ID: 1133021273

View in Genome Browser
Species Human (GRCh38)
Location 16:2967937-2967959
Sequence CAGGCTGAGGGTTCTGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 204}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133021258_1133021273 3 Left 1133021258 16:2967911-2967933 CCTTGCCCTGCTCCCCCGGGGAC 0: 1
1: 0
2: 3
3: 38
4: 431
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021260_1133021273 -3 Left 1133021260 16:2967917-2967939 CCTGCTCCCCCGGGGACCCCCAG 0: 1
1: 0
2: 9
3: 53
4: 502
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021252_1133021273 16 Left 1133021252 16:2967898-2967920 CCCCGAGGGGTGGCCTTGCCCTG 0: 1
1: 0
2: 6
3: 24
4: 187
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021254_1133021273 14 Left 1133021254 16:2967900-2967922 CCGAGGGGTGGCCTTGCCCTGCT 0: 1
1: 0
2: 1
3: 42
4: 307
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021263_1133021273 -10 Left 1133021263 16:2967924-2967946 CCCCGGGGACCCCCAGGCTGAGG 0: 1
1: 0
2: 8
3: 76
4: 410
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021259_1133021273 -2 Left 1133021259 16:2967916-2967938 CCCTGCTCCCCCGGGGACCCCCA 0: 1
1: 0
2: 2
3: 33
4: 308
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021262_1133021273 -9 Left 1133021262 16:2967923-2967945 CCCCCGGGGACCCCCAGGCTGAG 0: 1
1: 0
2: 2
3: 30
4: 260
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021253_1133021273 15 Left 1133021253 16:2967899-2967921 CCCGAGGGGTGGCCTTGCCCTGC 0: 1
1: 0
2: 1
3: 39
4: 298
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204
1133021251_1133021273 23 Left 1133021251 16:2967891-2967913 CCAACAGCCCCGAGGGGTGGCCT 0: 1
1: 0
2: 2
3: 10
4: 165
Right 1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133021273 Original CRISPR CAGGCTGAGGGTTCTGCCGC GGG Exonic
900447298 1:2687748-2687770 CAGGGTGTGGGTTCTGCTCCAGG - Intronic
900503529 1:3018079-3018101 CTGGCTCAGGGCCCTGCCGCTGG - Intergenic
902935675 1:19762926-19762948 AAGGCTGAAGTTTCTGCCTCTGG - Intronic
903018950 1:20380128-20380150 CAGGGTGAGGGTTCGAACGCAGG - Intergenic
903649890 1:24916059-24916081 CCGGCTGTGGGTTCTGTGGCCGG - Intronic
904405281 1:30284368-30284390 CAGGCTGAGGGTGCAGCCCCAGG - Intergenic
904755261 1:32765434-32765456 CAGGGTGAGTGATCTGCTGCTGG + Intronic
905905475 1:41615378-41615400 CAGGCTGAGGGTTCTCCAGGTGG - Intronic
914847566 1:151291463-151291485 CACACTGGGGGTTCTGCAGCAGG - Exonic
915296420 1:154924838-154924860 CAGGCTGAGGGGACTGGCACTGG + Exonic
916709187 1:167387194-167387216 CAGCCTGAGGTTTCTGGAGCTGG + Intronic
918149061 1:181782636-181782658 CAGGCTGGTGGTTCTGCCAGAGG + Intronic
919886914 1:201941600-201941622 CATTCTGAGGGTTAGGCCGCCGG + Intronic
920249126 1:204610892-204610914 CAGGCGGAGGGTTCTTTGGCTGG + Intergenic
