ID: 1133013822

View in Genome Browser
Species Human (GRCh38)
Location 16:2929780-2929802
Sequence GAACTCCCTGGGCTTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133013822_1133013837 27 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013837 16:2929830-2929852 GACCAAGATGAGGATGGGGTGGG 0: 1
1: 0
2: 2
3: 46
4: 412
1133013822_1133013836 26 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013836 16:2929829-2929851 CGACCAAGATGAGGATGGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 194
1133013822_1133013831 21 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013831 16:2929824-2929846 GCCTCCGACCAAGATGAGGATGG 0: 1
1: 0
2: 2
3: 10
4: 86
1133013822_1133013830 17 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013830 16:2929820-2929842 CACAGCCTCCGACCAAGATGAGG 0: 1
1: 0
2: 2
3: 12
4: 111
1133013822_1133013833 22 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013833 16:2929825-2929847 CCTCCGACCAAGATGAGGATGGG 0: 1
1: 0
2: 1
3: 4
4: 74
1133013822_1133013834 23 Left 1133013822 16:2929780-2929802 CCCCCAGGAAGCCCAGGGAGTTC 0: 1
1: 0
2: 2
3: 30
4: 296
Right 1133013834 16:2929826-2929848 CTCCGACCAAGATGAGGATGGGG 0: 1
1: 0
2: 1
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133013822 Original CRISPR GAACTCCCTGGGCTTCCTGG GGG (reversed) Exonic
901050816 1:6425102-6425124 GCACTGTCTGCGCTTCCTGGTGG + Exonic
901080084 1:6579227-6579249 CAACTCCCTGGGCTTCATACTGG + Exonic
901184706 1:7365544-7365566 GACTTCCCTGGGCCTGCTGGTGG + Intronic
902242295 1:15096992-15097014 ACACCCCCAGGGCTTCCTGGAGG + Intronic
903241635 1:21986625-21986647 GAACACCGTGGGCTTCCTGCGGG - Exonic
903539272 1:24087592-24087614 GAAATCTCTTGGCTTCCTGTAGG + Intronic
903918311 1:26780477-26780499 CAACCTCCTGGGCTTCCTAGAGG + Exonic
903977935 1:27163623-27163645 CAACTCCCTGTGCTTTCTGCTGG + Intronic
904439802 1:30522852-30522874 GAACTCCCTGGGCTTCAGAGGGG - Intergenic
904577589 1:31514912-31514934 GGGCACCCAGGGCTTCCTGGTGG + Intergenic
905448560 1:38043257-38043279 GAACTCCCAGTGCATCCAGGGGG + Intergenic
905617354 1:39410117-39410139 GAACTTCCAGGCCTTTCTGGAGG + Intronic
908470640 1:64440431-64440453 GAATTCCCTAGGCTTCTTGGAGG - Intergenic
908630726 1:66103748-66103770 GAACTTCTTGGGCTTCCATGTGG + Intronic
911412400 1:97526229-97526251 GAATTCCCAGCTCTTCCTGGAGG - Intronic
912953959 1:114139739-114139761 CAGCACCCTGGGCTTCCTGGAGG - Exonic
915327035 1:155085994-155086016 GGGCTCCCCTGGCTTCCTGGGGG + Intronic
915569680 1:156737761-156737783 GATCTCAGTGGGTTTCCTGGTGG + Exonic
916000027 1:160606517-160606539 GACTTCCCTGGACTTCCTGGGGG + Intergenic
916029515 1:160863776-160863798 GAGCTGCCTGGCCTTCCTGGAGG - Intergenic
917584989 1:176417093-176417115 GAGCTTGCTGGGCTTTCTGGTGG + Intergenic
917966719 1:180183457-180183479 AAACTCCCTGGACTTCTTAGGGG + Intronic
918356491 1:183710022-183710044 CAACTTCCTGGCATTCCTGGTGG + Intronic
922537792 1:226395163-226395185 GAACCCCCTTGTCTTGCTGGTGG + Intronic
922980750 1:229824638-229824660 GAACTCAGTTGTCTTCCTGGTGG + Intergenic
