ID: 1133022831

View in Genome Browser
Species Human (GRCh38)
Location 16:2974376-2974398
Sequence TTCTGTCCTTGTCATGATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133022831_1133022840 23 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022840 16:2974422-2974444 CCATGAGGAAGGGCCACATCGGG 0: 1
1: 1
2: 0
3: 24
4: 241
1133022831_1133022833 8 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022833 16:2974407-2974429 GGAAGACAGACCTGCCCATGAGG 0: 1
1: 0
2: 1
3: 18
4: 200
1133022831_1133022841 24 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022841 16:2974423-2974445 CATGAGGAAGGGCCACATCGGGG 0: 1
1: 1
2: 1
3: 15
4: 125
1133022831_1133022835 13 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022835 16:2974412-2974434 ACAGACCTGCCCATGAGGAAGGG 0: 1
1: 0
2: 2
3: 16
4: 202
1133022831_1133022838 22 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022838 16:2974421-2974443 CCCATGAGGAAGGGCCACATCGG 0: 1
1: 1
2: 1
3: 18
4: 201
1133022831_1133022834 12 Left 1133022831 16:2974376-2974398 CCAGCATCATGACAAGGACAGAA 0: 1
1: 0
2: 1
3: 18
4: 220
Right 1133022834 16:2974411-2974433 GACAGACCTGCCCATGAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133022831 Original CRISPR TTCTGTCCTTGTCATGATGC TGG (reversed) Exonic
901769661 1:11523912-11523934 TGCTGTCCTTGACATGGCGCTGG + Intronic
902023702 1:13367058-13367080 TTCTCTCCTTATCAAGAAGCAGG - Intergenic
905281611 1:36852903-36852925 TTCTGTCAATGTCAGGCTGCTGG - Intronic
905293904 1:36942221-36942243 CTCTGTGCTGGTGATGATGCTGG + Intronic
906203205 1:43972861-43972883 GTCTGTCCTTGTCAAAAGGCAGG + Exonic
912386283 1:109272718-109272740 TTCTGTCCTCACCATGCTGCTGG - Exonic
914439469 1:147691157-147691179 TTCTATCCTTCTCATTATGGGGG - Intergenic
915282291 1:154830765-154830787 TGGTGTCCTGGTCATCATGCTGG - Intronic
916284743 1:163093866-163093888 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
916592558 1:166206472-166206494 TTCTGTCCTAGTCAGGAAGTGGG + Intergenic
918563951 1:185903931-185903953 GTCTCCCCTTGTCCTGATGCTGG - Intronic
918577973 1:186086974-186086996 TACTGTCCATGTTTTGATGCTGG + Intronic
923261171 1:232269389-232269411 TACTGTCCTGGAGATGATGCTGG + Intergenic
1064742034 10:18443662-18443684 TTCTGTCCTTATCCAGGTGCAGG + Intronic
1065371536 10:24991774-24991796 CTCTGTCCTTGTCATAAGGCAGG + Intronic
1066441584 10:35444586-35444608 TCCTGTGTTTGTGATGATGCTGG - Intronic
1069219235 10:65862789-65862811 TTATGTCCTTACCAGGATGCAGG - Intergenic
1070556410 10:77531371-77531393 TTCTGTCCATTTCAGTATGCTGG - Intronic
1070578803 10:77703096-77703118 CTCTGTCCTTCTCCTGGTGCTGG - Intergenic
1072304109 10:94090454-94090476 TTGTGTCCGTGTCCTGACGCAGG + Intronic
1073616349 10:105000127-105000149 TTCTGTCCTTGTCTTTTTGTTGG - Intronic
1073928848 10:108550306-108550328 TTCTGTTATTATCATTATGCAGG + Intergenic
1074005360 10:109417296-109417318 TTCTGGTCTTGTTTTGATGCTGG - Intergenic
1076033893 10:127182783-127182805 CTCTGTCACTGTCATGATGATGG - Intronic
1076587464 10:131559440-131559462 TCCAGTCTTTGTCAGGATGCCGG + Intergenic