1062891388 10:1063373-1063395 CAGGGTGAGGGTGGTGCTGCAGG - Intronic
1062891400 10:1063454-1063476 CAGGGTGAGGGTGGTGCTGCAGG - Intronic
1063477704 10:6343308-6343330 GAGGCTGATGGTCCTGACGCTGG + Intergenic
1065763214 10:29002448-29002470 CAGCCTGAGTGTTCAGCCGCAGG - Intergenic
1067232448 10:44421572-44421594 CATGCTGATGGTTTTGCCCCTGG - Intergenic
1068722209 10:60258296-60258318 CAGGCTCATGGGTCTGCTGCAGG - Intronic
1073184429 10:101607292-101607314 CAGGCTGAGGGCTCTTCCTGGGG - Intronic
1073330973 10:102669633-102669655 CTGGCTGAGGGGCCTGCAGCTGG + Intergenic
1075626112 10:123965585-123965607 CAGGCTGGGGTGTCTGCCGCTGG - Intergenic
1076672247 10:132129661-132129683 CAGGCTCAGGGATCTGCCTGTGG + Intronic
1076919597 10:133444809-133444831 CAGGGAGAGGGCTCTGCCCCAGG - Intergenic
1077387685 11:2278838-2278860 CAGGCTGGGGGTGCTGCCTCTGG - Intergenic
1078667870 11:13341119-13341141 GAGGCTGAGGGTTCTCCCCTAGG - Intronic
1079130554 11:17744649-17744671 CAGGCTGTGGGGTCTGGAGCAGG + Intronic
1081021700 11:37956530-37956552 CAGGCTTAGGGTTCAGGCACTGG - Intergenic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1083602170 11:63955533-63955555 CAGGCAGAGGGGCCTGCTGCTGG - Exonic
1084188766 11:67489407-67489429 GGGGCTGGGGGTTCTGCTGCAGG - Exonic
1089824876 11:121265951-121265973 CATGCTGAGGGATCTTCCCCTGG + Intergenic
1091370262 11:135051571-135051593 CAGGCTTATGGTTCAGCCACTGG + Intergenic
1098342975 12:69470617-69470639 CGGGCTGAGGGCTCGGCTGCCGG + Intronic
1101804612 12:108052444-108052466 GAGACTGAGGGTTCTGCCGTGGG + Intergenic
1103930840 12:124449969-124449991 CTGGGTGAGGGCTCAGCCGCAGG + Intronic
1104040499 12:125127169-125127191 AAGGCTGAGGGGTCGGCCTCAGG - Intronic
1109590623 13:64476151-64476173 AAGCCTGAGGGTTCTGCAGGAGG - Intergenic
1110301977 13:73939176-73939198 AAGTCTGAGGAATCTGCCGCGGG - Intronic
1112018950 13:95354928-95354950 CAGGCTGAGGGTTGGGAGGCTGG - Intergenic
1112507424 13:99983199-99983221 CAGGCTGTGGGTGCCGACGCTGG + Intronic
1117584018 14:57181701-57181723 CAGGCTGAAAGTTTTGCCCCGGG + Intergenic
1118983719 14:70735566-70735588 CAGGCTGTGGGTTTGGCAGCAGG - Intronic
1120387118 14:83860727-83860749 CAGGTTGAGTGTTCTGCTGAAGG + Intergenic
1121564288 14:94896899-94896921 CAGGTTGAGGGTTCTGGTGGGGG - Intergenic
1122501010 14:102199518-102199540 GAGGCTGAGGGTTGGCCCGCTGG + Intronic
1123123351 14:105928274-105928296 CAGGCTCAAGGTCCTGCCCCAGG - Intronic
1123405993 15:20019778-20019800 CAGGCTCAAGGTCCTGCCCCAGG - Intergenic
1123515323 15:21026426-21026448 CAGGCTCAAGGTCCTGCCCCAGG - Intergenic
1124385742 15:29207069-29207091 CTGGCTGAGGGCACTGCTGCAGG - Intronic
1125770981 15:42165838-42165860 CAGTCAGATGGTTCTGCTGCTGG - Intronic
1128252681 15:66174004-66174026 CAGGGAGAGGATTCTGCCTCAGG - Intronic
1130305558 15:82710237-82710259 CAGGCTGGGGGTTCTAGAGCGGG + Intergenic
