ID: 1133013342

View in Genome Browser
Species Human (GRCh38)
Location 16:2927017-2927039
Sequence ATTGATAAGCTAATGGCGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 8, 2: 19, 3: 10, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133013342_1133013349 19 Left 1133013342 16:2927017-2927039 CCAACCGCCATTAGCTTATCAAT 0: 1
1: 8
2: 19
3: 10
4: 61
Right 1133013349 16:2927059-2927081 TCAGTATTGGCTGCCTCCAGAGG 0: 1
1: 0
2: 1
3: 23
4: 172
1133013342_1133013346 6 Left 1133013342 16:2927017-2927039 CCAACCGCCATTAGCTTATCAAT 0: 1
1: 8
2: 19
3: 10
4: 61
Right 1133013346 16:2927046-2927068 TGCCAGCCGAGCTTCAGTATTGG 0: 1
1: 1
2: 8
3: 12
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133013342 Original CRISPR ATTGATAAGCTAATGGCGGT TGG (reversed) Intronic
901955750 1:12784087-12784109 ATTGATAAACTACCGGTGGTTGG + Intergenic
901979124 1:13020137-13020159 ATTGATAAACTACCGGTGGTTGG + Intronic
902002958 1:13208801-13208823 ATTGATAAACTACCGGTGGTTGG - Intergenic
902022183 1:13354565-13354587 ATTGATAAACTACCGGTGGTTGG - Intergenic
905767167 1:40610671-40610693 ATTTATAAGGTAATGGGGTTTGG + Intergenic
909413348 1:75378808-75378830 ATTGATAAGCTACTGGCGGTTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
913062685 1:115222474-115222496 ATTGATATGCTGTTGGCTGTGGG - Intergenic
915402541 1:155634101-155634123 ATTGATAGGCTACTGGCGGTTGG + Intergenic
915997620 1:160579924-160579946 ATTATTAGGCGAATGGCGGTGGG + Intergenic
916009557 1:160692499-160692521 ATTGATAAGCTACTGGCAGTTGG - Intronic
917060177 1:171029134-171029156 ATTGATATGATATTGGCTGTGGG + Intronic
1063531089 10:6831903-6831925 ATTGATAAGCTACTGGTAGTTGG + Intergenic
1067913746 10:50374440-50374462 ATAGATTAGATAATGGGGGTGGG - Intronic
1068153471 10:53164997-53165019 ATTCATAAGCTAATGGATATAGG + Intergenic
1072428984 10:95354658-95354680 ATTTATAAGCTAGTGCCTGTGGG + Intronic
1072947935 10:99827182-99827204 ATTGATAAGCTACTGGCGGTTGG + Intronic
1074636934 10:115330113-115330135 ATTGATAAGTTAATTTTGGTCGG + Intronic
1080243280 11:30151707-30151729 AATGAAAAGTTAATGGAGGTTGG - Intergenic
1081884774 11:46485445-46485467 ATAGATTAGCTAAGGGAGGTGGG - Intronic
1083394555 11:62381065-62381087 ATTGATAGGCTACTGGCGGTTGG + Intronic
1087723889 11:101696785-101696807 ATTGATAAGCTACTGGCGGTTGG - Intronic
1089471947 11:118728430-118728452 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1097142538 12:56914809-56914831 CTTGATCAACTAATGGAGGTTGG - Intergenic
1097331292 12:58335171-58335193 ATTGATAAGCTACTGGTGGTTGG + Intergenic
1099074021 12:78082584-78082606 ATTGAAATGCTAATGGTGGGGGG - Intronic
1106211851 13:27656505-27656527 ATTTATAATCTAATGGGGGTGGG + Intronic
1125882170 15:43204386-43204408 ATAGATGAGCTCATGGCAGTGGG - Intronic
1128405640 15:67334803-67334825 ATGGAAAAGCTAAGGGCTGTAGG - Intronic
1130156590 15:81355931-81355953 ATTGAAAAAATATTGGCGGTTGG + Intronic
1130773433 15:86948861-86948883 ATTGGTAAGCTAAGGCCTGTAGG + Intronic
1133013342 16:2927017-2927039 ATTGATAAGCTAATGGCGGTTGG - Intronic
1144688045 17:17239215-17239237 GGTGATAGGCTAATGGCGGAAGG + Intergenic
1152010702 17:77712109-77712131 ATTGATATGCTGATGGCTTTTGG + Intergenic
1158834804 18:61319794-61319816 ATTTATTAGCTAATTGAGGTTGG - Intergenic
1158888893 18:61855030-61855052 TTAAATAAGCTAATGGTGGTGGG + Intronic
1163919860 19:20278406-20278428 ATTGATAGGCTACTGGCAGTTGG - Intergenic
1164153843 19:22576652-22576674 ATTGATAAGCTACTGGCGGTTGG - Intergenic
1164371190 19:27645677-27645699 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1165607014 19:37114338-37114360 ATTGATAGGTTACTGGCGGTTGG + Intronic
930648605 2:53939939-53939961 ATTGAGAAGCTACTTACGGTCGG + Exonic
936550724 2:113437526-113437548 CTTAATAAGCTACTGGCTGTAGG - Intergenic
936928626 2:117763617-117763639 GATGATAAGATACTGGCGGTGGG + Intergenic
946916226 2:224524961-224524983 AATAATAAGCTAATGGGGGTGGG + Intronic