1076933161 10:133547488-133547510 ATTTGTTCCTGTCATGATGCTGG - Intronic
1078113903 11:8426044-8426066 CTCTGTCCTTGTGATGAGGCAGG - Intronic
1081706396 11:45184293-45184315 TTCTGTCCTTTTAATAATGTAGG + Intronic
1084242646 11:67833088-67833110 TTCTGTCCTTGCAATAAGGCGGG - Intergenic
1086676400 11:89612405-89612427 TTATGTCCTGGTCCTGGTGCTGG + Intergenic
1087816497 11:102664374-102664396 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1088498172 11:110453752-110453774 TTCTGTCCTTGCCATGGTCAGGG - Intronic
1091235126 11:134016778-134016800 TTATGTCCCTGGCAGGATGCAGG + Intergenic
1091991798 12:4961464-4961486 TTCTGTCCCTGCCATTCTGCTGG - Intergenic
1093654378 12:21677684-21677706 TTCTGTCCTTGAGATAAGGCAGG + Intronic
1093713351 12:22353237-22353259 ATCTGTCCTTCTCATAATGCAGG - Intronic
1101208963 12:102517260-102517282 TGCTGCCCTTGTCATATTGCTGG + Intergenic
1101287408 12:103329226-103329248 TTTTATCCTTTTCATCATGCAGG + Intronic
1104076899 12:125397983-125398005 TTCTGTCCTTGTCACTATGTGGG - Intronic
1105444374 13:20439980-20440002 TTCTGCCCTTCCCATGAAGCAGG + Intronic
1105673401 13:22644373-22644395 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1105724424 13:23147646-23147668 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1106542182 13:30699902-30699924 TTGTTTCCATGTCATGATGAAGG + Intergenic
1106949453 13:34866878-34866900 TTCTGACCTTCCCATGAAGCAGG + Intergenic
1107380051 13:39847204-39847226 TTCTGGCCCTGTCATGGTACTGG + Intergenic
1109083413 13:57937862-57937884 TTCTATCATTGTCATTATACTGG + Intergenic
1110565678 13:76955429-76955451 TTCTGGCCTTGACCTGCTGCTGG + Exonic
1111198027 13:84898703-84898725 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1113397399 13:109961341-109961363 CTCTGTCCATCTCCTGATGCTGG + Intergenic
1115032664 14:28815401-28815423 TTCTGTCCTTATCATAATCCTGG + Intergenic
1118632153 14:67715410-67715432 ATCTGTCCTTGTCCTGATGTTGG + Intronic
1119815440 14:77562489-77562511 TTCTGTTCCTGTGATGTTGCAGG - Exonic
1120731324 14:88005147-88005169 TTCTCTTCTTGACTTGATGCAGG + Exonic
1120821038 14:88912151-88912173 TTATGTCCATTTCATAATGCGGG + Intergenic
1123217675 14:106827005-106827027 TTCTTTCCTTCTCATGACTCAGG - Intergenic
1125347728 15:38735510-38735532 TTATGTCTTTGTGGTGATGCTGG + Intergenic
1127378336 15:58405744-58405766 ACCTGTCCCTGTCATGATTCAGG - Intronic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1135660945 16:24296106-24296128 TTCTGACCTTGTCATCCTGGGGG - Intronic
1136413449 16:30090428-30090450 CCCTGTCCTTGTCTGGATGCTGG + Intronic
1139384155 16:66553400-66553422 TTCTCTCCTTGTCCTGGTTCTGG - Intronic
1139654075 16:68376903-68376925 TTCTGTCCTTATGATCATCCTGG - Intronic
1141279527 16:82618449-82618471 TTAAGTGCTTGTCATGAAGCAGG + Intergenic
1141707699 16:85677213-85677235 TTCTATCCATTGCATGATGCTGG + Exonic
1143290226 17:5822655-5822677 CTCTGTCCTTGTGATAAAGCAGG - Intronic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1148223271 17:45880188-45880210 TCCTGTGTTTGTGATGATGCCGG - Intergenic