923407352 1:233675675-233675697 AAAATCCCTGGGCTTGTTGGTGG + Intergenic
923913556 1:238477315-238477337 GAACTCATGGAGCTTCCTGGAGG - Intergenic
924156139 1:241178469-241178491 GAACTCCCTGGGTTTACTCTTGG - Intronic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1065785300 10:29207416-29207438 GACCTCACTGGCCTGCCTGGTGG + Intergenic
1067343744 10:45423460-45423482 CAATCCCCAGGGCTTCCTGGAGG - Intronic
1067732169 10:48820337-48820359 GAACTCCCTCAGCTTCCTCCGGG - Exonic
1068119381 10:52770720-52770742 GAAGGCCCTGGATTTCCTGGAGG + Exonic
1068507370 10:57918399-57918421 GAACTCCCAGGGATTACTAGTGG + Intergenic
1069948625 10:72004297-72004319 GAACTCCCTGTCCTGCCTGAAGG + Intronic
1070167759 10:73911305-73911327 GGGCTCCCTGGGCTCCCCGGCGG + Exonic
1070290172 10:75108807-75108829 GAAGTCCCTGCTCTCCCTGGTGG + Intronic
1070558026 10:77545203-77545225 CAACTCCCTGGGTTAACTGGAGG + Intronic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1070853201 10:79584310-79584332 GGAGCCCCTGGGTTTCCTGGGGG + Intergenic
1070887882 10:79920996-79921018 GAAGTCCCTGTGTTTCCTGGGGG - Intergenic
1071200930 10:83220192-83220214 GAACTACCTAGGGCTCCTGGAGG + Intergenic
1072912966 10:99520255-99520277 TAAAGCGCTGGGCTTCCTGGGGG + Intergenic
1073450018 10:103603616-103603638 GGCCTCCTTGGGCTTGCTGGGGG + Exonic
1076124369 10:127962611-127962633 GAGCTCCCTCGGCTTCATTGAGG - Intronic
1076162494 10:128256084-128256106 GGGATCCCTGGGCATCCTGGTGG + Intergenic
1076384537 10:130046859-130046881 GAGCTCCCTGACCTTTCTGGGGG + Intergenic
1076857772 10:133126053-133126075 GAAGCCCCTGGGCTGCTTGGGGG - Intronic
1077193637 11:1267647-1267669 GAACTGCCTTGTCTTTCTGGTGG - Intergenic
1077504179 11:2922586-2922608 TAGCTCCTAGGGCTTCCTGGAGG - Intronic
1078668264 11:13343576-13343598 CAACTCACTGGGCATCCTGGGGG - Intronic
1079017333 11:16880247-16880269 GATCTGCCTGGGCTTCCTGCAGG - Intronic
1079698751 11:23518041-23518063 GAGCTACCTGGGCTACCTGGTGG + Intergenic
1080311913 11:30904474-30904496 GAACTACCTGGTCTGCCTTGGGG - Intronic
1081660525 11:44885411-44885433 CTTATCCCTGGGCTTCCTGGTGG + Intronic
1081743887 11:45459651-45459673 CAGCTGCCTGGGCTTCCTGCAGG + Intergenic
1081963112 11:47152814-47152836 GAAAGCCTTGGGCTCCCTGGTGG + Intronic
1082020982 11:47533035-47533057 GAACCCACTAGGATTCCTGGGGG + Intronic
1083683191 11:64360677-64360699 CTTCCCCCTGGGCTTCCTGGGGG + Intronic
1083714952 11:64569802-64569824 GAAGTCCCTGGGTCTCCGGGAGG - Exonic
1084165718 11:67373874-67373896 TACCACCCTGGGCCTCCTGGGGG + Intronic
1084267965 11:68014641-68014663 GAACACCTCGGGCCTCCTGGAGG - Intronic
1084328735 11:68417262-68417284 GACCTCCCTGGGCTCACTGCTGG - Intronic
1084352532 11:68612776-68612798 TCACTCCCTGTGCTTCTTGGAGG + Intronic
1084962167 11:72722605-72722627 CCAATCCCTGGTCTTCCTGGAGG - Intronic
1085478616 11:76804207-76804229 CAAGTCCCAGGGCTTCATGGAGG - Intergenic
1087345440 11:96965363-96965385 GAACTCCCTGGATTACCAGGTGG - Intergenic
1087508668 11:99061456-99061478 CACCTCTCTGGCCTTCCTGGTGG - Intronic
1088807239 11:113363681-113363703 GAACGGCATGTGCTTCCTGGTGG - Intronic
