ID: 1133023390

View in Genome Browser
Species Human (GRCh38)
Location 16:2976755-2976777
Sequence TCAGAGACTCTGCAGAGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 382}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133023390_1133023405 29 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023405 16:2976807-2976829 GCTGCAGCTGGTGCCAGCCTGGG 0: 1
1: 0
2: 5
3: 36
4: 405
1133023390_1133023404 28 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023404 16:2976806-2976828 GGCTGCAGCTGGTGCCAGCCTGG 0: 1
1: 0
2: 6
3: 58
4: 477
1133023390_1133023400 17 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023400 16:2976795-2976817 ACACCCGCCGGGGCTGCAGCTGG 0: 1
1: 0
2: 0
3: 19
4: 261
1133023390_1133023397 7 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023397 16:2976785-2976807 CCCCGGAATGACACCCGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1133023390_1133023394 5 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 17
1133023390_1133023395 6 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023395 16:2976784-2976806 GCCCCGGAATGACACCCGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 79
1133023390_1133023406 30 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023406 16:2976808-2976830 CTGCAGCTGGTGCCAGCCTGGGG 0: 1
1: 2
2: 2
3: 37
4: 393
1133023390_1133023392 -10 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023392 16:2976768-2976790 GAGTCTCTGAGGCCTCGCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133023390 Original CRISPR TCAGAGACTCTGCAGAGCCC TGG (reversed) Exonic
900137536 1:1124722-1124744 ACAGAGACTCTGCAAGGCCAAGG - Intergenic
900801042 1:4737286-4737308 CCAGGGACTCGGCAGAGCCAGGG - Intronic
901238304 1:7679225-7679247 TCAGGAACTCTCCAGAGCTCTGG + Intronic
901391231 1:8947624-8947646 TCAGAGGCTGGGCAGAGCCTGGG - Intronic
901490114 1:9592421-9592443 CCAGAGTCTCTGCCCAGCCCTGG - Intronic
901793532 1:11667249-11667271 TGAGTGACAGTGCAGAGCCCTGG + Intronic
901881812 1:12198592-12198614 GCAGAGACCCAGCAGAGCCACGG - Intronic
902159788 1:14520605-14520627 GCAGAGGCTCTGAGGAGCCCAGG + Intergenic
902443720 1:16448248-16448270 GCAGAGACTCAGGAGAACCCAGG + Intronic
902836164 1:19048021-19048043 TCACAGTCTCTGCAAGGCCCTGG + Intergenic
902881294 1:19373442-19373464 TCAGAGCCTTTACAGAGCCAGGG + Intronic
903288079 1:22289526-22289548 TCAAAGACTTAGCAGAGCACAGG - Intergenic
903343566 1:22670390-22670412 TGAGAAACTCTGTTGAGCCCAGG + Intergenic
903574104 1:24327368-24327390 TCAGGGACTCTTCTGAGCACTGG - Intronic
905871486 1:41406931-41406953 CCAGATACTCCGCTGAGCCCAGG - Intergenic
906551174 1:46667852-46667874 TGGGAGTCTCTGCAAAGCCCTGG - Intronic
906674133 1:47681097-47681119 TAGGAGCCTCTGCAGAGCTCAGG + Intergenic
906923203 1:50086881-50086903 TCGGGGACTCTGCAGATCCAAGG + Intronic
909093546 1:71257573-71257595 TTAGAGAATCTTCAGAGCACAGG + Intergenic
909515300 1:76500731-76500753 TCAGAGACTTTGCAAAGACCTGG + Intronic
909954478 1:81762290-81762312 TCACAGATGCTGCAAAGCCCCGG - Intronic
911125858 1:94340238-94340260 CCAGACACTCTCCAGTGCCCTGG - Intergenic
912662101 1:111541041-111541063 ACAGAGACTATGCAGAGTCTAGG - Intronic
912668521 1:111604818-111604840 TCAGAGAGTCAGCAGACCCCAGG - Intronic
914393412 1:147242335-147242357 TCAGACACTCCGCTGGGCCCTGG - Intronic