1149932412 17:60769457-60769479 TTCTCTCCTTGGCCTGGTGCTGG + Intronic
1151433214 17:74078993-74079015 TTCTGTTCTTGCCAGGCTGCTGG - Intergenic
1152133177 17:78489536-78489558 TTCTGTCCTTGGCTTGACTCTGG + Intronic
1153089862 18:1331191-1331213 CTCTGTCCTTTCCATGATGGAGG - Intergenic
1153722998 18:7926170-7926192 TACTGTTCTTTTCATGTTGCTGG + Intronic
1156326013 18:36076054-36076076 TCATGTGCTTGTTATGATGCTGG + Intergenic
1157722252 18:49934326-49934348 TACTGACCATGTCATGATACCGG - Intronic
1159069303 18:63605562-63605584 TACTGTTCTTCTCATGGTGCAGG + Intergenic
1159487737 18:69086720-69086742 TCCTGTCCTTGTTTTGATACTGG - Intergenic
1159725336 18:71951040-71951062 GTCTGTCCTGGTTGTGATGCAGG - Intergenic
1161139181 19:2637790-2637812 ATCTGTAATTGTCATGATGGAGG - Intronic
1161548168 19:4895040-4895062 TTCTGTCCTGGTCCTGAAGGAGG + Intronic
1162637827 19:11984341-11984363 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1168710996 19:58499779-58499801 GTCTGTCCTTGGCAGGGTGCTGG - Intronic
925141527 2:1553117-1553139 TTCAGTCTTTGTGATGGTGCAGG + Intergenic
927196310 2:20549834-20549856 TTCTCTGCTTCTCATGGTGCGGG - Intergenic
927532222 2:23817452-23817474 TGCTGTCCTTTTCATTATGAAGG - Intronic
927584036 2:24282511-24282533 TTCTGTCCTTGTGATAAGGAAGG + Intronic
927975790 2:27337138-27337160 TCCTGTCCTTCCCCTGATGCTGG - Intronic
928819360 2:35342320-35342342 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
930409175 2:51001874-51001896 TTCTGACCTTCTCCTGAAGCAGG + Intronic
931772459 2:65509934-65509956 TTCTTTCCTTGTTCTGATGTTGG + Intergenic
932068182 2:68589114-68589136 TTCTGTCCCTCTCATGCTGTAGG - Intronic
932791689 2:74659054-74659076 TTAAGTCCTTTTCATAATGCAGG + Intronic
932816795 2:74868219-74868241 TGCTTTCCTTGTTATCATGCTGG + Intronic
932922414 2:75931785-75931807 TTCTATCCTTTTCGTGTTGCCGG + Intergenic
933187149 2:79290874-79290896 CTCTGTCCTTGTGATAAGGCAGG + Intronic
933315242 2:80706947-80706969 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
933466486 2:82658325-82658347 TTCCGTCCTTGTGATAAGGCTGG + Intergenic
933708418 2:85308202-85308224 TTCTGTGCTAGGCATGATTCTGG - Intronic
934957087 2:98631807-98631829 TTCTGTCCTTGTGATAAGGCAGG + Intronic
936833810 2:116682321-116682343 TTATGTGCTTGTATTGATGCTGG + Intergenic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
940599913 2:155845630-155845652 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
941304166 2:163840871-163840893 CGCTGTCCTTCTCATGATCCAGG - Intergenic
942095527 2:172533845-172533867 AACTGTCTTTGTCATGATGGTGG - Intergenic
942204673 2:173608409-173608431 TTCTCTCCTTGGCATAAGGCAGG + Intergenic
944045682 2:195408812-195408834 TTCTTTTCTTGTCTTTATGCTGG - Intergenic
948303075 2:236923028-236923050 TTCTATCATTGTCATGATGTTGG + Intergenic
1169399871 20:5270753-5270775 TTCTGTCCTTGGAATAAAGCAGG + Intergenic
1171203513 20:23260640-23260662 TTCTCTCCATCTCAGGATGCAGG - Intergenic
1171531729 20:25857676-25857698 CTCTGCCTTTGTCATGAGGCCGG - Intronic
1172448080 20:35003424-35003446 TGCTGTCCTTGTCCTTGTGCAGG + Exonic
