ID: 1133012910

View in Genome Browser
Species Human (GRCh38)
Location 16:2924861-2924883
Sequence CTGTTGAAGCACATGTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133012906_1133012910 20 Left 1133012906 16:2924818-2924840 CCGGCGGTCAGGGCCTTTTCTTG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG 0: 1
1: 0
2: 1
3: 19
4: 151
1133012908_1133012910 7 Left 1133012908 16:2924831-2924853 CCTTTTCTTGTATTGGAACTTTT 0: 1
1: 0
2: 4
3: 32
4: 422
Right 1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG 0: 1
1: 0
2: 1
3: 19
4: 151
1133012905_1133012910 27 Left 1133012905 16:2924811-2924833 CCACAAGCCGGCGGTCAGGGCCT 0: 1
1: 0
2: 1
3: 12
4: 89
Right 1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG 0: 1
1: 0
2: 1
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133012910 Original CRISPR CTGTTGAAGCACATGTGTCT TGG Intronic
901294232 1:8148093-8148115 CTGTTCAAGCCCTTGTTTCTGGG - Intergenic
903594001 1:24480075-24480097 CTGCTGAAGGACATGGGACTCGG - Intergenic
905027768 1:34862942-34862964 CCATGGAAGCACATGTGTGTTGG - Intergenic
908887576 1:68807452-68807474 CTTTTCAAACAGATGTGTCTCGG + Intergenic
909728371 1:78863967-78863989 CTGGTTAAGAACATGTGTCCTGG - Intergenic
909866314 1:80676818-80676840 CTGTTGAACCTTATGTGGCTTGG + Intergenic
909942429 1:81626092-81626114 GTGTTGAAGCCCCTGTGTTTTGG - Intronic
911153086 1:94613802-94613824 CAGTTGAAGAAAATGTGTTTAGG + Intergenic
911153990 1:94621654-94621676 TTGATGAACCAAATGTGTCTGGG - Intergenic
912221619 1:107683882-107683904 CTGTTGTTGCTCATATGTCTTGG - Intronic
913368771 1:118072818-118072840 CTGTACATGCACATGTGTGTTGG + Intronic
915163062 1:153933159-153933181 GTGTTCAAGCACATCTGTGTGGG + Intronic
915526984 1:156481933-156481955 CTGTTGAAGGACATGAGCTTTGG - Intronic
918585882 1:186187921-186187943 ATGTTGAAGCACATGCGATTGGG - Exonic
919085420 1:192915406-192915428 TTGTGGAAGCACATGTCTGTTGG + Intergenic
922357014 1:224786012-224786034 CTGTAGAAGCACTAGTGTCCTGG + Intergenic
923259054 1:232249396-232249418 CTGTGGAAGCCCCTGTGTTTGGG - Intergenic
1063633631 10:7759018-7759040 CTGTTAGAGAATATGTGTCTAGG - Intronic
1065238168 10:23676262-23676284 CTGTTGAAGAACATATGGATTGG + Intergenic
1066373334 10:34836064-34836086 CTGTTTAAGCCCATGTGACTTGG - Intergenic
1067070490 10:43127247-43127269 CTGATGGAGGACATGTGGCTGGG - Intronic
1069216141 10:65823745-65823767 CAGTTTAAGCAAATGTCTCTGGG + Intergenic
1069244260 10:66182610-66182632 ATTTTGAAGTACATGGGTCTTGG - Intronic
1070838875 10:79469380-79469402 CAGATGAAGCAGATGTGTCCTGG + Intergenic
1071008383 10:80910092-80910114 CTGGTGAAGGAAATGGGTCTTGG + Intergenic
1072090101 10:92118958-92118980 CTGGTGAAGTCCCTGTGTCTGGG + Intronic
1073088030 10:100907856-100907878 CTCTTAAAGCAAATGTCTCTTGG - Intergenic
1073515335 10:104070912-104070934 CTGTTGAAGCATCTGTTTCAAGG - Intronic
1084503824 11:69553005-69553027 CTGTCAAGGTACATGTGTCTGGG + Intergenic
1085848059 11:80088108-80088130 CTGTAGGTGCACATGTTTCTCGG + Intergenic
1087719937 11:101651410-101651432 CTGATAAAGCCCATGTGTTTTGG + Intronic
1087848462 11:103000395-103000417 ATGTTGAAAAACATGTGGCTAGG - Intergenic
1088186922 11:107180938-107180960 ATGTTGAAACACATGAGACTGGG + Intergenic