1089615705 11:119693576-119693598 CCACTTCCTGGGCTTCATGGTGG - Intronic
1091688720 12:2581596-2581618 GAACTCCTTGAGCAACCTGGTGG + Exonic
1091908475 12:4208994-4209016 CCTCTCCCTGGCCTTCCTGGCGG - Intergenic
1092119642 12:6034936-6034958 AACTTCCTTGGGCTTCCTGGAGG - Intronic
1094719977 12:33053050-33053072 ATATTCCCTGGGCTTCTTGGGGG - Intergenic
1095089008 12:38087016-38087038 GAGCTGCCTGGGCTTCTTGCTGG + Intergenic
1095809500 12:46356838-46356860 GACCTCCCTGGGCTTCCAAGTGG + Intergenic
1096706379 12:53424849-53424871 GGAGTCCCAGGGCTCCCTGGAGG - Exonic
1097053081 12:56235251-56235273 GCCCTTGCTGGGCTTCCTGGGGG + Exonic
1098350858 12:69558508-69558530 GAACTACCTGGTTCTCCTGGAGG + Intronic
1102042916 12:109812044-109812066 GAAGTCCCTGGGCTTCCTAAAGG + Intronic
1104098670 12:125585276-125585298 GCCCTGCCTGGGGTTCCTGGTGG + Intronic
1104611531 12:130232693-130232715 GATCACCATGTGCTTCCTGGTGG + Intergenic
1104849956 12:131868131-131868153 GAACCCCATGGGCTGCCTCGAGG - Intergenic
1105770463 13:23606495-23606517 GAACAACATGGGCTTCCAGGTGG - Intronic
1106426598 13:29636582-29636604 TAGCTTCCTGGGCTTCCTGGGGG + Intergenic
1106547748 13:30745065-30745087 GGAGTCCCTGGGCTTGCTGCTGG + Intronic
1107444047 13:40454053-40454075 GAACAGCCTGGGCAACCTGGTGG - Intergenic
1108753536 13:53473422-53473444 CAACTCACTGGGCTTCCTTTTGG - Intergenic
1108934305 13:55866933-55866955 GAATCACCTGGGCCTCCTGGAGG + Intergenic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1111097408 13:83534001-83534023 GAATTCCCTGGGCTTGCATGGGG + Intergenic
1113759130 13:112835467-112835489 CAGCACCCTGGGCTTCCCGGGGG + Intronic
1117078194 14:52125226-52125248 GAGCTCCTGGTGCTTCCTGGTGG + Intergenic
1119630785 14:76230098-76230120 CAGCTCTCTGGGTTTCCTGGTGG + Intronic
1120107619 14:80515023-80515045 GAATTCCCTGGGTTACCAGGCGG + Intronic
1121420115 14:93807269-93807291 GAACACCCTATGCTTCTTGGAGG + Intergenic
1122424350 14:101597024-101597046 TGACCCCCTGGGCTTCCTGCAGG - Intergenic
1122813749 14:104302012-104302034 GACCTGCGTGGGCTGCCTGGCGG + Intergenic
1202875298 14_GL000225v1_random:201846-201868 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1202877776 14_KI270722v1_random:23066-23088 GAACGACCTAGGCCTCCTGGAGG - Intergenic
1124158780 15:27250931-27250953 GTTCTCCCTGGGCCTCCTGAAGG - Intronic
1124723430 15:32133421-32133443 GAACTCCCAGGGCCTCGTGTGGG - Intronic
1124814049 15:32970457-32970479 GTACTTCCTGGGCTACCTGCTGG - Intronic
1125227158 15:37408372-37408394 TAGCTTCCTGGGCTTCATGGGGG - Intergenic
1125388552 15:39166085-39166107 GAACTCCCTGGGCTCATTGCTGG + Intergenic
1126111763 15:45179399-45179421 GAAGTCCCTGTGGCTCCTGGAGG + Intronic
1126137099 15:45402858-45402880 GATCTCCCTGGGCCACGTGGTGG + Exonic
1127574157 15:60273640-60273662 GGATTCCCTGGGCTTCCTTAGGG + Intergenic
1128788127 15:70413243-70413265 GAACGCCCTGGCCTTGCTGAGGG + Intergenic
1128884461 15:71273924-71273946 GGAAGCCCTGGGCTTCCAGGTGG + Intronic
1129293808 15:74588454-74588476 GGTCTCACTGGGCTGCCTGGTGG - Intronic
1130844973 15:87735767-87735789 GACCTGCCTGGCCTGCCTGGAGG - Intergenic