914510179 1:148325219-148325241 GCAGAGACGCTGCACAGCGCAGG + Intergenic
915003311 1:152613427-152613449 TCTGTGACTCACCAGAGCCCTGG + Intergenic
915290020 1:154877306-154877328 TCTAAAACTCTGCAGAGGCCAGG + Intergenic
915517387 1:156421304-156421326 TCCCAGGCCCTGCAGAGCCCCGG + Intronic
916169983 1:161994553-161994575 TCTGGGAATCTGCAGAGCCTTGG + Intronic
917033263 1:170718708-170718730 ACACAGGCTCTGCAGAGCTCAGG + Intronic
917138588 1:171811829-171811851 TAAGAGGCCCTGCAGAGCTCTGG - Intronic
917229258 1:172818453-172818475 TCCGAGTCACTGCAGAGCTCTGG - Intergenic
917917962 1:179723263-179723285 TGAGAGAAGCAGCAGAGCCCAGG + Intergenic
918197095 1:182232884-182232906 TCAGACCCTTAGCAGAGCCCTGG - Intergenic
920439850 1:205972629-205972651 TCAGAGTCTCAGAGGAGCCCAGG - Intergenic
920695533 1:208179072-208179094 CCAGAGACTCTCCGTAGCCCAGG - Intronic
920820496 1:209375772-209375794 GCAGAAACTCTGCTGAGCTCTGG - Intergenic
921939986 1:220829390-220829412 CCAGGGAATCAGCAGAGCCCTGG + Intergenic
923101982 1:230824154-230824176 TCAGAGCCTTTGGAGAGCCTTGG + Intergenic
923799942 1:237199067-237199089 TCACACACTCTGCAGGACCCCGG - Intronic
1064416217 10:15152530-15152552 TCAGGGACTCATCAGACCCCAGG - Intronic
1065289471 10:24215273-24215295 TCCCAGCCTCTGCAGAGCCCAGG - Intronic
1065950041 10:30643343-30643365 TCAGAGACTCTCCCCAACCCTGG - Intergenic
1066975384 10:42363558-42363580 TGAGAGAAGCTACAGAGCCCAGG - Intergenic
1067131071 10:43565856-43565878 CCAGAGAATCTGCAGAGCAAAGG + Intronic
1067524454 10:47029662-47029684 AGACAGACTCTCCAGAGCCCTGG - Intergenic
1067542420 10:47165684-47165706 TCTGAATCTCTGCAGAGGCCGGG - Intergenic
1069687885 10:70330750-70330772 TCAGAGACCCTGCTGGGCCGTGG - Intronic
1071292439 10:84197376-84197398 TGTGAGCCTCTGCAGAGCCCTGG + Intronic
1072514054 10:96159993-96160015 TCAGTGACTGTTCAGAGTCCAGG + Exonic
1072985452 10:100135725-100135747 TCAGACAGTGTGCACAGCCCAGG + Intergenic
1073811871 10:107161257-107161279 TCAGAGACTCTTCATAGCAAAGG + Intronic
1074696502 10:116054284-116054306 TAGGGAACTCTGCAGAGCCCCGG + Intergenic
1074858227 10:117489235-117489257 ACAGAGATTCAGCAGAGGCCAGG - Intergenic
1074865464 10:117542258-117542280 CCAGGGACTCTGCAGGGACCGGG + Intergenic
1074978764 10:118602368-118602390 CCTGAGCCTCTCCAGAGCCCTGG - Intergenic
1075232323 10:120691100-120691122 ACAGAGCCTGAGCAGAGCCCAGG + Intergenic
1075310782 10:121411893-121411915 GCAGAGAGTCTGCAGTGCCTGGG - Intergenic
1075651957 10:124133090-124133112 TCAGTGACTCTGGAGAGATCTGG - Intergenic
1075879569 10:125839229-125839251 TCAGAAGCTCTGAAGAGCCCAGG + Intronic
1076839566 10:133039403-133039425 TTTGAGACTCTGCAGATCTCCGG + Intergenic
1077229415 11:1451883-1451905 GCAGAGACTCTACAGCGCCCAGG + Intronic
1077388531 11:2287788-2287810 TGAGGGTCTCTGCAGATCCCTGG - Intergenic
1077400248 11:2352100-2352122 TCAGGGACCCTCCAGAGCCCTGG + Intergenic
1077574991 11:3376160-3376182 AGAGAGAAGCTGCAGAGCCCGGG - Intronic
1078448351 11:11421747-11421769 GCAGAGTCTCTGCAGAGGTCAGG + Intronic
1078852761 11:15179451-15179473 TCAGCCTCTCTGCCGAGCCCAGG + Intronic
1080617949 11:33961223-33961245 TGAGAGACTGTGCATAGGCCAGG - Intergenic
1083186840 11:61022535-61022557 TCAGAGACTGTGGGGGGCCCTGG - Intergenic
1083253107 11:61481195-61481217 TCAGAGCCTCTGCAGAGGAAAGG + Exonic
