ID: 1133021588

View in Genome Browser
Species Human (GRCh38)
Location 16:2969303-2969325
Sequence CTGGCGTCCCCTCCCGCGTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133021574_1133021588 29 Left 1133021574 16:2969251-2969273 CCGGCGCGCGAAACGCTGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 21
Right 1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG 0: 1
1: 0
2: 2
3: 16
4: 75
1133021582_1133021588 6 Left 1133021582 16:2969274-2969296 CCGGCGGGAACTAGGAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 127
Right 1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG 0: 1
1: 0
2: 2
3: 16
4: 75
1133021580_1133021588 10 Left 1133021580 16:2969270-2969292 CCGGCCGGCGGGAACTAGGAGCC 0: 1
1: 0
2: 1
3: 2
4: 69
Right 1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG 0: 1
1: 0
2: 2
3: 16
4: 75
1133021573_1133021588 30 Left 1133021573 16:2969250-2969272 CCCGGCGCGCGAAACGCTGGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG 0: 1
1: 0
2: 2
3: 16
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133021588 Original CRISPR CTGGCGTCCCCTCCCGCGTC CGG Exonic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
900612935 1:3552031-3552053 CAGGGGTCCCCTCCCGTGCCTGG - Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
902870012 1:19308300-19308322 CTGGCCTCCCCTTCCTGGTCTGG - Intronic
905308388 1:37034075-37034097 CTGGCGGCGCCTCCGGAGTCTGG - Exonic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
907540862 1:55214853-55214875 GCGGCGGCCCCTCCCGCGGCGGG - Exonic
909171275 1:72298956-72298978 CAGGCGCCCCCTACCGCGTCTGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913650996 1:120913599-120913621 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914170118 1:145215468-145215490 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914525235 1:148459431-148459453 CTGGCGCCCCCTCCCGCTTTTGG + Intergenic
914598441 1:149176399-149176421 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
914641167 1:149607703-149607725 CTGGCGCCCCCTCCCGCTTTTGG - Intergenic
915446793 1:155978646-155978668 CTGGCGTCCCGTCCTGCGCGCGG - Intronic
919845475 1:201639660-201639682 CTATCCTCCCCTCCCACGTCTGG + Intronic
922463280 1:225828987-225829009 CCCCCGTCCCCTCCCGCATCTGG - Intronic
924269523 1:242318325-242318347 CTGGCCTCCCCTCCCGCAGGAGG - Intronic
1065024259 10:21526187-21526209 CGGGCCTCCCCTACCGCGCCGGG + Intergenic
1069583140 10:69578605-69578627 GTGGCCTCCCCTCCCCCGCCGGG - Intergenic
1081843394 11:46219991-46220013 CAGGCGCCCGCTACCGCGTCTGG - Intergenic
1083227543 11:61294530-61294552 CTGGCCTCCCCTGCCGCGCGGGG - Intronic
1090406033 11:126476239-126476261 CTGGGGTCCCCTCCAGAGACTGG - Intronic
1094512114 12:31103120-31103142 CTGGCGTCTCCTGCCCCCTCCGG + Intronic
1098595953 12:72273103-72273125 CTGGCCACCCCACCCGCCTCGGG - Exonic
1099637380 12:85230904-85230926 CAGGCGCCCCCTACCGCGCCCGG - Intronic
1113594092 13:111519275-111519297 CTGGCTTCTCCTCCTGCATCTGG + Intergenic
1120941476 14:89954512-89954534 CTCGCTTCCTCTCCCGTGTCTGG - Intronic
1121118107 14:91357809-91357831 CTGGCGTCCCCGCCCTTCTCTGG + Intronic
1132590195 16:723246-723268 CAGGTGTCCCCTCCCGGCTCTGG - Intronic
1132683241 16:1152410-1152432 CTCCGGTCCCCTCCCGCGTGGGG - Intergenic
1133021588 16:2969303-2969325 CTGGCGTCCCCTCCCGCGTCCGG + Exonic
1136522419 16:30805669-30805691 CTGGCGTCCGGGCCGGCGTCCGG + Intergenic
1138385895 16:56635534-56635556 CTGGCGCCCCTTCGCGCGTGAGG - Intergenic
1138586321 16:57972600-57972622 CTGGCTTCCCCTCCAGTGTTGGG + Intergenic
1141620871 16:85235954-85235976 CCGGCGCCCCCTCCGGCGCCGGG + Intergenic
1141957791 16:87383939-87383961 CTGCCCTCCCCTCCAGCGTGAGG + Intronic
1142186359 16:88696644-88696666 GTGCCGTCCCCTCCCGCAGCGGG + Exonic
1142188464 16:88706107-88706129 CTCGCGACCCCTCCCGCGGCGGG + Intronic