1131845318 15:96484944-96484966 TACTTCCCTGGGTTTCCTGGGGG - Intergenic
1132645769 16:998623-998645 GAGCTCCCAGGGCCTCCTGTGGG - Intergenic
1132725618 16:1337060-1337082 GACCTCCCTGGGGCTGCTGGGGG + Intronic
1132970787 16:2687681-2687703 GGAGTCCCTGGGATGCCTGGTGG - Intronic
1133008256 16:2896544-2896566 GAACTTTCTGGGCTTCCTGGGGG - Exonic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1133302367 16:4790454-4790476 GAACTCCCGCTCCTTCCTGGAGG + Intronic
1135752155 16:25066470-25066492 GATTTGCCTGGCCTTCCTGGGGG + Intergenic
1135919643 16:26638101-26638123 GAGCTGCCTGAGCTTCCTGAAGG + Intergenic
1135967990 16:27051654-27051676 GAGCTCCCTTGAATTCCTGGAGG - Intergenic
1137592942 16:49704907-49704929 GAACTCCCTGGGCTCCCTCCTGG + Intronic
1137817386 16:51411423-51411445 GAACTGGCAAGGCTTCCTGGAGG + Intergenic
1138279209 16:55760457-55760479 GATCTCCCTGGGCTTCCAGTGGG - Intergenic
1138289315 16:55833219-55833241 GATCTCCCTGGGCTTCTAGTGGG + Intronic
1140257361 16:73348818-73348840 GAAGTCCCTGGGCTTCTGGCAGG - Intergenic
1141656991 16:85421769-85421791 TACCTCTCTGGGGTTCCTGGTGG - Intergenic
1142202665 16:88768552-88768574 GAACTCCCGGGGGTCCCGGGTGG + Intronic
1142234341 16:88914915-88914937 CAACTCCCTGAGCGCCCTGGGGG + Intronic
1203142929 16_KI270728v1_random:1780661-1780683 AAACTCCCTGGACCTGCTGGAGG - Intergenic
1142919687 17:3173165-3173187 AAGCTTCCTGAGCTTCCTGGGGG - Intergenic
1143940336 17:10534244-10534266 AGACTCCCAGGGTTTCCTGGAGG - Intronic
1144638720 17:16926293-16926315 GAACTGCCTGTGCCTCCTGCAGG + Intergenic
1144778175 17:17795312-17795334 GGCCTGCCTGGGCTTCCAGGAGG + Exonic
1145126700 17:20306593-20306615 CACCTCCCTGGGCTGGCTGGTGG - Intronic
1145285789 17:21505326-21505348 GGACGCCCTGGGCTTCCTGCAGG - Intergenic
1145391808 17:22460974-22460996 GGATGCCCTGGGCTTCCTGCAGG + Intergenic
1147600467 17:41742097-41742119 GGATGCTCTGGGCTTCCTGGAGG - Intergenic
1148805627 17:50262463-50262485 GATCTGAGTGGGCTTCCTGGAGG + Intergenic
1150390116 17:64785086-64785108 GGACTTCCTGGGCTTTCTGTAGG + Intergenic
1150815447 17:68388982-68389004 TAACTCCCTGGGCTACCTCGTGG + Intronic
1152113453 17:78370181-78370203 GAACGTCCTGGGCTTCTTTGTGG + Intergenic
1152287751 17:79422425-79422447 TGACCCCCTGGGCTTCCTGGAGG - Intronic
1154123535 18:11670582-11670604 GAGCTCACTGGGCTTCCTGCTGG + Intergenic
1157229097 18:45897133-45897155 CAGCTCCCTGGCCTGCCTGGTGG + Intronic
1162039349 19:7960380-7960402 GAAATTCATGGGCTTCCTCGGGG - Exonic
1162361717 19:10224374-10224396 GAACTGCCTGGGCCACCTCGAGG - Exonic
1162771004 19:12949282-12949304 GAACCCCCTGGAGTTCCTGCGGG + Exonic
1163366383 19:16878176-16878198 GAACTTCTTGAGGTTCCTGGGGG - Exonic
1163387880 19:17011309-17011331 GAACTCCCTGGGGTTCTCCGGGG + Intronic
1163517864 19:17775705-17775727 GATCTAGCAGGGCTTCCTGGAGG + Intronic
1164145406 19:22509808-22509830 GGGCTCCCTGCCCTTCCTGGAGG - Intronic
1164711203 19:30358366-30358388 GATCTGCCTGGGCATCCCGGGGG - Intronic
1164925986 19:32130295-32130317 GGAGTCCCTTGGCTTCCTTGGGG - Intergenic
