ID: 1133015647

View in Genome Browser
Species Human (GRCh38)
Location 16:2938255-2938277
Sequence TACAGGAAGGAGAAGGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 2, 1: 0, 2: 1, 3: 42, 4: 374}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133015635_1133015647 26 Left 1133015635 16:2938206-2938228 CCTGAGGACTTCCCTGGGGGGCA 0: 1
1: 0
2: 1
3: 33
4: 237
Right 1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG 0: 2
1: 0
2: 1
3: 42
4: 374
1133015640_1133015647 -1 Left 1133015640 16:2938233-2938255 CCTGGTGCACGAGTCCTTCCTCT 0: 1
1: 4
2: 3
3: 10
4: 106
Right 1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG 0: 2
1: 0
2: 1
3: 42
4: 374
1133015638_1133015647 15 Left 1133015638 16:2938217-2938239 CCCTGGGGGGCAGGTTCCTGGTG 0: 1
1: 2
2: 0
3: 28
4: 233
Right 1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG 0: 2
1: 0
2: 1
3: 42
4: 374
1133015639_1133015647 14 Left 1133015639 16:2938218-2938240 CCTGGGGGGCAGGTTCCTGGTGC 0: 2
1: 0
2: 4
3: 22
4: 234
Right 1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG 0: 2
1: 0
2: 1
3: 42
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133015647 Original CRISPR TACAGGAAGGAGAAGGCGGC TGG Exonic
900242899 1:1625388-1625410 TGCAGGAAGGCCACGGCGGCTGG + Exonic
900383544 1:2398065-2398087 TTCAGGCAGGAGCAGGGGGCGGG + Intronic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
900699315 1:4034285-4034307 TCCAGGAAGGGGACAGCGGCTGG - Intergenic
900732437 1:4271181-4271203 TACAGGAAAGAGAAGGGGCATGG + Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900851411 1:5145947-5145969 TACAGGAAGGGGAATGCAGTGGG + Intergenic
901063081 1:6482449-6482471 GACAGGAGGGAGGAGGAGGCCGG + Intronic
901296052 1:8161707-8161729 AGGAGGAAGGAGAAGCCGGCAGG - Intergenic
901863370 1:12088758-12088780 AACAGGAAGGAGGAGGAGGAGGG + Intronic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902701948 1:18178672-18178694 AAAAGGAAGGAGAAGCTGGCAGG - Intronic
903008710 1:20315439-20315461 TACAGGAGGGAAAAGGAGGTGGG + Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904330573 1:29755628-29755650 TCCAGGAAGGAGCAGGTGTCTGG + Intergenic
904416098 1:30361967-30361989 TCCAGGAAGGAGCAGGTGTCTGG - Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904588408 1:31593191-31593213 TACAGGGAGGAGACTGAGGCTGG + Intergenic
904611723 1:31729483-31729505 TAAAGGCAGGAGAAGGTGCCGGG - Intronic
905128927 1:35737232-35737254 TAGAGGAAGGAGGTGGCTGCAGG - Intronic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
905721491 1:40206730-40206752 AACAGCAAAGACAAGGCGGCTGG - Intronic
906115261 1:43352433-43352455 TACAGGAAGGAGAAGGGCTGGGG - Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906292023 1:44625552-44625574 TACAGGCTGGAGAAGGTGGGGGG + Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
907246312 1:53111273-53111295 GACAGGAAGGACAACGAGGCGGG + Intronic
907422451 1:54356538-54356560 TGTGGGAAGCAGAAGGCGGCCGG + Intronic
907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG + Intergenic
907548651 1:55285436-55285458 TACTGGAAGGGGAAGGCAGAAGG + Intergenic
908842458 1:68293736-68293758 GGCAGGAAGGATAAGGCTGCAGG - Intergenic
909058208 1:70847248-70847270 TGCTGGGAGGAGAAGGAGGCAGG - Intergenic
910927729 1:92413423-92413445 TACAGAAAGGAGAAGGCAAACGG - Intergenic
912419280 1:109532375-109532397 TCCAGGAGGGAGAAGGCAGGTGG + Intergenic
912431762 1:109631753-109631775 GACAGGACGGAGAAGGCTGCTGG - Exonic