1131130719 15:89898621-89898643 CAGCCTGAGGGATCTTCCACAGG - Exonic
1131180822 15:90238579-90238601 CAGGGAGAGGGGTCTGCCACTGG - Intronic
1131676863 15:94678935-94678957 CAGTCAGATGGTTCTGCCCCAGG - Intergenic
1133008822 16:2898919-2898941 CAGGCAGAGGCTTCTGGCCCTGG + Intronic
1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG + Exonic
1133613063 16:7451093-7451115 CAGGCTGAGGGTTAAGGCTCTGG + Intronic
1133826638 16:9283919-9283941 CAAGCTGAGGGATCTGACACAGG + Intergenic
1134857014 16:17528295-17528317 GAGGCTGAGAGTTCTGCTGCCGG + Intergenic
1135699599 16:24620505-24620527 CAGGCTGGGTGTTCTGGCTCAGG + Intergenic
1135937859 16:26796338-26796360 CAGGAGGAAGGTTCTGCAGCAGG + Intergenic
1136677461 16:31924607-31924629 CAGGCTGAGGGTGAAGCCCCTGG - Intergenic
1137381623 16:48004562-48004584 CTTGCTGAGGAGTCTGCCGCTGG - Intergenic
1138577460 16:57917215-57917237 CTGGCTGAGCGGTCTGCCCCCGG + Intronic
1139437363 16:66943896-66943918 CAGGCTGTAGGTTCAGCTGCAGG - Exonic
1139469435 16:67170441-67170463 GAGGGTGAGGGTTCTTCCCCGGG - Intronic
1139484739 16:67249109-67249131 CAGGCTTAGAGCTCTTCCGCTGG + Exonic
1139512016 16:67432906-67432928 CAGGTTGTGGGCTCTGCCTCTGG + Intronic
1139551077 16:67673425-67673447 CAGGCCGAGGCTCCTGCCACAGG + Intergenic
1139571268 16:67814178-67814200 CAGGCTCTGGGTGCTGCCTCCGG - Intronic
1140504802 16:75464519-75464541 GAGCCTGAAGGTTGTGCCGCGGG - Exonic
1140901587 16:79372870-79372892 CAGGCTGAAGGTCCTGCAGTGGG - Intergenic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1141797982 16:86287317-86287339 CAGGCTGTGGGTCCGTCCGCTGG + Intergenic
1141828708 16:86497856-86497878 CATGCGGAGGGCTCTGCCGCCGG + Intergenic
1142396065 16:89832264-89832286 CAGCCTGCCTGTTCTGCCGCTGG + Intronic
1142738518 17:1917054-1917076 CAGCCTGAGGCTGCGGCCGCGGG + Intergenic
1143562805 17:7705420-7705442 GGGGCTGAGCGCTCTGCCGCGGG + Exonic
1143617802 17:8064129-8064151 CAGACTCCGGGGTCTGCCGCTGG + Intergenic
1148241030 17:45999407-45999429 TAAGCTGAGGGTTCTGTCTCTGG - Exonic
1149866615 17:60154680-60154702 CAGGCTGAGGGCTCTGCCTCAGG - Intronic
1152225776 17:79092038-79092060 CGGCCTGAGGGTGCTCCCGCAGG - Intronic
1152599652 17:81255651-81255673 CCAGCAGAGGGTGCTGCCGCAGG + Intronic
1153931505 18:9883526-9883548 CAGGCTGTGGGGCCTGCCCCAGG + Intergenic
1155507795 18:26549053-26549075 CGGGCCGCGGGTGCTGCCGCGGG + Exonic
1157210892 18:45741027-45741049 GAGGCTAAGGGATGTGCCGCAGG + Intronic
1161038488 19:2097973-2097995 CAGGCTGAGGGGCGTGCCGGTGG + Intronic
1163470935 19:17496586-17496608 CAGGCTGAGGGTTGCCCTGCGGG + Intronic
1164605343 19:29593926-29593948 CAGGCTCAGCCTCCTGCCGCTGG + Intergenic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166663935 19:44665863-44665885 CTGGGTGAGGTTTCTGCTGCTGG - Intronic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