1165069194 19:33245982-33246004 GAAATCCCTGGGGTTCCTTCAGG - Intergenic
1165789858 19:38484772-38484794 GTTCTCACTGTGCTTCCTGGTGG - Intronic
1166322200 19:42025420-42025442 GAACTCCCTGGGATCCAGGGAGG - Intronic
1167306560 19:48713383-48713405 GGACTCCCTGGACTGGCTGGAGG - Exonic
1168412254 19:56147263-56147285 CTCCTCCCTGGGCTTCCTGGTGG - Intronic
925071626 2:973488-973510 GGATTCTCTGGGCTTCTTGGGGG + Intronic
925375095 2:3378513-3378535 GAAGGCCCTGGGGTTCCTAGAGG + Intergenic
925413888 2:3656179-3656201 GGCCTCCCTGGGCTCCCAGGAGG - Intergenic
928855272 2:35795905-35795927 GAAGTACTTGGGTTTCCTGGAGG + Intergenic
930690904 2:54363309-54363331 GAGCTCTTTGGTCTTCCTGGGGG + Intronic
932927472 2:75993888-75993910 TAACTTCCTGGGCCTCCAGGAGG + Intergenic
932970617 2:76536509-76536531 GAACTCAGTGGGCTTACTGATGG + Intergenic
933912929 2:86960039-86960061 GCCCTCCTGGGGCTTCCTGGTGG - Intronic
934010066 2:87809851-87809873 GCCCTCCTGGGGCTTCCTGGTGG + Intronic
934048582 2:88191351-88191373 GACCTCCATGGCCTCCCTGGTGG - Intergenic
934756544 2:96828326-96828348 GTAGCCCCTGGGCTTCCAGGAGG + Intronic
935773636 2:106450559-106450581 GCCCTCCTGGGGCTTCCTGGTGG + Intronic
935906428 2:107845381-107845403 GCCCTCCTGGGGCTTCCTGGTGG - Intronic
936128212 2:109810490-109810512 GCCCTCCTGGGGCTTCCTGGTGG - Intronic
936216485 2:110560995-110561017 GCCCTCCTGGGGCTTCCTGGTGG + Intronic
936425626 2:112415566-112415588 GCCCTCCTGGGGCTTCCTGGTGG + Intronic
937259103 2:120574097-120574119 CCACTTCCTGGGCTTTCTGGGGG + Intergenic
937444245 2:121943398-121943420 GAACTCACAGAGGTTCCTGGAGG - Intergenic
938019147 2:127891946-127891968 GAACTTCCTGCACTTGCTGGAGG + Intergenic
939866889 2:147482790-147482812 ACACTCCCTGGGCTCCCTGAAGG - Intergenic
944894772 2:204152638-204152660 GAGCTCCCAGGGCTTCTTGGAGG + Intergenic
946313069 2:218893503-218893525 GAACTGTCTGGGCTTCGGGGAGG - Exonic
947031459 2:225800622-225800644 GAAGTCACGGGGCCTCCTGGTGG + Intergenic
948582227 2:238996358-238996380 GAGCTCCCGGTCCTTCCTGGTGG - Intergenic
948817727 2:240521321-240521343 CAGCTCCCTGGGCTTCCGAGTGG - Intronic
949052017 2:241902596-241902618 CGACTCCCTGGGCTCCCGGGAGG - Intergenic
1168826232 20:816200-816222 GGGCTCCCTGCGCCTCCTGGTGG - Intergenic
1169235725 20:3928395-3928417 CTACTCCCAGGGCTGCCTGGAGG + Intronic
1170080066 20:12464748-12464770 CAACTCCCAGGGATTCCTTGTGG - Intergenic
1173573778 20:44096749-44096771 GGACTTCCTGGGCTCCCTGAGGG + Intergenic
1175273059 20:57748540-57748562 TTTCTCCCTGGTCTTCCTGGTGG + Intergenic
1175917672 20:62434470-62434492 GGAGGGCCTGGGCTTCCTGGAGG - Intergenic
1176639065 21:9280505-9280527 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1177779292 21:25606097-25606119 GAAGTCCCTGGACTTCCCAGAGG - Intronic
1179271074 21:39851392-39851414 AGACTCCCAGGGATTCCTGGAGG - Intergenic
1179565464 21:42245111-42245133 GTGTTCCCTGGGCTGCCTGGAGG + Intronic
1180022314 21:45136131-45136153 GAACTCCCTCCCCTTCTTGGTGG + Intronic
1180229745 21:46419981-46420003 GAACTTCCTCGTCTCCCTGGTGG + Intronic