914048920 1:144115071-144115093 TCCAGAAAGCAGAAGGCAGCTGG + Intergenic
914130264 1:144850377-144850399 TCCAGAAAGCAGAAGGCAGCTGG - Intergenic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
915964497 1:160294520-160294542 GACAGGAAGAAGGAGGTGGCTGG - Exonic
916172784 1:162013268-162013290 CACAGGAAGGAGAGGTCAGCTGG + Intronic
917805901 1:178613575-178613597 TCCAGGCAGGAGAAGGCTGAGGG + Intergenic
918236627 1:182586627-182586649 TCCAGGAAGAGGAAGGGGGCTGG - Exonic
918456741 1:184727864-184727886 TACAGGCAGCATAAGGGGGCAGG - Intronic
918579519 1:186109734-186109756 TACAGGAAAAGGAAGGCTGCTGG + Intronic
920839794 1:209544980-209545002 TACAGGAAAGAGAATGTGGGAGG - Intergenic
921377257 1:214487257-214487279 TGAAGGAAGGAGGAGGAGGCAGG + Intronic
921604686 1:217139197-217139219 TATAGGCAGGAGAATGAGGCGGG + Intergenic
921768053 1:218996873-218996895 TCCAGGAAAGAGAAAGGGGCTGG + Intergenic
923065084 1:230510136-230510158 TCCAGGGAGAAGAAGGTGGCTGG - Intergenic
1063186437 10:3656117-3656139 TACTGGAATGAGAAGGCAGAGGG + Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1064213616 10:13381529-13381551 TTCAAGAAGGAAAAGGAGGCTGG + Intergenic
1064248203 10:13686245-13686267 TACAGGGAGGAGAAGGAGGAAGG + Intronic
1067959745 10:50834748-50834770 TTCAGGATGGAGAAGTCGGAGGG + Intronic
1069406657 10:68107645-68107667 TACAGAAAAAAGAAGCCGGCCGG - Intronic
1069999307 10:72364491-72364513 AACAGGAAGGAGGAGGAGACAGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071870530 10:89789529-89789551 TATAGGAAGGATCAGGCGGTGGG + Intergenic
1073051148 10:100668177-100668199 TCCAGGAGAGAGAAGGAGGCAGG + Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1076790523 10:132774791-132774813 TACAGGGAGGAGAGAGGGGCAGG + Intronic
1077219855 11:1411062-1411084 GGCAGGAAGGAGGAGGGGGCGGG + Intronic
1077852995 11:6093407-6093429 AACAGGAAAGAGAAAGCAGCAGG - Intergenic
1078022991 11:7670988-7671010 TGCAGGGAGGAGGAGGAGGCAGG + Intronic
1078085737 11:8232163-8232185 TGCAGGGAGGAGAAGGAGGAGGG - Intronic
1078450653 11:11438125-11438147 TACAGGTAGGAGACAGAGGCTGG - Intronic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1079708427 11:23651320-23651342 TCCAGGAAGAAGAAAGAGGCTGG - Intergenic
1083336066 11:61922611-61922633 TACAGGCAGGAGGACGGGGCAGG - Intergenic
1083631546 11:64097923-64097945 TCCAGTGAGGAGAAGGAGGCGGG + Intronic
1083935952 11:65870245-65870267 TAGAGGCAGGAGAAGGAGGGCGG + Intronic
1084171964 11:67405176-67405198 TACAAGAAGGTGAGGGGGGCAGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084671924 11:70612041-70612063 TCCAGGAAGGAGGCGGCGTCCGG + Intronic
1086219009 11:84419113-84419135 TACAGAAAAGAGAAGGCGAGAGG + Intronic
1087028369 11:93675009-93675031 TACAGGAAAGGGAAGGGGGAAGG + Intronic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087274226 11:96144544-96144566 TACATGGAGGGGAAGGGGGCAGG - Intronic
1087626924 11:100605771-100605793 TACAGAAAGGAAAAACCGGCTGG + Intergenic
1088415952 11:109589212-109589234 TAAAGGAGAGAGGAGGCGGCAGG + Intergenic
1088593310 11:111421616-111421638 TACAAAAAGTAGAAGGCGGCTGG + Intronic
1089628224 11:119765171-119765193 ACCAGGCAGGAGAAGGAGGCTGG - Intergenic
1089630024 11:119778776-119778798 TGCAGGAAGGAGGAGGCTGGTGG - Intergenic
1089660654 11:119983092-119983114 AACAGGAGGGAGGAGGGGGCTGG - Intergenic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1090367303 11:126217620-126217642 TAAAGGCAGGAGGAGGGGGCAGG - Intronic
