ID: 1133012539

View in Genome Browser
Species Human (GRCh38)
Location 16:2922469-2922491
Sequence CAGGGGCAGGAGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2650
Summary {0: 1, 1: 1, 2: 19, 3: 273, 4: 2356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133012539_1133012557 24 Left 1133012539 16:2922469-2922491 CCCTCCTCATCCTCCTGCCCCTG 0: 1
1: 1
2: 19
3: 273
4: 2356
Right 1133012557 16:2922516-2922538 CCATAAGTTTGACTGCCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 104
1133012539_1133012555 23 Left 1133012539 16:2922469-2922491 CCCTCCTCATCCTCCTGCCCCTG 0: 1
1: 1
2: 19
3: 273
4: 2356
Right 1133012555 16:2922515-2922537 CCCATAAGTTTGACTGCCCTGGG 0: 1
1: 0
2: 1
3: 7
4: 128
1133012539_1133012553 22 Left 1133012539 16:2922469-2922491 CCCTCCTCATCCTCCTGCCCCTG 0: 1
1: 1
2: 19
3: 273
4: 2356
Right 1133012553 16:2922514-2922536 CCCCATAAGTTTGACTGCCCTGG 0: 1
1: 0
2: 1
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133012539 Original CRISPR CAGGGGCAGGAGGATGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr