAGGGAGG - Intronic
1126322445 15:47439710-47439732 TGGCCTCTAAACCCACAGGGTGG - Intronic
1127895088 15:63291281-63291303 TTTCTTCTAAAGCATAAGGGAGG - Intronic
1128533504 15:68471338-68471360 CTGCTTTTAAAGCCACAGGAAGG + Intergenic
1131064256 15:89423484-89423506 TTGCTTCTAAAGCCACACCAGGG + Intergenic
1131744541 15:95432475-95432497 TTGATTCAAAAGCAAGAGAGAGG + Intergenic
1133012384 16:2921363-2921385 TTGCTTCTAAAGCCAGAGGGAGG + Intronic
1136295604 16:29300338-29300360 TGTCTTCTGAAGGCAGAGGGTGG - Intergenic
1138630946 16:58293693-58293715 GTGCAGCTAAAGTCAGAGGGAGG + Intronic
1139639584 16:68281380-68281402 TTGCTTCTAATGGTAGAGGTCGG + Intronic
1139829743 16:69787686-69787708 TGGCATTTAAAGCCAGAGGTTGG - Intronic
1140577592 16:76189476-76189498 TTGCTTCTATAGCAAGCGAGTGG - Intergenic
1142011092 16:87714506-87714528 TTCCTGCTGAAGCCAGAGGACGG - Exonic
1142101521 16:88274525-88274547 TGTCTTCTGAAGGCAGAGGGTGG - Intergenic
1144123264 17:12177586-12177608 CTGTTTCTTAAGCCAGATGGTGG + Intergenic
1145902206 17:28496395-28496417 TTGGTCCCCAAGCCAGAGGGAGG - Intronic
1146462441 17:33056832-33056854 TTCCTTCTGAAGCCAGAGAGGGG + Intronic
1149478957 17:56986187-56986209 TAGCTTCTAATGCGAGAGGGAGG - Intronic
1152275900 17:79356960-79356982 TAGCTTCTCAAGCAAGAGGTGGG - Intronic
1157495332 18:48153139-48153161 TTGCCTTTAAAGGCATAGGGAGG + Intronic
1157654873 18:49375237-49375259 TTTCTTCTAAAGCCCAAGGTAGG - Intronic
1158031772 18:52974550-52974572 TTGCTTGAAAAGCCACAGGGTGG + Intronic
1160770373 19:828372-828394 CTGCTTCCAAAGCCAGTGAGGGG + Exonic
1163267932 19:16232856-16232878 TTGCTCCTCAAGGCAGAGAGAGG + Intronic
1166371522 19:42303977-42303999 TTGATTTTAAAGTCTGAGGGAGG + Intronic
1167710085 19:51105051-51105073 TTGACTCTAAGGGCAGAGGGAGG + Intronic
1167798574 19:51726440-51726462 ATGTTTCTAAAACCAGAGTGCGG + Intergenic
1167929381 19:52851652-52851674 TGGCTTCTTGAGCCTGAGGGTGG + Intronic
927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG + Intergenic
932396592 2:71453316-71453338 TTGCTTTTAAAGCCAGAAAAAGG + Intergenic
933286274 2:80387692-80387714 TTGAATTTAAAGCCAGAGGATGG + Intronic
934115452 2:88787020-88787042 GTACTGCTAAAACCAGAGGGAGG + Intergenic
934631195 2:95924974-95924996 GTACTGCTAAAACCAGAGGGAGG - Intronic
934802849 2:97184010-97184032 GTACTGCTAAAACCAGAGGGAGG + Intronic
934833354 2:97556559-97556581 GTACTGCTAAAACCAGAGGGAGG - Intronic
934968955 2:98747804-98747826 TTGTTTTTAAAGCCAGAGTAAGG + Intergenic
936797199 2:116221465-116221487 CTGCTACTAAAGCCAGGGGATGG + Intergenic
937870637 2:126783466-126783488 TGGCTTCTGGGGCCAGAGGGAGG - Intergenic
941024481 2:160443264-160443286 CTGCTTCTAAGTCCAGAGGAGGG - Intronic
942160953 2:173186267-173186289 TTGATTCTAAAGCAAGAGAGAGG + Intronic
942933441 2:181524975-181524997 TTGCTTCTAATGCTAGATAGAGG - Intronic
943060154 2:183034682-183034704 TTGCTTCTGAAGGTAGAGGATGG - Intronic
943770225 2:191708569-191708591 TCCCTTCTGAAGCCAGAGGATGG - Intergenic