1090376477 11:126293065-126293087 TACAGGAGGGAGAAGGGGAACGG + Exonic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1091760745 12:3085599-3085621 TACAGGTAGGAGCAGGAGCCAGG - Intronic
1091781813 12:3218649-3218671 GAAAGGAAGGAGAAGGCACCAGG + Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092393446 12:8102884-8102906 TACAGGAAGGCAAAAGCGGGAGG - Intergenic
1095968052 12:47882691-47882713 TACCTGAAGGAGCAGGGGGCAGG + Exonic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096617018 12:52839085-52839107 TTCAGGAAGGAGGTGGCTGCTGG + Exonic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1101548676 12:105741146-105741168 GTCAGGCAGGAGAAGGTGGCAGG + Intergenic
1101883831 12:108644395-108644417 TGCAGGAAGTAGAAGTTGGCAGG - Intergenic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1103924958 12:124418524-124418546 TGCAGGTGGGAGAAGGTGGCTGG - Intronic
1103925539 12:124421787-124421809 TGCAGGTGGGAGAAGGTGGCTGG - Intronic
1104612464 12:130240970-130240992 GACAGGAAGTAGGAGGCAGCCGG - Intergenic
1104661820 12:130616827-130616849 CACAGGAAGGAGAAGTCAGAGGG + Intronic
1104901548 12:132191980-132192002 TACAGGAAGCAGCATGCGGGGGG - Intergenic
1105975546 13:25469117-25469139 ATCAGGTAGGAGAAGGCGGCCGG + Exonic
1106255587 13:28019648-28019670 GACAGGCAGGAGGAGGAGGCAGG - Intronic
1106339703 13:28817205-28817227 TGCAGGAGGGAGAAGGAGCCTGG + Intergenic
1108722035 13:53142041-53142063 TACAAGAGGAAGAAGGCAGCAGG - Intergenic
1109064179 13:57663819-57663841 TACAGGAACGAGGAGGAAGCAGG - Intronic
1112036373 13:95500390-95500412 TCCAGGAAGGAGAGTGCGCCTGG + Intronic
1114331474 14:21641526-21641548 AACAGGAAGGAAAAGACGGAGGG - Intergenic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119703102 14:76768425-76768447 GACAGGAAGGAGAAGACCGACGG + Intronic
1119851740 14:77871189-77871211 TTCAGGAAGGGGGAGGCAGCTGG + Intronic
1120479246 14:85028204-85028226 TACAGGAAGCAGAGGACAGCGGG - Intergenic
1121636978 14:95460699-95460721 TGCAGGAAGGGGAAGCCAGCAGG - Intronic
1121747936 14:96316165-96316187 TACGGGAAGGAGAGAGCGGAAGG + Intronic
1123418860 15:20114674-20114696 TCCAGAAAGCAGAAGGCAGCCGG + Intergenic
1123447007 15:20338861-20338883 TCCAGAAAGCAGAAGGCAGCCGG - Intergenic
1123528081 15:21121213-21121235 TCCAGAAAGCAGAAGGCAGCCGG + Intergenic
1123779603 15:23613391-23613413 TACAGGAAACAGATGGAGGCTGG + Intronic
1124007026 15:25802664-25802686 TTCAAGACAGAGAAGGCGGCCGG - Intronic
1124963140 15:34412993-34413015 GACAGGAAGTAGAATGCGGGTGG + Intronic
1124979763 15:34559219-34559241 GACAGGAAGTAGAATGCGGGTGG + Intronic
1125492070 15:40155740-40155762 CACAGGAAGGACTAGGAGGCAGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1127280912 15:57491856-57491878 TGCAGGAAGGAGGAGGAGGAGGG - Intronic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1128313221 15:66644595-66644617 AACAGGAAGAACAAGGCGTCAGG - Intronic
1129514006 15:76145490-76145512 TACATGAAGGAGAGAGCTGCTGG - Intronic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130661356 15:85833722-85833744 AACAGGAAGGGGAAGGAGGGTGG + Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132744724 16:1431866-1431888 TCCACGATGGTGAAGGCGGCTGG - Intergenic
1133013977 16:2930481-2930503 TACAAGCAGGAGAAGGCAGTGGG + Exonic
1133014643 16:2933778-2933800 TACCGGCGGGAGAAGGCGGCTGG + Exonic
1133015366 16:2937183-2937205 TACCGGCGGGAGAAGGCGGCCGG + Exonic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133050331 16:3113840-3113862 TACAGGAAGGAGAAAGGACCGGG - Intronic