1089584005 11:119498428-119498450 CTGTTGAAGCACATCTGGATGGG + Intergenic
1089875301 11:121715582-121715604 CGGTTCAAGCAACTGTGTCTAGG + Intergenic
1092461946 12:8694698-8694720 CTGTTGATTCTCATGTGTCTAGG + Intronic
1097213474 12:57391179-57391201 CTGTTGAAGGACTTCTGTGTTGG - Intronic
1097689849 12:62724463-62724485 CTGTTGAGGCAGATGTCTGTGGG + Intronic
1100208052 12:92372807-92372829 TTGTTGAAGCACATCTGTATCGG + Intergenic
1101699715 12:107160886-107160908 ATGATGAAGGACATGTGACTGGG - Intergenic
1101798423 12:107999930-107999952 CTATTGTAGCACCTGGGTCTTGG + Intergenic
1103432685 12:120902720-120902742 CTCTTGAAGCAAATGTGGTTTGG - Intronic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1106676987 13:31971000-31971022 GTGGTGAAGCCCATGAGTCTGGG - Intergenic
1108195129 13:47985995-47986017 CTTTTTAATCACATGTGTGTTGG + Intronic
1113957602 13:114107624-114107646 CTGTGGAAGCGACTGTGTCTAGG + Intronic
1114251874 14:20968746-20968768 CTGTTGGAGGACAGGAGTCTGGG + Intergenic
1114286429 14:21248341-21248363 ATCTTGAAACACATGTGTCTAGG - Intronic
1117519879 14:56540806-56540828 CTTTAGAAGCTCAAGTGTCTGGG + Intronic
1117783808 14:59261480-59261502 CTGTTGAAGCATATGTCTCCTGG - Intronic
1119653827 14:76402488-76402510 CTGTTGAATCCCATGACTCTGGG + Intronic
1119841926 14:77799975-77799997 CTGTGGAGGCACAGGGGTCTCGG - Intergenic
1120153053 14:81059050-81059072 ATGCCGGAGCACATGTGTCTGGG + Intronic
1121466795 14:94120878-94120900 CTGTTTGAGCACGTGTGTCCTGG + Intergenic
1121904317 14:97725679-97725701 ATGTTGAAGCCCATGGGTTTTGG - Intergenic
1123125031 14:105940395-105940417 CTGCTGAAGAACATGGCTCTAGG - Intergenic
1125441562 15:39709038-39709060 CTGCTGATACACATTTGTCTTGG - Intronic
1127495914 15:59511992-59512014 CTGTTGATGGACATTTGTTTTGG - Intronic
1129050188 15:72774659-72774681 CTGTTGAAACACAGATTTCTGGG - Intronic
1132172843 15:99680104-99680126 CTGCTGAAGCAGCTGAGTCTGGG + Intronic
1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG + Intronic
1134228633 16:12411930-12411952 TTGTTGAATCAAATGTCTCTGGG + Intronic
1135458781 16:22623020-22623042 TTGGTGAAGCACATGGGTCTTGG - Intergenic
1137277863 16:46948833-46948855 GTGTTGAAGCACATGAGCTTTGG + Intergenic
1138358833 16:56408844-56408866 CTGTAGATGCACATTTATCTGGG + Intronic
1142322429 16:89392587-89392609 GTGTTGAAGCAGACCTGTCTTGG + Intronic
1144185458 17:12791213-12791235 ATGTTAAAGCACATGTGTTTGGG - Intronic
1144440139 17:15273809-15273831 CTGTGGTGGCTCATGTGTCTAGG - Intergenic
1146898715 17:36566262-36566284 TTGTTGCAGCACATTTATCTTGG - Intronic
1152540239 17:80971137-80971159 CTCTTGGAGCACATGTCCCTCGG + Intergenic
1156068194 18:33171691-33171713 CTGTTGGAGCAAATGTGTAGAGG + Intronic
1156719543 18:40052974-40052996 CTGTTGAAGAACATTTGTGTTGG + Intergenic
1158096998 18:53784216-53784238 CTGTTAAATCACCTGTGTCAAGG - Intergenic
1158365419 18:56728798-56728820 CTCTTGATGCACATGCTTCTGGG + Intronic
1158814686 18:61080889-61080911 CTGTTGATGCAAATGTGACTTGG + Intergenic
1158814768 18:61082560-61082582 CTGTTGATGCAAATGTGACTTGG + Intergenic
1161791490 19:6362515-6362537 CTGTTGATGTACATGTGGATGGG - Exonic
1161809212 19:6462021-6462043 CTGTTCCAGCACACCTGTCTAGG - Intronic
1163791429 19:19308617-19308639 CTGATGCAGCTCAGGTGTCTCGG + Intronic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
925579402 2:5395335-5395357 CTGTAGAAGCACATGTGCTAGGG + Intergenic
925903895 2:8527713-8527735 GGGTTGAAGCCCAGGTGTCTTGG + Intergenic
926927964 2:18007332-18007354 TTGTTGAAACACATGTTTCTGGG + Intronic
927946407 2:27137614-27137636 CTTTTGCAGCACCTGTGGCTAGG - Exonic
928810859 2:35224121-35224143 TTGTTTATGCACATGTGTATAGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931259530 2:60605153-60605175 CTGTCAAGGCAGATGTGTCTTGG - Intergenic
931721569 2:65070897-65070919 GTGTTGAAGGACATGGGTTTTGG - Intronic
933795357 2:85915131-85915153 CTCTTGAAGCACATGTGACATGG + Intergenic
937499300 2:122461141-122461163 CTGTGGAAGCAGATGCGTCAAGG + Intergenic
938819299 2:134938688-134938710 CTCTTGAAGCACCAGTGCCTAGG + Intronic
940002612 2:148981560-148981582 CGGTTGGAGCATTTGTGTCTAGG + Exonic
940341779 2:152589019-152589041 CTGATGAAGCAGATGACTCTCGG - Intronic
941296314 2:163742912-163742934 CTTTTAAAGCACAGGTATCTTGG + Intergenic
941774585 2:169378540-169378562 CTGTTAAAGCACATATGTGTCGG + Intergenic
942395104 2:175538857-175538879 CTGCTGTAGCACATCTGTCTTGG + Intergenic
944846143 2:203670081-203670103 CTGTGGAATCCTATGTGTCTGGG + Intergenic
944965871 2:204932661-204932683 CTTTGGAAGTAAATGTGTCTAGG + Intronic
945070225 2:205981929-205981951 CTGTATAAGCACATGTGAGTAGG - Intergenic
946126834 2:217570065-217570087 CTGTTGAAGTGCATTTGTGTTGG - Intronic
946173610 2:217909545-217909567 CTGTTGACCCACAGGTGCCTGGG + Intronic
947515133 2:230797058-230797080 CTGTTGATACACTTGTGTGTTGG + Intronic
948495462 2:238345856-238345878 CTGTGGAAGCACAGGCGTCGGGG + Intronic
1169112382 20:3042642-3042664 CTGCTGAAGTCCAGGTGTCTAGG + Intergenic
1173419008 20:42884062-42884084 ATGTTTAAGCAGAGGTGTCTTGG + Intronic
1173775498 20:45702929-45702951 GTGTGGTAGCTCATGTGTCTGGG + Intronic
1174376759 20:50131150-50131172 CTCTCCAAGCACATGAGTCTTGG - Intronic
1175390333 20:58623112-58623134 CTGGTTAAGCACATGGGTTTTGG - Intergenic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
1182067762 22:27442618-27442640 CTTTTCAAGAACAAGTGTCTTGG - Intergenic
1184422997 22:44392617-44392639 CTGTTGCATCACATGTGTGATGG + Intergenic
951645232 3:24882796-24882818 CTGGTTAAGCACATGTCTATAGG - Intergenic
952055284 3:29436749-29436771 CTGTTGACACACAGATGTCTGGG + Intronic
952490605 3:33868587-33868609 CTTTTTAATCACCTGTGTCTGGG + Exonic
953849299 3:46454030-46454052 CTGCATGAGCACATGTGTCTTGG + Intronic
955422966 3:58758424-58758446 ATTCTGAAGCACAGGTGTCTGGG - Intronic
955437433 3:58916784-58916806 TTGTTGAAGCATATGAGTATTGG - Intronic
957953610 3:87155343-87155365 TTGTTGGAGCTTATGTGTCTTGG + Intergenic
961960135 3:130845972-130845994 TTGTTAAAGCACAGGTGGCTGGG - Intergenic
962717583 3:138140082-138140104 TTGTTGAATAACTTGTGTCTTGG + Intergenic
965271655 3:166623718-166623740 CTGTGGAAGCACATGCCACTGGG - Intergenic
969677052 4:8620036-8620058 CAGCTGAAGCTCATGTGTCCTGG + Intergenic
970166654 4:13245196-13245218 CTGTAGAACCACATGTGTATAGG - Intergenic
977976517 4:103272887-103272909 CTGGTGAAGAAAATGTCTCTTGG - Intergenic
978840066 4:113201289-113201311 TTGTTGAAACCCATGTTTCTAGG + Intronic
979192109 4:117874435-117874457 CTGTTGATGCAATTGTGTCAGGG + Intergenic
979292534 4:118993587-118993609 CTCTTCAAGCACAAGTCTCTTGG + Intronic
985624991 5:980831-980853 CTGTTTAGGCACATTTGTCACGG + Intronic
985787872 5:1909201-1909223 CTGTCCAGGCACATGGGTCTTGG + Intergenic
988399864 5:30749371-30749393 CTGCAGTAGCACATGTGTGTTGG - Intergenic
989644417 5:43614554-43614576 CTGGTGATGCATATGTTTCTAGG - Intronic
992497439 5:77307764-77307786 CTGTGGAAACACATGTGGCTAGG + Intronic
1000525799 5:162356028-162356050 CTGCTGATGGACATGTGTTTTGG + Intergenic
1003894473 6:10594103-10594125 CTGTTAAAGCACAGATTTCTGGG + Intronic
1003989175 6:11468984-11469006 TTGTTAAAGCACCTGTTTCTGGG + Intergenic
1004337580 6:14778320-14778342 CTGTTATAGCACACTTGTCTTGG - Intergenic
1005150053 6:22738514-22738536 ATGTTAATGCAAATGTGTCTAGG - Intergenic
1005583883 6:27257780-27257802 CTGTTGGATCTCATGTGGCTTGG + Intergenic
1006461835 6:34163824-34163846 CTGCTGTAGCAGATGTGCCTGGG + Intergenic
1006802787 6:36769997-36770019 CTGTTAAACCACAGTTGTCTGGG - Intronic
1011224390 6:85090945-85090967 CTGTTGATGCAATTGGGTCTGGG - Intergenic
1011437191 6:87351098-87351120 CTGTTCAAGTACATGACTCTAGG + Intronic
1012858345 6:104528940-104528962 CAGTTGAAACACAGGTATCTGGG + Intergenic
1013731426 6:113172789-113172811 CTGTTGAAGCATTTCTGTGTTGG + Intergenic
1013737636 6:113246376-113246398 CTGATGAAATACATTTGTCTGGG + Intergenic
1014013867 6:116507253-116507275 CTGTTGTGGCAAATGTGTCCTGG - Intronic
1015203267 6:130606030-130606052 CTGGTGAAGCACAGTTGTCATGG + Intergenic
1015598601 6:134890628-134890650 CTCTTGAAGCACAAATTTCTTGG + Intergenic
1019614086 7:1951052-1951074 CGGGTGAAGCCCACGTGTCTGGG - Intronic
1023124153 7:36938341-36938363 CTGTTGAACCACATGTGGGTGGG + Intronic
1025790654 7:64684263-64684285 CTGTTGGAGGACTGGTGTCTGGG - Intronic
1025887474 7:65610796-65610818 CTGTTGAAAAACCTGTGTTTTGG + Intergenic
1026623851 7:71975159-71975181 CTGTTGCAGGACCTGTCTCTGGG - Intronic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1033642915 7:143279423-143279445 CAGTTTAAGCACATGTGTTTTGG - Intergenic
1034459438 7:151190377-151190399 CTATTGTAGCAAAAGTGTCTGGG - Intergenic
1036532768 8:9610495-9610517 CTCTTAAAGCTCATGTGTATTGG + Intronic
1039303984 8:36241307-36241329 TTGTTAAAGCACAGGTGGCTGGG + Intergenic
1040894781 8:52354810-52354832 CTGTTGAAGGACATCTGTCTTGG - Intronic
1041701896 8:60799834-60799856 CAGTTGAAGGACATGTAGCTGGG + Intronic
1043504437 8:80888352-80888374 CTGTTGATTCACATGTGACATGG - Intergenic
1045842805 8:106599490-106599512 CTTTTGATCCACATGTGTATTGG + Intronic
1051870618 9:21733605-21733627 CTGTTCAAGAACTTGTGTCAAGG + Intergenic
1060788962 9:126472835-126472857 CTGTTGAAGCTCGTTTGTTTAGG + Intronic
1061413308 9:130432467-130432489 GTGTTGAAGCACATCTGGCCGGG - Exonic
1187161651 X:16770761-16770783 CTGTTGATGCACATTTGGGTTGG - Intergenic
1189088506 X:38052274-38052296 CTGTTGCAACACATGAGTCATGG + Intronic
1189478380 X:41374744-41374766 CTGTTGATGGACATGAGTCCTGG + Intergenic
1190154570 X:47978441-47978463 CTATTGTAACACATGAGTCTGGG - Intronic
1196830189 X:119769896-119769918 CTCTTGAAGATGATGTGTCTCGG - Intergenic
1199490184 X:148388803-148388825 TTGTTGAAGCAAATGTATTTTGG - Intergenic
1200037888 X:153345186-153345208 CTGTCGAAGTCCACGTGTCTGGG + Intronic