925275000 2:2642318-2642340 CATGATCAGGGTTCAGCCGCAGG + Intergenic
925468818 2:4136482-4136504 GAGGCTGAGGATGCTGCAGCAGG + Intergenic
926035324 2:9631205-9631227 CAGGCTGCGGCTTCGGCCACGGG + Intergenic
926915089 2:17883626-17883648 CAGGCTGAGGATTCTAAGGCAGG + Intronic
927713515 2:25339939-25339961 CAGGAGGCGGGTTCAGCCGCTGG + Intronic
927777753 2:25915463-25915485 CAAGCTGAGGGTGCTGGCTCCGG - Intergenic
928445915 2:31333165-31333187 CAGGCTGAGGATTCTCTTGCTGG - Intergenic
929533071 2:42764322-42764344 CAGCCTGGGGGTTGTGCTGCTGG + Intergenic
931982074 2:67704526-67704548 TAGCCTAAGGGTTCTGCCTCTGG - Intergenic
937126620 2:119478758-119478780 CAGGCTGAGGGGTGTCCCTCTGG - Intronic
938551200 2:132383971-132383993 CAGGCTGAGAGGTCTGCCTAAGG + Intergenic
938551439 2:132386056-132386078 CAGGCTGAGAGGTCTGCCTAAGG + Intergenic
938852782 2:135278512-135278534 CAGGATGAGAGCTCTGCAGCAGG + Intronic
948123489 2:235548052-235548074 CAGGCTGCTGTTTCTGCCCCAGG + Intronic
948916514 2:241037204-241037226 CAGGCTGAGGCCTCAGCGGCGGG - Intronic
948988831 2:241541671-241541693 CATTCTGAAGGTTCTGCCGATGG - Intergenic
1171424691 20:25042249-25042271 CAGGCTGCGGCTGCTGCCACTGG - Intronic
1171443662 20:25187458-25187480 GAGGCTGAGGGAGCTGCCTCAGG - Intergenic
1171981476 20:31632182-31632204 CATGCTATGGGTTCTGCGGCAGG + Intergenic
1174061216 20:47834265-47834287 AAGGCTGAGGGTTGTGTAGCTGG - Intergenic
1174061224 20:47834321-47834343 AAGGCTGAGGGTTGTGGTGCTGG - Intergenic
1174070552 20:47896378-47896400 AAGGCTGAGGGTTGTGGTGCTGG + Intergenic
1174070560 20:47896434-47896456 AAGGCTGAGGGTTGTGTAGCTGG + Intergenic
1175246090 20:57582963-57582985 CAGGCTGAGGGGTCTGGGGTGGG + Intergenic
1175785688 20:61710452-61710474 CAGGAGGGGGGCTCTGCCGCAGG - Intronic
1175961663 20:62640397-62640419 CAGGTGAAGGGTCCTGCCGCAGG - Intergenic
1177190900 21:17849941-17849963 CTGGCTGAGGGTTGTGCCCATGG + Intergenic
1180011645 21:45055157-45055179 CAGCCTGCGGGTTCTGCTGAGGG + Intergenic
1180127285 21:45801118-45801140 CAGGCTGTGGGTGCTGCAGGTGG - Intronic
1181538788 22:23562018-23562040 CAGGCTGAGGGCCCTGGCACAGG - Intergenic
1181625417 22:24119432-24119454 GAGGCTGGGGTTTCTGCAGCAGG - Exonic
1182393722 22:30020367-30020389 CAGGCTGAGAGTGCTGCCAAGGG - Exonic
1182557297 22:31136144-31136166 GAGGCTGAGGCTTCTGGCTCAGG - Intronic
1183778105 22:39980986-39981008 CTGGCTGGGGGGTCTGCAGCTGG + Intergenic
1183991304 22:41598691-41598713 CAGGCAGAGGGGTCTGGAGCAGG + Exonic
1184596817 22:45518910-45518932 CAGGCTGCGGGTGCTGCAGTGGG + Intronic
1185342747 22:50299041-50299063 CAGGCTGTGGGCTCTGGCACGGG + Intronic
950478298 3:13227895-13227917 CAGGCTGAGGATCCAGCCTCAGG - Intergenic
951076606 3:18401110-18401132 CAGGATGAGTGCTCTGCTGCAGG - Intronic
953918008 3:46932948-46932970 CAGGGTGTGGATTCTGCCTCCGG - Intronic