1134103010 16:11465749-11465771 TAAAAGAAAGAGAAGGCGGGGGG + Intronic
1139895976 16:70288403-70288425 ATCAAGAAGGGGAAGGCGGCCGG - Intronic
1140424286 16:74847975-74847997 TAAAGGGAGGAGCAGGCGGGAGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141508455 16:84496451-84496473 AGAAGGAAGGAGAAGGCGGAAGG - Intronic
1141861898 16:86722824-86722846 TCCAGGAAGGAGATTGTGGCAGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142406142 16:89891319-89891341 TACAGGCAGGAGAAGCAGGCTGG + Intronic
1203138265 16_KI270728v1_random:1744117-1744139 TCCAGAAAGCAGAAGGCAGCCGG - Intergenic
1142849427 17:2697101-2697123 GACAGGAAGAAAAAGGCGGCCGG + Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143100605 17:4502735-4502757 GGCATGAAGGAGAAGGCAGCTGG - Intronic
1143570622 17:7755720-7755742 AACAGGAAGGAGGAGGCCACTGG + Intronic
1144385665 17:14747011-14747033 TCCAGAAAGCAGAAGGCGGGTGG - Intergenic
1145011548 17:19371085-19371107 TACAGGGAGAAGAAGGCAGGTGG + Intronic
1146514961 17:33481977-33481999 TAAAGAAAGGAGAGGGCAGCAGG - Intronic
1146537583 17:33666506-33666528 GACAGGCAGGAGGAGGCGGAGGG - Intronic
1146833285 17:36088950-36088972 GACAGGAAGAAGGAGGCAGCGGG - Intronic
1146847807 17:36195565-36195587 GACAGGAAGAAGGAGGCAGCAGG - Intronic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147591926 17:41689248-41689270 GACCGGAAGGAGCAGGCGGTAGG + Intronic
1147939693 17:44037537-44037559 TGCTGGAAGGAGAAGACAGCAGG + Exonic
1148432229 17:47650850-47650872 GATAGGAAGGAGAAGCCGGCCGG - Intronic
1149303983 17:55331143-55331165 AACAGGAAGCAGAAGTGGGCAGG - Intergenic
1151375165 17:73683528-73683550 TACAGCAAAGAGTAGGGGGCAGG - Intergenic
1152076663 17:78164259-78164281 GGCAGGAAGGAGAAGTTGGCAGG - Exonic
1152295769 17:79466192-79466214 TAGAGGAGGGAGGAGGCCGCTGG - Intronic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1153160201 18:2196235-2196257 TCCAGGAAGAAGAAGGCTGGAGG + Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153362200 18:4209902-4209924 TGAACGAAGGAGTAGGCGGCAGG - Intronic
1153663148 18:7343511-7343533 TCCAGGGAGAAGAAGGTGGCTGG + Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156213006 18:34967432-34967454 TCCAGGAAGGAGAAAGGGCCTGG - Intergenic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1160149377 18:76387674-76387696 GACAGGAAGGAGAACACGGCTGG + Intronic
1161586368 19:5107960-5107982 GACTGGAAGGAGGTGGCGGCTGG - Intronic
1161686064 19:5703232-5703254 TGCAGGAAGGAGGAGATGGCCGG + Intronic
1162126187 19:8500596-8500618 TGCAGGGAGGAGAAGGTGGCTGG - Intronic
1163044123 19:14626684-14626706 GACAGGGAAGAGAAGGCAGCTGG + Intronic
1163845746 19:19637386-19637408 TCCTGGAAGGAGAAGGCGGGCGG + Exonic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164597086 19:29537422-29537444 TGCAGGCAGGAGAAGGGGCCTGG - Intronic
1164987374 19:32658364-32658386 AACAGGAATGAGAAGCAGGCAGG - Intronic
1165116715 19:33533252-33533274 ACCAGGAAGGAGGAGGGGGCTGG - Intergenic
1165291394 19:34888933-34888955 AGCAGGAAGGAGAATGTGGCTGG - Intergenic
1165486778 19:36101221-36101243 TGCAGGAAGGAGGTGGAGGCCGG + Exonic
1166321511 19:42022025-42022047 TCCAGGAAGGAGAAGTAGCCAGG + Exonic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1166432687 19:42740572-42740594 AACAGGAGGGACAAGGAGGCAGG - Intronic
1166435795 19:42765769-42765791 AACAGGAGGGACAAGGAGGCAGG - Intronic
1202688371 1_KI270712v1_random:67974-67996 TCCAGAAAGCAGAAGGCAGCTGG + Intergenic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