1180372371 22:12053347-12053369 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1180390099 22:12222306-12222328 GAACAACCTAGGCCTCCTGGAGG + Intergenic
1180415836 22:12712161-12712183 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1180423111 22:12888012-12888034 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1181007722 22:20021858-20021880 GTGCTCCCTTGGCTTCCTGCTGG + Intronic
1182008828 22:26983533-26983555 GAGCTCCCCTGTCTTCCTGGAGG + Intergenic
1183328632 22:37207644-37207666 GATCCCCCTGGTCTACCTGGTGG - Exonic
1184450495 22:44579684-44579706 GAGCCTCCAGGGCTTCCTGGAGG - Intergenic
1184917959 22:47586057-47586079 TAATTCCTTGGTCTTCCTGGTGG + Intergenic
1185057713 22:48589554-48589576 GAGCACCCTGGGTTTCCAGGTGG - Intronic
1185262936 22:49880269-49880291 GAACTGCCAGGGCTCCCTGGAGG - Intronic
949661380 3:6283318-6283340 AAACTCCCTGGGCTACGTGCAGG - Intergenic
950579579 3:13853585-13853607 AATCTCAGTGGGCTTCCTGGAGG - Intronic
950623511 3:14226723-14226745 GCACTTCCTGGTGTTCCTGGGGG - Intergenic
951423980 3:22520495-22520517 CACCTCCCTGTGCTTCCAGGTGG - Intergenic
953793046 3:45962905-45962927 GAATTCCCTGGGCCTCAGGGGGG - Intronic
954083115 3:48224083-48224105 GAAGTCAGGGGGCTTCCTGGGGG - Intronic
955159227 3:56447890-56447912 AAATTCCCTGGGCTTGGTGGTGG - Intronic
956460967 3:69472329-69472351 CAACTCCCTGGGATTCTTGTTGG + Intronic
957101144 3:75830345-75830367 GAACAACCTAGGCCTCCTGGAGG + Intergenic
959275828 3:104276657-104276679 TAATTCCTTGGGTTTCCTGGGGG + Intergenic
959654851 3:108791650-108791672 GAACTCGCTGGGTTTCCTGGAGG - Intergenic
960973845 3:123157198-123157220 GGCCTGCCTGGGTTTCCTGGAGG + Intronic
962154640 3:132933166-132933188 TAATTCCCTGGGCTTCCATGAGG + Intergenic
964041675 3:152268824-152268846 GTCCGCCCTGGGCTTCCTGGTGG + Exonic
1202747830 3_GL000221v1_random:124514-124536 GAACAACCTAGGCCTCCTGGAGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968641361 4:1716646-1716668 GCAGTCCTGGGGCTTCCTGGTGG - Exonic
970152764 4:13107105-13107127 TTTCTCCCTGGGCTTCCAGGTGG + Intergenic
970734641 4:19151695-19151717 GAACTCACAGGCCTTACTGGTGG - Intergenic
973544070 4:51962715-51962737 GAACTCCATGGGCATGCAGGAGG - Intergenic
976235681 4:82894065-82894087 GAACTCTCTGGTCTTTCTCGGGG + Intronic
976813062 4:89117931-89117953 GAGGTGCCTGGGTTTCCTGGGGG - Intergenic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
978171606 4:105677802-105677824 GAACTCTCTGGTATTCCTGAAGG - Exonic
978831183 4:113086845-113086867 GAACTCGCTTGGCATGCTGGAGG + Intronic
983222820 4:165059033-165059055 GATCTCACTGTCCTTCCTGGAGG - Intergenic
983795410 4:171855719-171855741 GAACTCCCAGTCATTCCTGGTGG - Intronic
985171243 4:187152720-187152742 GAACTTCCTGGGCTAATTGGAGG + Intergenic
1202753962 4_GL000008v2_random:38917-38939 GAACAACCTAGGCCTCCTGGAGG - Intergenic
985642187 5:1068896-1068918 GCACTGCCTGGCCTCCCTGGAGG - Intronic
985924379 5:3004538-3004560 GGAGTCACTGGGCTTCCTGCAGG - Intergenic
985936452 5:3101392-3101414 GAGATGCCTGGGCTTCCGGGGGG - Intergenic
987031873 5:13983669-13983691 GAGCCCCCCAGGCTTCCTGGAGG + Intergenic