954278202 3:49555988-49556010 CAGGCTGACCTGTCTGCCGCAGG - Intronic
954869640 3:53757972-53757994 CAGGCTGAGTCTTCTGCTTCTGG + Intronic
955769708 3:62374819-62374841 GAGGCTGAGGGTTCTTACGGAGG + Intergenic
957637687 3:82807900-82807922 CAGGCTGAGGGTGAAGGCGCAGG + Intergenic
960269544 3:115658912-115658934 CAGGCTGCGGTTGCTGCTGCGGG - Intronic
962606248 3:137035166-137035188 CAGGCTGAGGGCTCAGGCTCAGG - Intergenic
965884903 3:173433249-173433271 CAGGATGAGGGTGCTCCTGCAGG - Intronic
968097402 3:195941332-195941354 CAGTCTGAGGGCCGTGCCGCTGG + Intergenic
968466497 4:754189-754211 CAGGCTGGGGGTTCTGGTGTGGG + Intronic
968727023 4:2252532-2252554 CAGCCTGATGGTTCTGTCTCTGG - Intronic
968871945 4:3246785-3246807 CAGTGTGAGGGCTCTGCCTCGGG + Intronic
969466874 4:7362580-7362602 CAGGAAGAGGGCTCTGCCCCTGG + Intronic
970350613 4:15198230-15198252 CAGGCAGAGGGTGCTGCTACAGG - Intergenic
971053328 4:22885689-22885711 CAGGCAGAAGGTTCTGCAGTTGG - Intergenic
971499234 4:27300603-27300625 CAGGCAGAGGTATCTGCTGCAGG - Intergenic
972505830 4:39718900-39718922 CAGGCTGAGGGAGCTGGCTCCGG + Intronic
977507698 4:97923216-97923238 CAGGCTGAGGGAGCTGGCTCCGG - Intronic
985495184 5:200162-200184 CAGGCTGAGGGTCTTGCTGTCGG - Exonic
985506561 5:284890-284912 CAGTCTGAGGGTCTTGCAGCTGG + Intronic
985506587 5:285055-285077 CAGTCTGAGGGTCTTGCAGCTGG - Intronic
985741553 5:1620087-1620109 CAGTCTGAGGGCTGTGCAGCTGG + Intergenic
986285302 5:6354505-6354527 CAGGCTGGGGGTCCAGCCTCGGG + Intergenic
986285353 5:6354699-6354721 CAGGCTGGGGGTCCAGCCACAGG + Intergenic
986720460 5:10557403-10557425 AGGGCTCAGGGTTCTGCTGCAGG + Intergenic
997202379 5:132018916-132018938 AAGTCTGTGGGTTCTGCCCCTGG - Intergenic
998012563 5:138707235-138707257 CTGGCTGAGGGCTCTGCAGGAGG + Intronic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
999613783 5:153400172-153400194 GAGGCTGAGGCATCTGCTGCAGG - Intergenic
1002400095 5:178986771-178986793 CAGGCTGGGGCGTCTGCCTCCGG + Intronic
1003607717 6:7579706-7579728 AAGGTTGAGGGTTCTACTGCAGG + Exonic
1003868064 6:10381478-10381500 CAGGCTCGGGGACCTGCCGCAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1012168365 6:95987909-95987931 CTGGCTGATGGTTATGCCCCTGG + Intergenic
1012846460 6:104395596-104395618 CAGGCTGAGAGTTCTACCATTGG + Intergenic
1013935076 6:115584563-115584585 CAGCCTCAGGCTTCTGCCTCAGG - Intergenic
1017043661 6:150327518-150327540 CAGGCTGAGGGCGCTGCCAGAGG + Intergenic
1018069772 6:160154167-160154189 CAGAATGAGGGATCTGCCACTGG - Intronic
1018091507 6:160349558-160349580 CAGGCGGAGGCTGCTGCCGGCGG + Intronic
1019455100 7:1122850-1122872 CGGGCAGGAGGTTCTGCCGCTGG - Intronic
1019488871 7:1301825-1301847 GAGGCTGTGGGCTCTGCCACCGG + Intergenic
1025171283 7:56759370-56759392 AAGGCTGAGGGTTCTTTCTCTGG + Intergenic