926169057 2:10539570-10539592 TCCAGGAAGGAGAGAGGGGCTGG + Intergenic
926349427 2:11981921-11981943 TACAGGGAAGAGAAGGAAGCAGG + Intergenic
927315462 2:21676118-21676140 TCCAGGAAGGAGAGAGGGGCTGG + Intergenic
927395784 2:22649875-22649897 TACTGGATGGAGAAGCTGGCTGG + Intergenic
927787100 2:25981835-25981857 AGCAGGAAGGAGGAGGCTGCTGG - Exonic
928387321 2:30881480-30881502 TACACGAAGGAGGAAGGGGCCGG + Intergenic
929245500 2:39697761-39697783 AACAGGAAGGAGGTGGCAGCTGG - Intronic
931218246 2:60265713-60265735 TACAGGAAGGAGCAGGAAGTGGG + Intergenic
933433589 2:82215494-82215516 GCCATGAAGGAGCAGGCGGCTGG - Intergenic
933645963 2:84812896-84812918 AACAGGAAGGGGAATGCGGCAGG + Intronic
933958053 2:87387958-87387980 TCCAGAAAGCAGAAGGCAGCTGG - Intergenic
934270998 2:91536812-91536834 TCCAGAAAGCAGAAGGCAGCTGG + Intergenic
935881582 2:107571004-107571026 TCCAGGAAGGAGCAGAAGGCTGG - Intergenic
936551304 2:113443209-113443231 TACAGGGAGGCCAAGGCGGGCGG - Intronic
937681210 2:124646809-124646831 TTCAGAAAAGAGAAGGGGGCTGG + Intronic
938225754 2:129614717-129614739 AACAGGAAGGAGGAGGGGGGAGG + Intergenic
938797466 2:134730502-134730524 GACAGGACGGAGCAGGCCGCTGG - Intergenic
939001319 2:136738605-136738627 TACAGGTAGGAACAGGCTGCAGG - Intergenic
940293235 2:152098312-152098334 GACAGGTATGAGAAGGAGGCGGG - Exonic
941086381 2:161122957-161122979 AACAGGTAGGAGAAGGAAGCTGG - Intergenic
942664835 2:178306528-178306550 TGCAGGGAGGAAAAGACGGCAGG - Intronic
944605481 2:201348226-201348248 TAAAGGCAGGAGAGGGCGGTGGG - Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945273196 2:207962209-207962231 TCCAGGAAGGGGAAGGAGGCTGG + Intronic
946668095 2:222072436-222072458 TACATGAAAGAGAAGGCATCTGG - Intergenic
947808513 2:232984677-232984699 TGGAGGAAGGAGAAGCCGGGAGG + Intronic
948200609 2:236127435-236127457 GAAAGGAGGGAGAAGGCAGCGGG + Exonic
948837227 2:240631622-240631644 TGAAGGAAGGAGAAGAGGGCTGG - Intergenic
948883695 2:240872815-240872837 GACAGGCAGGAGAAGGCAACTGG + Intronic
948901426 2:240958585-240958607 TCCAGGCAGCAGCAGGCGGCTGG - Intronic
1168826896 20:820007-820029 AAGAGGAAGGAGAAGGCTGAGGG - Intergenic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169076638 20:2764053-2764075 GACAGGGTGGGGAAGGCGGCTGG - Intergenic
1169277721 20:4244702-4244724 TGCAGGAAGGAGAGGGGGCCAGG - Intronic
1170119438 20:12895615-12895637 GACAGGGAAGAGAAGGCAGCTGG - Intergenic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1172064824 20:32211821-32211843 TTCAGGAAGGAGAAGCTTGCAGG - Intronic
1172173525 20:32958969-32958991 TGCAGGGAGGAGCAGGCTGCTGG + Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172762388 20:37331839-37331861 TCCAGGAATGAGAAGGCTGCAGG + Intergenic
1172989078 20:39018513-39018535 TACAAGCAGGAGAAGGCTGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173871628 20:46345648-46345670 TGTGGAAAGGAGAAGGCGGCAGG - Intergenic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1175290003 20:57869429-57869451 TAGAGGAAGGAGAAGGCAAGGGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176100024 20:63360640-63360662 TGCAGGAAGGACAAGGTCGCGGG - Intronic
1176122378 20:63459996-63460018 TACAGGAAGCAGACGGCACCCGG + Intronic
1176199376 20:63853691-63853713 ACCAGGAGGGTGAAGGCGGCTGG - Intergenic
1176203986 20:63878213-63878235 GACGGGAAGGAGAACGTGGCCGG + Intronic
1178148944 21:29771867-29771889 TACAGGAGGGACTAGGGGGCGGG - Intronic
1179477842 21:41659376-41659398 GCCAGGAAGGAGAGGGAGGCAGG + Intergenic