943813775 2:192224741-192224763 CTGCTTCTAAAGCAAGTTGGGGG + Intergenic
945279040 2:208018037-208018059 TTGCAGCTAAAGCCACAGGATGG - Intronic
946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG + Intergenic
948239089 2:236413880-236413902 TTGTTTCTAAAGCCAATGTGAGG + Intronic
948276009 2:236709327-236709349 TTGCTTGTAAAAACAGAGAGTGG - Intergenic
1169445663 20:5669229-5669251 GTGCTCATAAAGCCAGAGGCTGG + Intergenic
1170892330 20:20386784-20386806 TGGCTTCTGGAGCCAGAGAGAGG + Intergenic
1171238768 20:23548439-23548461 TTTCTTCAAAAGGCAGAGGAAGG + Intergenic
1172706660 20:36887169-36887191 CTGCTTCCAAAGCTGGAGGGAGG - Intronic
1175297100 20:57916010-57916032 AAGCTTCTAAAGCCATAAGGAGG + Intergenic
1177330495 21:19654371-19654393 TTGCTTCAAAAGCCAGGAGCTGG - Intergenic
1181023197 22:20113985-20114007 TGGCTTTTAAAGCCAGGGGCTGG - Intronic
1181424493 22:22824570-22824592 AGGCTTCCACAGCCAGAGGGAGG - Intronic
1181424498 22:22824590-22824612 AGGCTTCCACAGCCAGAGGGAGG - Intronic
952737649 3:36706243-36706265 ATGCTTCTAATACCAGGGGGAGG - Intergenic
955463139 3:59207792-59207814 TTGGCTCTAAAGCCACAGGGTGG + Intergenic
955543274 3:60000576-60000598 TGGCTACTAAATCAAGAGGGAGG + Intronic
955655465 3:61240495-61240517 TTGTTTCTATAGCCAGTTGGAGG - Intronic
957462198 3:80535559-80535581 TTACTTCTAAGGTAAGAGGGAGG + Intergenic
960020615 3:112948162-112948184 TTGAATATAAAGCAAGAGGGGGG - Intronic
961299651 3:125914665-125914687 TTTCATCTAAATCAAGAGGGTGG - Intergenic
962859978 3:139390158-139390180 AGGCTTCTGAAGTCAGAGGGAGG + Intergenic
964323881 3:155526084-155526106 TTGCTTCCAGAATCAGAGGGTGG + Intronic
966247707 3:177826834-177826856 TTTCTTCTAAAGCCAAAGCCAGG + Intergenic
966497450 3:180597006-180597028 TTGTTGCTTAAGCCAGATGGAGG - Intergenic
967572793 3:191050615-191050637 TTGGTTATAAAGCTAGGGGGAGG - Intergenic
968181194 3:196596553-196596575 TTGCTTCTCAGGGCAGAGGCTGG - Intergenic
969624969 4:8297733-8297755 TGGCTTCTAAATCCAGGGGGTGG - Intronic
970210544 4:13705600-13705622 CCGGTTCCAAAGCCAGAGGGCGG - Intergenic
971256318 4:25016927-25016949 CAGCTTCTAAAGCCAGAGAGAGG - Intronic
973633275 4:52839077-52839099 TTGCTTCTGGAGCCCAAGGGAGG + Intergenic
975240228 4:72048872-72048894 TTGCTTATAGAGCCACAGTGAGG + Intronic
976077953 4:81320915-81320937 TTGCTTGAAAACCCAGAAGGTGG - Intergenic
977994089 4:103481838-103481860 TTGCTTCTCAAGTCTCAGGGCGG + Intergenic
979531836 4:121776609-121776631 CTGATACGAAAGCCAGAGGGAGG - Intergenic
980532334 4:134071546-134071568 TTGCCTCAAAAGGCATAGGGTGG - Intergenic
982522470 4:156436161-156436183 TTGGTTCTAAATCAAAAGGGAGG + Intergenic
985760069 5:1744234-1744256 TTCCTTCTGAAGGCCGAGGGAGG - Intergenic
988576141 5:32426816-32426838 TTGCTTGAAAACCCAGGGGGCGG + Intronic
990043485 5:51399560-51399582 TTGCTTCCAAAGCCCGGAGGCGG + Intergenic
990793798 5:59516488-59516510 TTTCTTCTAGAGCAATAGGGAGG - Intronic
990839713 5:60063479-60063501 TTGCTTCTAGCCTCAGAGGGTGG + Intronic
992211909 5:74488458-74488480 TTACCTCTAAAACCAGAGGGAGG - Intergenic
