ID: 1133019696

View in Genome Browser
Species Human (GRCh38)
Location 16:2961905-2961927
Sequence GCAGATGCACAGGTGCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133019696_1133019700 10 Left 1133019696 16:2961905-2961927 CCAATCTGCACCTGTGCATCTGC No data
Right 1133019700 16:2961938-2961960 GATGACATGCCAAGCCTGTCAGG No data
1133019696_1133019702 18 Left 1133019696 16:2961905-2961927 CCAATCTGCACCTGTGCATCTGC No data
Right 1133019702 16:2961946-2961968 GCCAAGCCTGTCAGGCCCTAGGG No data
1133019696_1133019701 17 Left 1133019696 16:2961905-2961927 CCAATCTGCACCTGTGCATCTGC No data
Right 1133019701 16:2961945-2961967 TGCCAAGCCTGTCAGGCCCTAGG No data
1133019696_1133019705 26 Left 1133019696 16:2961905-2961927 CCAATCTGCACCTGTGCATCTGC No data
Right 1133019705 16:2961954-2961976 TGTCAGGCCCTAGGGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133019696 Original CRISPR GCAGATGCACAGGTGCAGAT TGG (reversed) Intergenic
No off target data available for this crispr