1179946918 21:44684758-44684780 TACAGGAAGGAGATGGGGGAAGG + Intronic
1180050178 21:45327492-45327514 TGCGGGAAGGAGGAGGCTGCCGG + Intergenic
1180553117 22:16557025-16557047 TCCAGAAAGCAGAAGGCAGCCGG - Intergenic
1180793569 22:18590840-18590862 TACAGGATGGAGCAGGCAGAAGG + Intergenic
1181228170 22:21404473-21404495 TACAGGATGGAGCAGGCAGAAGG - Intergenic
1181250481 22:21530377-21530399 TACAGGATGGAGCAGGCAGAAGG + Intergenic
1181350971 22:22257403-22257425 TCCAGAAAGCAGAAGGCAGCCGG + Intergenic
1181820481 22:25471753-25471775 TTCAGGGAGGAGAAAGCGGGGGG + Intergenic
1183033558 22:35123519-35123541 TAAAAGGTGGAGAAGGCGGCAGG - Intergenic
1184288429 22:43484883-43484905 TACGGGAAGGAGACGGAGGTGGG - Intronic
1184431429 22:44443430-44443452 TACAAGAGGCAGAGGGCGGCAGG + Intergenic
1184527932 22:45036513-45036535 TACATGAAAGAGAAGTGGGCGGG - Intergenic
950468047 3:13167152-13167174 TGCAGGAACGAGAAGGCTCCAGG - Intergenic
952253775 3:31678278-31678300 GACAGGAAGGACAAGGGTGCAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952894244 3:38066376-38066398 TACAAGAAAGAGGAGGAGGCAGG - Intronic
953583847 3:44181701-44181723 CACAGGAAAGAGAAGGCAGGGGG + Intergenic
953979091 3:47404847-47404869 TGCAGCAAGGAGAAGGGGGAAGG - Intronic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954604792 3:51900937-51900959 TAGAGGAAGGTGCAGGCGGTGGG - Intronic
954891809 3:53937424-53937446 TCCAGGCAGGGGAAGGCAGCTGG + Intergenic
955020827 3:55119641-55119663 GACATGAAGGACAAGGCTGCTGG - Intergenic
955801905 3:62695594-62695616 TACAGGAAGGAGAAAGGAGGAGG - Intronic
956187572 3:66577021-66577043 TATAGGGAGAAGAACGCGGCTGG - Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
960245405 3:115394702-115394724 TATAGGATGGAGAGGGAGGCAGG - Intergenic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
961550364 3:127667470-127667492 TTCAGGAGGGAGAAGGCTGCTGG + Intronic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
963755540 3:149231752-149231774 TACAGGAAAGAGAAGGGGAGAGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965906660 3:173716474-173716496 TACAGGAAGCAAGAGGCAGCAGG + Intronic
966202515 3:177372169-177372191 TCCAGGGAGGGGGAGGCGGCTGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966516945 3:180829431-180829453 TACAAGCAGGAGAAGGCTGTCGG - Intronic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
967818650 3:193819675-193819697 TCCAGGTGGGAGAAGGTGGCTGG + Intergenic
967910753 3:194540768-194540790 TTCAGGAAGGAGGAAGTGGCTGG - Intergenic
968082284 3:195854791-195854813 CCCAGGAAGGAGAAGGCCGACGG - Intergenic
970641489 4:18071066-18071088 TGCAGGAAGGAGAAAGCAGAGGG + Intergenic
971405721 4:26319884-26319906 TGCAGGTAGGAGGAGGGGGCGGG + Exonic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
974231917 4:59127084-59127106 TACAGGAAAGAGAAGACTTCGGG + Intergenic
979140258 4:117163205-117163227 TCCAGGAAGGTGATGGGGGCTGG - Intergenic
981786597 4:148486609-148486631 TAAAGGAAAGAGAAGGAGACAGG - Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
985747642 5:1656114-1656136 AGGAGGCAGGAGAAGGCGGCCGG + Intergenic
986360636 5:6975011-6975033 TACAGGAAGGATGATGAGGCTGG + Intergenic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986767023 5:10937588-10937610 TACAGGAATGAAAATGCTGCAGG + Intergenic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
988683368 5:33503997-33504019 TACAGGAATGAGAAGGCCAGAGG + Intergenic
991425770 5:66490080-66490102 TAGAAGAAGTAGAAGACGGCAGG - Intergenic
992438498 5:76777853-76777875 TACAGTAATGGGAAGGGGGCTGG - Intergenic
994060501 5:95471641-95471663 TACAGGCAGTAGCAGGTGGCTGG + Intronic
995317406 5:110791516-110791538 TGCAGGAATGTGAATGCGGCTGG - Intergenic
997441098 5:133909077-133909099 TGCAGGAAGGAGAAGGATGAGGG + Intergenic
997736187 5:136214201-136214223 TTATGGAAGGAGGAGGCGGCAGG - Intronic
998406453 5:141877110-141877132 TTCAGGCAGGAGAAGCCGCCGGG - Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998820946 5:146057320-146057342 TACAGGAAGGTGATGGAGGGAGG - Intronic
998938619 5:147256909-147256931 TACAGGAAGGTGCAGGCGGTGGG + Intronic
999311729 5:150555799-150555821 TATGGGAAGGAGCAGGCGGTTGG + Exonic
999623077 5:153491553-153491575 GACAGCAAAGAGAAGGCAGCTGG - Intronic
999928236 5:156403138-156403160 GACAGACAGGAAAAGGCGGCAGG - Intronic
999945664 5:156592573-156592595 TCTAGGAAGGAGAAGGGAGCTGG - Intronic
1000110885 5:158107211-158107233 TAAAGGATGTAGAAGGTGGCAGG - Intergenic
1000202034 5:159020522-159020544 TGCAGGAAGGAGGAGGTGGGAGG - Intronic
1001942858 5:175753085-175753107 TCCAGGGAGGAGGAGGAGGCAGG + Intergenic
1002065177 5:176648130-176648152 TACTGGAAGGGAAAGGAGGCCGG - Intronic
1004301537 6:14462694-14462716 TGTGGGAAGGAGAAGGCAGCAGG - Intergenic
1005511648 6:26517268-26517290 TACATGAAAGAGATGGCTGCTGG + Intergenic
1006378806 6:33685996-33686018 TACAGCACGGAGAGGGAGGCTGG - Intronic
1007463181 6:42032811-42032833 TACAGGAAGATGAGGGCAGCTGG - Intronic
1008535643 6:52504465-52504487 GTCAGGAAGGAGAAGCTGGCAGG + Intronic
1008810371 6:55490053-55490075 TACAGGACGGAGAATATGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010993862 6:82511091-82511113 TGCAGCAAAGAGAAGGCAGCAGG + Intergenic
1011353369 6:86447094-86447116 TACAGGATGGAGAGTGGGGCAGG + Intergenic
1012660870 6:101889763-101889785 TTCAGGAAGGAGAAGACGCCTGG - Exonic
1013251867 6:108342273-108342295 GACAGGACGGAGAAGGCATCAGG + Intronic
1014169650 6:118264943-118264965 TACAGGAAGGAGGTGGTGGCAGG - Intronic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1016617261 6:146065725-146065747 TCCAGATAGGAGAAGGCGGAAGG + Intronic
1017274557 6:152551079-152551101 TAGAGGAAGGAAAAGGTGTCAGG - Intronic
1017679034 6:156845259-156845281 TACAGAATGCAGAATGCGGCAGG - Intronic
1017716676 6:157218071-157218093 GACAGGACGGAGAGGGCGGGTGG + Intergenic
1018747428 6:166773222-166773244 TGCAGGTTGGAGAAGGAGGCAGG + Intronic
1019524241 7:1473587-1473609 TGCAGGAAGGAGATGGCTGCTGG + Exonic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019990711 7:4688773-4688795 TACAGGAATGACAAGGGGGAGGG - Intronic
1020121595 7:5507148-5507170 TACAGGAAGCAGGAGCAGGCTGG - Intronic
1020149043 7:5667511-5667533 TGCAGGATGGAGAAGGCTGGGGG - Intronic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1021909191 7:25367146-25367168 GACAGGAAGTAGAAGGAAGCGGG + Intergenic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022605319 7:31807662-31807684 TACAGGATGGAGAAAGTGTCTGG + Intronic
1023116157 7:36864655-36864677 TCCATGAGGGAGAAGGCGCCAGG + Intronic
1023785631 7:43705318-43705340 CACTGGCAGGAGAAGGCTGCAGG + Intronic
1024152144 7:46582704-46582726 CACAGGGAGGAAAAGGCCGCAGG + Intergenic
1026641019 7:72125746-72125768 GACAGGAAGGTGGGGGCGGCAGG - Intronic
1026738054 7:72961294-72961316 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1026789091 7:73320091-73320113 TACAGGAAAGTGAAGGTGGCCGG + Intronic
1027105680 7:75403774-75403796 TACAGGAAAGTGAAGGTGGCCGG - Intronic