992330409 5:75711432-75711454 ATGCTTCATAAGCCAGAAGGTGG - Intronic
994396685 5:99231067-99231089 TTACTTCTAATGTCACAGGGGGG + Intergenic
1000450404 5:161379624-161379646 CTGCTTCTATAGCCAGAGTGTGG - Intronic
1001692357 5:173642546-173642568 TTGCTTCTGTAGCCTCAGGGAGG - Intergenic
1001855351 5:175005621-175005643 TTGGTTCTTAGACCAGAGGGAGG + Intergenic
1004086699 6:12456493-12456515 TTGCTTCTAAAGAAATAGTGTGG + Intergenic
1004098371 6:12582462-12582484 CTTCCTCTATAGCCAGAGGGAGG - Intergenic
1007196509 6:40066215-40066237 TTCCCTCTGAAGCCAGAGGCAGG - Intergenic
1008346335 6:50431809-50431831 TTTCTTCAAGAGCCAGAAGGTGG + Intergenic
1008546149 6:52585458-52585480 TTGCTTCTAAAGTGAGAAAGTGG - Intergenic
1014229922 6:118892011-118892033 TTGCCTCTGAAACCAGAGAGAGG + Intronic
1023438298 7:40161037-40161059 TTGCTTCCAAAGACAGAGGTAGG - Intronic
1023560448 7:41467955-41467977 CTGCTTTAAAAGCCAGAGGCTGG + Intergenic
1024230000 7:47356459-47356481 CTGCTTCTACCTCCAGAGGGTGG - Intronic
1025761773 7:64402571-64402593 TTGCTTCTGAAGCCAGGAGATGG - Intergenic
1027601863 7:80249185-80249207 AATCTCCTAAAGCCAGAGGGAGG - Intergenic
1028871717 7:95777461-95777483 TTGCTTCTAAATCCTGGGAGGGG + Intronic
1034297794 7:149989782-149989804 TTGGTTCTAAACCCAGAAGTGGG + Intergenic
1034745762 7:153522596-153522618 TTGTTTCAAATTCCAGAGGGAGG - Intergenic
1034808228 7:154107073-154107095 TTGGTTCTAAACCCAGAAGTGGG - Intronic
1035076585 7:156181681-156181703 TTGCTTTTAGAGCCAGAAGGTGG + Intergenic
1036907368 8:12718616-12718638 TTGCTGCTAATGTCACAGGGAGG + Intergenic
1040693095 8:49962996-49963018 GTGCTTCTCAAGCCAGAGGCGGG + Intronic
1042477699 8:69267495-69267517 TTGTTTCTAATGACACAGGGAGG + Intergenic
1043888667 8:85632100-85632122 TGGCCTCTAAAGGCAGAGAGAGG + Intergenic
1044117859 8:88356354-88356376 TTGCTTCTGGAGGCAGAGGGGGG - Intergenic
1046041784 8:108914519-108914541 TTGCTTCTTCAGCCTGGGGGTGG - Intergenic
1047033181 8:120906052-120906074 TTGCTTTTCAAGCAAGAGGAAGG - Intergenic
1047745608 8:127842724-127842746 TCTCTTCTGAAGCAAGAGGGAGG - Intergenic
1049094827 8:140542222-140542244 TTCCTTCCGCAGCCAGAGGGTGG - Intronic
1052473698 9:28931806-28931828 TTGCTTCAAAAGGCAGTGGCGGG + Intergenic
1055581522 9:77711385-77711407 TTGCTCCTCAGGCCAGAGGATGG - Intergenic
1060223329 9:121775703-121775725 TTGAATCTAAAGCCAGGGGGTGG - Intronic
1062352575 9:136146278-136146300 TTCCTTCTAAGGCCTGAGTGAGG - Intergenic
1185874355 X:3690157-3690179 TTGCTGCTATAACCAGTGGGTGG + Intronic
1188415470 X:29927875-29927897 ATGCTTCAAAAGCAGGAGGGAGG + Intronic
1193713329 X:84905075-84905097 TTGCTTGTAATACCAGAGAGAGG + Intergenic
1194162933 X:90477749-90477771 TTGCTTATAAAACCAGATGTAGG + Intergenic
1195220268 X:102739597-102739619 TGGCTTAAAAAGCAAGAGGGTGG + Intronic
1197355536 X:125434440-125434462 TTCCTTCTCAAACCAAAGGGTGG - Intergenic
1200509207 Y:4055481-4055503 TTGCTTATAAAACCAGATGTAGG + Intergenic
1200873357 Y:8126360-8126382 TTTGTTCTTAAGGCAGAGGGAGG + Intergenic