1172337523 20:34129685-34129707 ATTGATAGGGTACTGGCGGTTGG - Intergenic
1176514058 21:7770088-7770110 CTTGCTAAGCTAATGACTGTAGG + Exonic
1177248978 21:18568064-18568086 ATTGATAAGCTACTGGCGGTTGG + Intergenic
1178648171 21:34400612-34400634 CTTGCTAAGCTAATGACTGTAGG + Exonic
1179271342 21:39853379-39853401 ACTAGTAAGTTAATGGCGGTGGG - Intergenic
1180837896 22:18940396-18940418 ATTGATAGGCTACTGGCGGTTGG - Intergenic
1181535353 22:23539572-23539594 ATTGATAAACTACCAGCGGTTGG - Intergenic
950030927 3:9852858-9852880 ATTGATAAGCTACTGGTGGTTGG + Intronic
952316395 3:32236449-32236471 TATGATAAGCTCATGGTGGTTGG - Intergenic
959070033 3:101693616-101693638 ATTGATAAGCTACTGGCGGTTGG - Intergenic
960028183 3:113031699-113031721 ATTGATAGGCTACTGGCGGTTGG + Intergenic
961296881 3:125892016-125892038 ATTGATAAGCTTCTGGCGGTTGG - Intergenic
963696045 3:148566833-148566855 ATTGATAAGCTACTGGCGGTTGG + Intergenic
964648252 3:158981946-158981968 ATTGATGAGCTGATGGTGGATGG + Intronic
965870762 3:173261762-173261784 ATTGATAAAGTAAGGGCTGTAGG + Intergenic
966012302 3:175095707-175095729 ACTGATAAGCTAATTGCCTTAGG - Intronic
967026615 3:185569987-185570009 ATTGATAGGCTACTGGCGGTTGG + Intergenic
976097084 4:81519480-81519502 ATTGATAAGCTATTAGCTGAAGG + Intronic
982856614 4:160390397-160390419 ATTGATAATCTATTGGCCATCGG + Intergenic
982876743 4:160660341-160660363 ATTGATAAGCTACTGGCGGTTGG - Intergenic
983215339 4:164997395-164997417 ATTGATAAGCTACTGGTGGTTGG - Intergenic
983895106 4:173072867-173072889 ATTAATAAGCTATTGTGGGTGGG + Intergenic
988380749 5:30494371-30494393 ATTGATAGGCTACTGGCGGTTGG + Intergenic
989837178 5:46007461-46007483 ATTGCTAAGCTACTGGTGGTTGG + Intergenic
992528512 5:77633608-77633630 AGTGAGAATCTAATGGAGGTTGG + Intronic
996034683 5:118745435-118745457 ATTGATATGCTAAAGGCTTTGGG + Intergenic
999575426 5:152971565-152971587 AGTTATATGCTAATGGCTGTAGG - Intergenic
999952447 5:156665141-156665163 ATTGATAGGCTACTGGCGGTTGG + Intronic
1005729602 6:28684251-28684273 ATTGATAGGCTACTGGCAGTTGG - Intergenic
1008234627 6:49029156-49029178 ATTGATATGCTACTGCCTGTGGG - Intergenic
1010592234 6:77724630-77724652 ATTGATAGGCTACTGGCGGTTGG + Intronic
1019976907 7:4590153-4590175 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1019977842 7:4598656-4598678 ATTGATAGGCTACTGGCGGTTGG + Intergenic
1020409274 7:7873184-7873206 ATTAATAAGCAAATGGCCTTGGG - Intronic
1026205231 7:68251594-68251616 ATTAATAAGCTCATGGGGCTGGG - Intergenic
1029967192 7:104752046-104752068 ATTGATAGGCTACTGGCGGTTGG + Intronic
1030617443 7:111752992-111753014 GTTGATAAGCTATTGGGGGGGGG + Intronic
1033482431 7:141755240-141755262 ATTGATAGGCTACTGGCAGTTGG + Intronic
1036292451 8:7505601-7505623 ATTGATAGGCTACTGGCGGTTGG + Intronic
1040491754 8:47929697-47929719 ATTGATATGTGAATGGCAGTTGG - Intronic
1046039545 8:108885798-108885820 ATTGATCAGTTAATGGCTTTGGG + Intergenic
1047447950 8:124936928-124936950 GTTGATAAGCTAATGTCAGGTGG - Intergenic
1048947416 8:139462217-139462239 ATTGATAGGCTACTGGTGGTTGG + Intergenic
1049902211 9:179290-179312 CTTAATAAGCTACTGGCTGTAGG + Intergenic
1052610321 9:30764536-30764558 ACTGATAAAGTAATGGTGGTAGG - Intergenic
1053745240 9:41189579-41189601 CTTAATAAGCTACTGGCTGTAGG + Intronic
1054482031 9:65675634-65675656 CTTAATAAGCTACTGGCTGTAGG - Intronic
1054683107 9:68241689-68241711 CTTAATAAGCTACTGGCTGTAGG - Exonic
1056308159 9:85311933-85311955 CTTGATAAGTGCATGGCGGTGGG - Intergenic
1060649748 9:125315165-125315187 ATTGATAAAGTGATGGTGGTTGG + Intronic
1062487634 9:136787947-136787969 ATTGATAGGCTACCGGCAGTTGG + Intergenic
1202781368 9_KI270718v1_random:363-385 CTTAATAAGCTACTGGCTGTAGG + Intergenic
1192989415 X:76432605-76432627 ATTGAAAAACTAAAGGGGGTGGG + Intergenic
1195458196 X:105093296-105093318 ATTTAAAAGCAAATGGCCGTAGG - Intronic
1197867461 X:131034430-131034452 AGTAAGAAGCTAAAGGCGGTAGG - Intergenic