1025233513 7:57218567-57218589 AAGGCTGAGGGTTGTGGAGCTGG + Intergenic
1025700585 7:63816117-63816139 AAGGCTGAGGGTTCTTTCTCTGG - Intergenic
1026237047 7:68535498-68535520 CAAGCTGAGGGTGCTGGCTCCGG + Intergenic
1028392616 7:90334384-90334406 CAGGCTGAGGGAGCTGCCTCCGG - Intergenic
1028556812 7:92134227-92134249 CAGGCTGAGGGTGAAGGCGCAGG + Exonic
1034936327 7:155203062-155203084 CTGGATCAGGGTTCTGCTGCTGG + Intergenic
1036484715 8:9169151-9169173 CAGGCTAAAGGTTCTGCCCTAGG + Intergenic
1039431219 8:37526567-37526589 CAGGATGAAGGCTCTGCAGCAGG + Intergenic
1041315654 8:56559492-56559514 CAGGCTGAGGAGTCTGGCCCCGG + Intergenic
1046455630 8:114456298-114456320 CGGGCTGGGGGTTTTGCAGCAGG - Intergenic
1049410924 8:142473715-142473737 AAGGAAGAGGGTTCTGCAGCAGG + Intronic
1049579365 8:143404441-143404463 CTGGTGGAGGGTCCTGCCGCAGG + Intergenic
1050367326 9:4884608-4884630 CAGGCTGAGAGATCTGGCTCAGG - Intronic
1053268061 9:36730359-36730381 CAGGCACAGGGTTCTGGGGCTGG + Intergenic
1056081021 9:83093704-83093726 CAAGCTGAGGGATCTGGCTCTGG + Intergenic
1057169273 9:92951042-92951064 CAGGCTGAGGGTTGTGGCCAGGG + Intronic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1057524514 9:95786702-95786724 CAGCCTGAGGCTTCTGCCCTCGG - Intergenic
1058225460 9:102356211-102356233 CAGCCTGAGGGTACTGCAGGAGG - Intergenic
1058425036 9:104868883-104868905 CAGGCGGAGGGGTATGACGCGGG + Intronic
1060111722 9:120911346-120911368 GAGGCTGACGGTCCTGCCACAGG + Exonic
1060209451 9:121700823-121700845 AAGGCTGAGGGTCCCGCCTCAGG - Intronic
1060569737 9:124627475-124627497 CAGGCTGAGGGGTTTTCAGCAGG + Intronic
1061243375 9:129387257-129387279 CAGGCTGAGGGCCCTGGCACAGG + Intergenic
1061628465 9:131856353-131856375 CTGGCTGAGGGTTCTGGCTTAGG + Intergenic
1061846249 9:133389948-133389970 CAGCCTGAAAGTTGTGCCGCTGG - Intronic
1062085824 9:134647669-134647691 GAGGCTGTGGGTTCTGCCGCAGG + Intronic
1062272317 9:135715073-135715095 CAGGCTGCGGGCTCCGCCACCGG - Intronic
1062427409 9:136512352-136512374 CGGGCAGAGGGTGCTGCCACGGG - Intronic
1062586202 9:137251089-137251111 CAGGCTGGGGGTCCTGGCCCAGG + Intergenic
1185513162 X:677994-678016 AATGCTGAGAGTTCTGCCTCTGG - Intergenic
1188107791 X:26164369-26164391 CAGCCTGAGAGTTCTGCCCTGGG - Intergenic
1188111178 X:26197591-26197613 CAGCCTGAGAGTTCTGCCCTGGG - Intergenic
1190053949 X:47171219-47171241 CATGCTGAGGATGCTGCCACAGG + Exonic
1190233798 X:48601158-48601180 CAGGGTCAGGGTTCTGGCTCTGG + Intronic
1191053960 X:56222950-56222972 CAGGCTGAGGGAGCTGGCTCTGG + Intergenic
1192180860 X:68914712-68914734 CAGGCTGGGGGTTGGGCCCCAGG + Intergenic
1196818817 X:119686622-119686644 CAGGAGGAGGCTTCTGCTGCTGG - Intronic
1200412669 Y:2876989-2877011 CAGGCAGAGGGTTAGGCCTCCGG - Intronic
1200911552 Y:8535752-8535774 CAGGCCTAGGGTGCTGCCTCAGG - Intergenic