987900489 5:24004340-24004362 GAACTCCCTGAACTTACTGTTGG + Intronic
990031261 5:51262344-51262366 GAACGCCTGGGGGTTCCTGGAGG - Intergenic
991647413 5:68815086-68815108 GAACCTGCTGGACTTCCTGGAGG + Intergenic
992503977 5:77367492-77367514 GAACTCCCCAGGCTTCCAGTTGG - Intronic
994175030 5:96701966-96701988 TAACTGCCTTGGCTGCCTGGTGG + Intronic
995123838 5:108560710-108560732 AAAATCCCTGTGCTCCCTGGTGG + Intergenic
996544190 5:124660372-124660394 AACCTCCCTGTTCTTCCTGGAGG + Intronic
996777655 5:127150173-127150195 GAACTCTCTGGGTTTGGTGGTGG + Intergenic
997978248 5:138452957-138452979 GAACCCCTTGCCCTTCCTGGGGG - Intergenic
999484082 5:151976572-151976594 GACCAGCCTGGGCATCCTGGTGG - Intergenic
1001853929 5:174994548-174994570 GAACACGGAGGGCTTCCTGGAGG + Intergenic
1002412120 5:179089229-179089251 GAACCCAGTGGGGTTCCTGGAGG + Intergenic
1002940247 6:1709406-1709428 CAAGTCACTCGGCTTCCTGGTGG + Intronic
1003041352 6:2690393-2690415 GAACTTCCAGGGATTCGTGGGGG + Intronic
1003618035 6:7673026-7673048 CCACTCCCTGGCATTCCTGGAGG + Intergenic
1005926867 6:30451891-30451913 GAACGCCCCGGGCTTCCTAATGG - Intergenic
1005928601 6:30464589-30464611 GAACGCCCCGGGCTTCCTAGTGG - Intergenic
1006372081 6:33651332-33651354 GAACACCAGGGCCTTCCTGGAGG - Intronic
1006467749 6:34206228-34206250 GCCCTCCTGGGGCTTCCTGGTGG - Intergenic
1006860926 6:37170962-37170984 GGAGACCCTGGGCTTCCAGGTGG + Exonic
1007081362 6:39107305-39107327 GACCTCCCTGGGCATCAGGGAGG + Intronic
1007353415 6:41292183-41292205 GACCTCCCTGGCCTGCCTAGAGG - Intergenic
1007662518 6:43495518-43495540 GAACACCATGGGCCCCCTGGTGG + Intronic
1008155462 6:48008736-48008758 GCCCTTCCTGGGCCTCCTGGGGG - Exonic
1011949824 6:92952067-92952089 TGACCCCTTGGGCTTCCTGGGGG - Intergenic
1017866561 6:158449103-158449125 GAACTACCCGATCTTCCTGGTGG + Exonic
1018031651 6:159846000-159846022 GAACTCCCTAGGCTTTCAGCTGG + Intergenic
1019171226 6:170134362-170134384 CAAGTCCTTCGGCTTCCTGGCGG - Intergenic
1019469372 7:1210577-1210599 CATTGCCCTGGGCTTCCTGGCGG + Intergenic
1019565661 7:1677838-1677860 GAGCTCCCGCGGGTTCCTGGTGG + Intergenic
1019574253 7:1728680-1728702 CATCACCCTGGGGTTCCTGGAGG - Intronic
1019640995 7:2103577-2103599 GGGCTCCCAGGGCTGCCTGGTGG - Intronic
1023287793 7:38637102-38637124 TAACTCCCTGATCTCCCTGGAGG - Intergenic
1025739282 7:64182991-64183013 GAACTGCCTGGGCCTGCCGGGGG - Intronic
1028492017 7:91423263-91423285 GAAGTTCCTGGGCTTCCTGTTGG + Intergenic
1029366896 7:100122417-100122439 GAACTCCCAGGGCTCCGTTGGGG - Intronic
1031610307 7:123818279-123818301 GAACTCCCAGTACTTCCTTGTGG - Intergenic
1031796337 7:126179001-126179023 TAACTCCCTTGGCTCCCTGGTGG + Intergenic
1034457508 7:151179018-151179040 TAGCTGCATGGGCTTCCTGGAGG - Intronic
1034521793 7:151626052-151626074 GAACTTTCTCTGCTTCCTGGTGG - Intronic
1035636705 8:1152625-1152647 GAACTCCCAGGGGTGCCTGCAGG + Intergenic
1037192507 8:16143937-16143959 GAAGGCACTGGACTTCCTGGGGG - Intronic
1037390689 8:18388101-18388123 GAACTTGGTGGGCATCCTGGAGG + Intergenic
1037734686 8:21556592-21556614 GAAGTCCCTAGGGTTCCTGCTGG - Intergenic