1142627928 17:1203874-1203896 CTGGTTTCTCCTCCCGCGTCAGG - Intronic
1151558470 17:74859013-74859035 CTGGCTTCCCCTCCTGGGTGGGG + Intronic
1151954930 17:77375411-77375433 CTGGCCTCCCCTCCCGCCACAGG - Intronic
1152025417 17:77805736-77805758 CTGGCGTCCCCTCCCCCATCTGG - Intergenic
1152025425 17:77805755-77805777 CTGACATCCCCTCCCCCATCTGG - Intergenic
1152736752 17:82000992-82001014 CTGCCTGCCCCTCCCGCCTCGGG + Intronic
1152815248 17:82404121-82404143 CGAGCGTCCCCTCCCGCCTGGGG - Intronic
1152924200 17:83080025-83080047 CTCGCGTCCCCTCCCGTCCCGGG + Intronic
1156149085 18:34222738-34222760 CTGGCCTCCCTCCCCGCCTCGGG - Intronic
1160357280 18:78239036-78239058 TTCGCGTCCACTCCTGCGTCAGG - Intergenic
1161535575 19:4816928-4816950 CTGGCGACCCCTGTCGCGTGAGG + Exonic
1161856955 19:6771597-6771619 CAGGCGTCCGCCACCGCGTCTGG - Intergenic
1162893094 19:13748028-13748050 CCGGCGCGCCCTTCCGCGTCGGG + Intronic
1163154449 19:15432433-15432455 CCCGCGTCCGCTCCCGCGCCCGG - Intronic
1168013632 19:53554469-53554491 CGGGAGGCCCCTCCCGAGTCCGG + Intronic
1168059577 19:53883387-53883409 CTGGGGGCCCCTCCCTCGGCCGG + Intronic
1168328762 19:55553842-55553864 CTGGCCTCCCCTCTCGCCTCTGG + Intergenic
1168404325 19:56102988-56103010 CTGGCCTCCCCTCCCGCCCTGGG - Intronic
926308551 2:11657902-11657924 CTGGCGTCCCCTCCTGCCTCTGG - Intergenic
927794258 2:26034324-26034346 ATGGCCTCCCCTCCCCCCTCAGG - Exonic
927961322 2:27242213-27242235 CTGGGGTCCCCTCACTCATCTGG - Intronic
937956364 2:127423633-127423655 CTGGCGTCCCCGCCTTCCTCCGG + Intronic
947793093 2:232878861-232878883 CTGGGGACCCCTCCCGCCTCTGG - Exonic
1171308496 20:24126333-24126355 CTGGCCTCCTCTCCCTCCTCAGG + Intergenic
1173494432 20:43508372-43508394 CTTCCGTCCCCTCCCGAGTCCGG + Intronic
1182122899 22:27798535-27798557 CTGGCGCCCCCTCCTCCGCCTGG - Exonic
950306093 3:11916059-11916081 CTGTGGTCCCCTCCCGCCTCAGG + Intergenic
950509835 3:13419703-13419725 CCGGCGCCCCCTCCCGGGTCAGG + Intronic
954265658 3:49469118-49469140 CTGGCTTTCCCTCCCTCCTCAGG - Intronic
955752263 3:62195177-62195199 CTGGCTTCCCCTCCTGTGGCCGG + Intronic
955911505 3:63863686-63863708 CTGGCCTCCCGGCCCGCTTCCGG - Intronic
963168029 3:142225120-142225142 TTCGCGTTCCCTCCCTCGTCTGG - Intronic
968081775 3:195851353-195851375 CTGGCGGCACCTGCCGCGTGTGG + Intergenic
969484966 4:7467107-7467129 CTGGCGTCCCCCCAGGCGTTTGG + Intronic
985672726 5:1214524-1214546 CTGGAGTCCCCAGCAGCGTCTGG + Intronic
989983258 5:50667334-50667356 CTGGCGCCCCCTCCCCCTTTTGG - Intronic
1000506656 5:162128402-162128424 CTGGCATCCCTTCCCTTGTCTGG + Intronic
1002888036 6:1312855-1312877 CTGGCGCCGCCGCCCGCGGCCGG - Exonic
1014697239 6:124638746-124638768 CAGGCGTCCACTACCACGTCTGG - Intronic
1014913804 6:127120896-127120918 CAGGCCTCCCCTTCCGCGTCCGG - Intronic
1024246882 7:47477399-47477421 CTGGCGGCCCCTCCCACACCTGG - Intronic
1026605243 7:71810300-71810322 CTGCCATCCCCTCCCCGGTCCGG - Intronic
1026929567 7:74216291-74216313 CTCGCCTCCCCTCCCTCGTCTGG - Intronic
1033757033 7:144403970-144403992 CAGGCGGCCCCTCCCGTGGCGGG + Intronic
1043294474 8:78646276-78646298 ATGGCTTTCCCTCCCGAGTCAGG + Intergenic
1048924762 8:139261615-139261637 CTGTCGTCCCTTCCAGCCTCTGG + Intergenic
1054835505 9:69672041-69672063 CAGGCAGCCCCTCTCGCGTCCGG + Intronic
1059329041 9:113523654-113523676 CTGGCTTCCCCTCCCACGAGTGG - Intronic
1062570898 9:137184873-137184895 CTGGGGTCCGCTCTCCCGTCTGG - Intronic
1188811336 X:34657053-34657075 CTGGCGTCCTCGCCTGCGGCGGG - Exonic
1189229561 X:39441765-39441787 CTGGTGTCCCCTTCTGCATCAGG + Intergenic
1194616122 X:96105693-96105715 CAGGCATCACCTACCGCGTCTGG - Intergenic
1195202523 X:102564687-102564709 CTGCCTTCCACTCCCGCCTCAGG - Intergenic
1200058824 X:153475002-153475024 CGGGCGCCCCCTCCCCCGGCCGG - Intronic
1200240638 X:154491285-154491307 CAGGCGTCCGCCCCCGCGCCCGG + Intergenic