1173824868 20:46041675-46041697 TTCTGTCCTTGGCATCAGGGAGG + Intronic
1176105123 20:63382277-63382299 TTCTGTCCTTATCAAGATGGGGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177610309 21:23437915-23437937 TTCTGTAATTATCATGATGTTGG - Intergenic
1178913219 21:36693029-36693051 GTCTGTCCTGGCCCTGATGCGGG - Intergenic
1180780872 22:18518724-18518746 TTCTGTCCATGTGATGAGGTGGG + Intergenic
1181040630 22:20190924-20190946 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1181043977 22:20205934-20205956 CTCTGTCCTTGTTATAAGGCAGG - Intergenic
1183686206 22:39362670-39362692 TCCTGCCCTTGTCCTGGTGCAGG - Intronic
1183781373 22:40001182-40001204 TTCTGTTTTTGACATGAAGCTGG - Intronic
1184536281 22:45089334-45089356 TTCTGTCACTGTCATATTGCAGG + Intergenic
951470683 3:23052799-23052821 TTATGCCCTTGTCAGGGTGCAGG - Intergenic
951545962 3:23825636-23825658 TTGGGTCCTTGTCATCATTCAGG - Intronic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
956194136 3:66635220-66635242 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
956778639 3:72587293-72587315 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
957878103 3:86175200-86175222 TTCTGTCCTTGTCCTGCTGAAGG + Intergenic
959583458 3:108004590-108004612 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
959884641 3:111485353-111485375 CTCTGTCCTTGTTAGAATGCAGG - Intronic
960376090 3:116903324-116903346 TGCTCTGCTTGTCTTGATGCAGG + Intronic
960515208 3:118595637-118595659 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
962030233 3:131591769-131591791 TTCTCTCCCTGGCATGAAGCTGG + Intronic
964308005 3:155361557-155361579 TTCTGTCCTTGCGATAAGGCAGG - Intergenic
964672259 3:159239538-159239560 TTCTTTTCTAATCATGATGCAGG + Intronic
964779396 3:160318865-160318887 TTCTGACCTTTTCCTGAAGCAGG + Intronic
966008491 3:175047205-175047227 TTCTGTCCTTGTCATATAACTGG + Intronic
966285571 3:178291421-178291443 TTTTGGCCTTGCCATGCTGCTGG + Intergenic
968948666 4:3679026-3679048 TTCTGTCCCTGGCCTGGTGCTGG + Intergenic
969730371 4:8952727-8952749 TTCTGTTCTTGAAATCATGCTGG + Intergenic
970749636 4:19342138-19342160 TACTGTCCTTGTGATAATGAGGG + Intergenic
970954435 4:21794006-21794028 TTCTGTCCTTGTGAGAATGATGG - Intronic
971965218 4:33545615-33545637 TTCTGTATTTGTGGTGATGCTGG + Intergenic
972794788 4:42404692-42404714 ATTTGTCTTTGTCATGATGCTGG - Intergenic
973057425 4:45678679-45678701 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974250076 4:59374768-59374790 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974250615 4:59378552-59378574 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974752084 4:66154465-66154487 TTCTGTCCTTGTGATAAAGATGG + Intergenic
976762751 4:88568345-88568367 TTCTGTCCTTCTCTTCATGGTGG + Intronic
977892229 4:102325901-102325923 TTCTGTCTTTGTCATAGTGATGG + Intronic
979210672 4:118097885-118097907 TTCTGTTCTTGACATCACGCTGG + Intronic
980485466 4:133451268-133451290 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
980970170 4:139560034-139560056 TTTTATCCTTGTCATCCTGCTGG - Intronic