1037950263 8:23014950-23014972 GAACTCCCTGGTGTACCCGGAGG + Intronic
1037977913 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG + Intergenic
1038206944 8:25475878-25475900 GTACTCCCAGTGTTTCCTGGGGG + Intronic
1039449413 8:37659662-37659684 GACCTCCCTGGGCAACATGGTGG + Intergenic
1040345538 8:46489275-46489297 GCACTTCCTGGTTTTCCTGGGGG + Intergenic
1040413927 8:47181059-47181081 GTGCTCCCTTGGCTTTCTGGGGG + Intergenic
1044900989 8:96944319-96944341 GAACTCCCAGAACTGCCTGGAGG - Intronic
1045422664 8:102031845-102031867 GATCTCCCTGTGATCCCTGGAGG + Intronic
1045548113 8:103146350-103146372 GGACAGCCAGGGCTTCCTGGTGG + Intronic
1047960936 8:130011200-130011222 AAGCTTCCTGGGCTTCCTTGAGG - Intronic
1048343821 8:133561344-133561366 GAATTCCTTGAGCTTTCTGGAGG + Intronic
1048846553 8:138607928-138607950 GAACTCACAGGGGTTCCTGAAGG + Exonic
1049145667 8:141000300-141000322 GAGCCCCGTGGGCTTCTTGGCGG - Intronic
1049361366 8:142213885-142213907 GAAAGGCCAGGGCTTCCTGGGGG - Intronic
1049718019 8:144102812-144102834 GAGGTTCCAGGGCTTCCTGGTGG + Intronic
1052573672 9:30264191-30264213 GAATTCCCTGGATTTCCAGGCGG + Intergenic
1055244174 9:74220288-74220310 GAGTTCCCTGGGCTTCCTTGGGG - Intergenic
1057004671 9:91546837-91546859 GAACCTGCTGGGGTTCCTGGAGG - Intergenic
1057929889 9:99184354-99184376 GAGCAAGCTGGGCTTCCTGGAGG + Intergenic
1057956840 9:99416501-99416523 GATCTCCCTAGCCTTTCTGGAGG - Intergenic
1058920031 9:109604622-109604644 TAACTCCATGGCTTTCCTGGAGG + Intergenic
1059341495 9:113599946-113599968 GCCCTGCCTGGGCTCCCTGGAGG + Intergenic
1061307346 9:129739745-129739767 GCACTTCCTGGTCTTCCTCGTGG - Exonic
1062039774 9:134398901-134398923 GTGCTCCCAGGGCTACCTGGTGG + Intronic
1203716465 Un_KI270742v1:154595-154617 GAACAACCTAGGCCTCCTGGAGG + Intergenic
1203534749 Un_KI270743v1:23641-23663 GAACAACCTAGGCCTCCTGGAGG - Intergenic
1203650695 Un_KI270751v1:118157-118179 GAACAACCTAGGCCTCCTGGAGG + Intergenic
1185535469 X:858129-858151 CAACTCCTTCGGATTCCTGGTGG + Intergenic
1185549675 X:973070-973092 AAACTCCCCGGGCCTGCTGGAGG + Intergenic
1187941429 X:24386470-24386492 GCACTCCCAGTGCTTCCTGTGGG + Intergenic
1189589027 X:42492460-42492482 GGAATACCTGGGCTTCCTTGCGG - Intergenic
1190382570 X:49853975-49853997 GAAATGCCTGGGTTGCCTGGAGG - Intergenic
1191879226 X:65828122-65828144 GGGTTCCCTGGGCTTCCTTGGGG - Intergenic
1192312424 X:70027925-70027947 GGAATCCCTGGAATTCCTGGGGG - Exonic
1192800513 X:74460798-74460820 GAACTAGCTGGGCTTGGTGGTGG - Intronic
1193590537 X:83384100-83384122 GGACTCCCTGGGCTTTCTTGGGG - Intergenic
1193773100 X:85610958-85610980 GACCTCCCTGTTCTTCCTGCTGG + Intergenic
1195919355 X:109967052-109967074 GAAGGCCGTGTGCTTCCTGGTGG - Intergenic
1196015591 X:110937053-110937075 GTTTTCCCTGGGATTCCTGGGGG - Intergenic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1200708303 Y:6461841-6461863 GTGCTCCCTGGGTTTCCTGCAGG + Intergenic
1201025809 Y:9702867-9702889 GTGCTCCCTGGGTTTCCTGCAGG - Intergenic
1201170666 Y:11259549-11259571 GAACAACCTAGGCCTCCTGGAGG + Intergenic