1028235851 7:88360938-88360960 TCCAGAAAGGAGATGGGGGCTGG + Intergenic
1028604118 7:92636429-92636451 TACAAGAATGAGAAGGCTGAGGG + Intronic
1029546364 7:101212440-101212462 TGCAGGAAGGAGATGGGGGTGGG + Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032797406 7:135288909-135288931 GACAGGGAGGAGAGGGAGGCAGG + Intergenic
1033068526 7:138179994-138180016 GACAAGTAGGAGAAGGAGGCTGG - Intergenic
1033329220 7:140404233-140404255 ACCAGGAAGGCGAAGGCTGCGGG + Intronic
1034035186 7:147812218-147812240 TCCAGGAAGAGGAAGGAGGCCGG + Intronic
1034140113 7:148807714-148807736 AACAGGAAGGAGATGTCCGCTGG + Intronic
1034261974 7:149762960-149762982 TTCAGGGAGGAGGAGGCCGCTGG - Intergenic
1035062420 7:156079429-156079451 TACAGGGAGCAGATGGCGGTCGG - Intergenic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1039838141 8:41273913-41273935 TAAAGCAAGGAGAAGAAGGCAGG + Intronic
1041014101 8:53573678-53573700 TACGGGATGGGGAAGGCAGCAGG - Intergenic
1042242923 8:66682634-66682656 TACAGGAAGGATCAGGGGACAGG - Intronic
1045785894 8:105919566-105919588 TGCAGGGAGGAGAAGGCCTCAGG - Intergenic
1047696966 8:127413433-127413455 TACAGCTAGGTGAAGGGGGCAGG - Intergenic
1048438317 8:134438958-134438980 AACAGGAAGGAGAAGGAAGTGGG - Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1050507767 9:6365183-6365205 AAAAGGAAGGAGAGGGCTGCAGG + Intergenic
1051897676 9:22005832-22005854 CACAGGAAGGAGGAGCCGACCGG - Exonic
1052806418 9:33017840-33017862 TCCAGGGAGGAGAAAGGGGCTGG - Intronic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1055306964 9:74939765-74939787 TACAAGAAGAAGAAAGCGGCCGG - Intergenic
1055316567 9:75039886-75039908 TACAGGAAAGAGAAGGGGAGGGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057200699 9:93138252-93138274 AACAGGCAGGAGCAGGAGGCTGG + Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057911986 9:99026415-99026437 TACAGGAAGGTGAACTGGGCAGG - Intronic
1058430808 9:104917456-104917478 TACATTAAGGAGTAAGCGGCCGG + Intronic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059094503 9:111398562-111398584 TACAAGAGGGAGCAGGCGGCAGG + Intronic
1060105646 9:120871273-120871295 TACAGGAAGGAGAAGTAGGTGGG - Intronic
1060220965 9:121763907-121763929 GACAGGATGGGGAAGGCGACAGG - Intronic
1060685630 9:125608750-125608772 TACTGGAAGGTTAAGGCAGCCGG - Intronic
1060893183 9:127201461-127201483 TGCAGGATGGAGATGGAGGCCGG - Intronic
1061490269 9:130940317-130940339 TCCTGGAAGGAAAAGGCGGCTGG - Intergenic
1061808728 9:133150277-133150299 GACAAGAAGGAGACTGCGGCTGG - Intergenic
1061929177 9:133823662-133823684 TCCAGGAAGGAGTAGGCAGCTGG - Intronic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1185533237 X:838782-838804 TCCAGAAAGCAGAAGGCAGCCGG - Intergenic
1185726673 X:2427225-2427247 TCCAGGAAGAGGAAGGCGGCTGG + Intronic
1186205639 X:7197121-7197143 TACTGGAAGGAGGAGTTGGCTGG - Intergenic
1186517447 X:10176529-10176551 AACAGGAAGGAGCAAGGGGCAGG + Intronic
1187765886 X:22641547-22641569 TACAGGAAAGGGATGGCAGCTGG - Intergenic
1187843560 X:23513356-23513378 TACATGATAGAGAAGGCAGCTGG - Intergenic
1189232106 X:39460608-39460630 GACAGGAAGGAGAATGAGACTGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190753406 X:53381058-53381080 TCCAGGACGAAGAAGGGGGCTGG + Exonic
1197992380 X:132332060-132332082 TACAGTAAGGAGAAAGGGGTGGG - Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1199941052 X:152628219-152628241 GACAGGAAGGAGGAGGAGGAAGG + Intergenic