983094333 4:163543847-163543869 TTCTTTCCTTCTCATGTAGCTGG + Intronic
984871465 4:184329225-184329247 TTCTGACCTTCTCCTGAAGCAGG + Intergenic
985810384 5:2079093-2079115 TGCTGTCCTTGTGATAATGGGGG + Intergenic
985888848 5:2700356-2700378 GTCTGTCCTTGTCCTCATGTGGG - Intergenic
986365304 5:7022908-7022930 CTCTGTCCTTGTGATAATGCAGG - Intergenic
986427154 5:7644997-7645019 TTCTGTCCTTGTTATGAGCATGG + Intronic
988526073 5:31988418-31988440 TTCTGTCCTTGTGGAGATGGGGG + Intronic
989098168 5:37800315-37800337 TTTTGTCTATGTCTTGATGCTGG + Intergenic
989751090 5:44894998-44895020 TTCTGGACTGGTCCTGATGCTGG + Intergenic
991437146 5:66608631-66608653 TTCTGTGTTTGTCTTGATGCTGG + Intronic
991524125 5:67537488-67537510 ATCTGCCACTGTCATGATGCTGG - Intergenic
991548904 5:67815081-67815103 TTCTTTCATTTTCATGAAGCTGG - Intergenic
993365323 5:87028480-87028502 ATTTGTGCCTGTCATGATGCTGG + Intergenic
993996316 5:94727815-94727837 TTCAGACCTTGGCATAATGCAGG + Intronic
994301897 5:98157342-98157364 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
995111665 5:108435849-108435871 TTCTGACCTTTTCCTGAAGCAGG - Intergenic
995191500 5:109323060-109323082 TCCTGACCCTGTCCTGATGCAGG + Intergenic
995278713 5:110308250-110308272 TGCTGTCCTTGTGATGGTGTGGG + Intronic
996932627 5:128908566-128908588 TTCTGTCTTTCTGATGATTCAGG + Intronic
997358605 5:133280255-133280277 TCCTGTCCATGTAATGAGGCTGG - Intronic
999007272 5:147996675-147996697 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
999163782 5:149530064-149530086 TTTTGTCCTGGTCATGGTGATGG - Intronic
1003622092 6:7709303-7709325 TTCTGTCCAAGTCAAGGTGCTGG + Intergenic
1003637750 6:7848842-7848864 TTGTGTCCTTGTGATGATGCAGG + Intronic
1004428636 6:15523756-15523778 TTCTGGCCTTCTCAGGATGAGGG + Intronic
1004702792 6:18094849-18094871 ATCTCTCCTTGACATGATTCAGG + Intergenic
1005137281 6:22584092-22584114 TTCTGTCCTAGTCATCCTCCTGG + Intergenic
1007307598 6:40919042-40919064 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1007741836 6:44015615-44015637 TTATGTCTTTGTAGTGATGCTGG + Intergenic
1008584273 6:52934821-52934843 TTCTGTCCTTACCATGGTGAGGG + Intergenic
1008714755 6:54275024-54275046 TTCTATGCTTGTCAGGGTGCAGG - Intergenic
1010899519 6:81408829-81408851 GTCTTTCCTTTTCATGTTGCTGG - Intergenic
1013792584 6:113854670-113854692 TTCCTTCCCTGTCATTATGCAGG + Intergenic
1014247222 6:119081549-119081571 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1014717991 6:124887925-124887947 TTCTGTCCTTGTGATAAGGAGGG + Intergenic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1016158069 6:140838778-140838800 TTCTGTCCTGTTAATTATGCTGG + Intergenic
1024581290 7:50802975-50802997 ATCTGCCCTTGTCATCATACAGG - Intergenic
1024837597 7:53541212-53541234 TTGTGTCCTTATCATGCTTCAGG + Intergenic
1024901772 7:54326112-54326134 TTCTTTTCTTGTCATAATGGAGG - Intergenic
1033050454 7:137999874-137999896 TTCTGTCATTGTGATAAAGCAGG - Intronic
1033249940 7:139749842-139749864 TTCTGTCCTTGTGAAGATGTTGG - Intronic
1033330295 7:140411858-140411880 TCCTGTCCTTCTCCAGATGCAGG + Exonic
1034179704 7:149127221-149127243 TTCTGTCCTAGTCATGTTTTAGG + Intronic
1035824193 8:2627192-2627214 TTCTCCCCTTGTCATGTTACAGG - Intergenic
1037149511 8:15618803-15618825 TCCTGTGCTTGTGGTGATGCTGG - Intronic
1037482848 8:19321008-19321030 TTATTTCCTTGTCATGATAAAGG - Intronic
1037542577 8:19886532-19886554 TTCTGTACATCTCATGTTGCAGG - Intergenic
1037550458 8:19965925-19965947 TTGTAACTTTGTCATGATGCAGG - Exonic
1037808386 8:22071030-22071052 TTCTCACCTTGCCATGAAGCTGG - Intronic
1038248616 8:25882059-25882081 CTCTGTCCTTGTGATAAGGCAGG + Intronic
1039076221 8:33692884-33692906 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1039250854 8:35662548-35662570 TTCTGTCCCCATCATGATCCTGG - Intronic
1043967071 8:86490807-86490829 TACTGTCCTTAACATGATCCAGG + Intronic
1044085317 8:87936294-87936316 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1044533431 8:93333716-93333738 TTCTGTCTTTGACATGTGGCTGG + Intergenic
1046329053 8:112690458-112690480 TCGTGTCCTGGTCATGATTCAGG - Intronic
1047640884 8:126820745-126820767 TTCTGTCCTTGCAATAAGGCAGG - Intergenic
1048133759 8:131725711-131725733 CTCTCTCCTTGACATCATGCAGG - Intergenic
1049853326 8:144846124-144846146 TTCTGTCCTGATCATGAACCAGG - Intronic
1050162041 9:2729257-2729279 TTCTGTTCTTTTCATGACACAGG + Intronic
1050884509 9:10746965-10746987 TTTTGTCCATGTCATAATCCAGG - Intergenic
1051092309 9:13424352-13424374 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1051484516 9:17593537-17593559 TTGTGTCCTTGTAAGGATGTAGG - Intronic
1052566510 9:30160390-30160412 TTCTGTCCTTGTGATAAGGCAGG - Intergenic
1053538793 9:38952106-38952128 TTCTGACCTTCTCCTGAAGCAGG - Intergenic
1054627347 9:67411813-67411835 TTCTGACCTTCTCCTGAAGCAGG + Intergenic
1055503822 9:76928508-76928530 TTCTGTCCCTGAAAAGATGCTGG + Intergenic
1060698766 9:125732398-125732420 ATCTCCCCTGGTCATGATGCAGG + Intergenic
1061665164 9:132156428-132156450 TCCTCTCCCTGTCATGCTGCTGG + Intergenic
1061812128 9:133168230-133168252 TTATTTCATTGTCCTGATGCAGG - Intergenic
1062651855 9:137581882-137581904 CTCTGTCCTTGTCTTGCGGCAGG - Intergenic
1062652361 9:137584527-137584549 TTCTGTCCCTGCCATGGTGCGGG - Intronic
1185549056 X:969011-969033 TTCTGTGCTTGCCAAAATGCTGG + Intergenic
1191916498 X:66207087-66207109 TTCTGTCTGTGACATGAAGCTGG + Intronic
1192012470 X:67289629-67289651 TCCTATACTTGTCATGATGGAGG + Intergenic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1193416357 X:81229392-81229414 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1194221645 X:91200500-91200522 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1198167539 X:134072255-134072277 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1199571302 X:149269710-149269732 TTCCATCCTGGTCATGAGGCAGG + Intergenic
1200274192 X:154716398-154716420 TGCTGTCCTTGTCATGACATGGG - Intronic
1200558160 Y:4664256-4664278 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1201651893 Y:16297501-16297523 TCCTGTCATTATCATGCTGCTGG - Intergenic