1083772467 11:64875997-64876019 CCAGTTGCTCTGCAGAGCCCAGG + Intronic
1084279035 11:68074360-68074382 TCAGAGACTGAGCAGGGCCAAGG + Intronic
1084408928 11:68994838-68994860 TCAGAGACCGTGGAGACCCCTGG + Intergenic
1084515338 11:69634897-69634919 CCAGAGACAGGGCAGAGCCCTGG + Intergenic
1088713059 11:112525476-112525498 TCACAGAATCAGCAGAGCCTGGG + Intergenic
1088928643 11:114327194-114327216 GCAGAGGCACTGCAGAGCCTTGG + Intergenic
1089125937 11:116176631-116176653 TCAGAGTCTCTGCAGAACACAGG + Intergenic
1089208709 11:116786430-116786452 TCAGAGACTCTTCAGACACATGG + Intronic
1089556548 11:119318502-119318524 CCAGAGGCTGTGCAGAGCCCAGG + Intronic
1090077199 11:123586994-123587016 TCAGCGATTCTGCAGGGCACTGG - Intronic
1090666248 11:128916775-128916797 ACACAGACACTGCAGAGCCTGGG + Exonic
1091328851 11:134714490-134714512 TCAGAGCCCAGGCAGAGCCCTGG - Intergenic
1091774575 12:3176008-3176030 TCAGAGGGTCTGAAGAGCCACGG + Intronic
1091797068 12:3303614-3303636 TCAGACGCTCTACAAAGCCCTGG - Intergenic
1092088937 12:5788103-5788125 ACAGAGACTCAGCAGAGCACAGG - Intronic
1092299064 12:7227997-7228019 TTAGAGAATCTCCTGAGCCCAGG - Intergenic
1094168232 12:27464411-27464433 CCAGAGACTCAGAAGAGGCCGGG + Intergenic
1094494849 12:30982838-30982860 CCAGAGTCTCTACAAAGCCCTGG + Intronic
1095476117 12:42589226-42589248 GGAGAGCCTCTGCGGAGCCCTGG + Intronic
1095975692 12:47939536-47939558 CCAGGGAGTGTGCAGAGCCCTGG - Intronic
1096221231 12:49829113-49829135 TCTGAGGCTCTGCAGGGGCCTGG - Intergenic
1097310928 12:58118155-58118177 TCAGATACTCTGCTGAGCTTAGG - Intergenic
1098505978 12:71251202-71251224 TCAGAGACCCTGCCTTGCCCTGG + Intronic
1101292737 12:103388210-103388232 GAAGAGACTCTCCAGAGGCCAGG - Intronic
1101811571 12:108112320-108112342 TCAGACACTGTGCAGGGCTCTGG - Intergenic
1102063405 12:109952460-109952482 TCACAGGCAGTGCAGAGCCCAGG - Intronic
1102399290 12:112614593-112614615 TGAGAGAATCTCCTGAGCCCGGG + Intronic
1102553484 12:113710288-113710310 TCAGAGCCTCAGGAGAGTCCAGG - Intergenic
1103930218 12:124446165-124446187 TCAGGAAATCTGCAGTGCCCAGG - Intronic
1104502968 12:129303613-129303635 ACGGAGGCTCTGCAGAGTCCCGG - Intronic
1105951107 13:25230141-25230163 TCAGAGAGCCTGCAGCACCCTGG + Intergenic
1107791277 13:44004803-44004825 TCAGAGACTTTCCTGATCCCTGG + Intergenic
1107987985 13:45792259-45792281 TAAGAGACTCATCAAAGCCCAGG + Intronic
1108456267 13:50617149-50617171 TCCGTGCCTCTGCAGAGCTCAGG + Intronic
1111559265 13:89923776-89923798 TCAGAGACTCCGCAGGGTCTCGG + Intergenic
1112074827 13:95900754-95900776 TCAGTGACACTGCAGTGCACTGG - Intronic
1113675432 13:112203466-112203488 TCAGAGCAGCTGCACAGCCCTGG - Intergenic
1113730445 13:112637537-112637559 TCAGAGATTTTGCAAAGCCAGGG + Intergenic
1113968136 13:114166379-114166401 TGTGGGACCCTGCAGAGCCCAGG + Intergenic
1114625043 14:24123437-24123459 TCTGAGCCTCAGCTGAGCCCTGG + Exonic
1115521903 14:34241429-34241451 ACAGAGAAGCTTCAGAGCCCAGG - Intronic
1117457655 14:55913922-55913944 TCAGAGACTCAGGAGACTCCTGG - Intergenic
1117470668 14:56041188-56041210 TCAAAGACTCTTCTGCGCCCTGG + Intergenic
1117993155 14:61454565-61454587 TCAGAGGCTCTGCACAGCCCTGG + Intronic
1118376790 14:65184466-65184488 TTGGAGAATCTTCAGAGCCCTGG - Intergenic
1118769104 14:68929736-68929758 TCAGAGACTCTGCAGGGCCGGGG - Intronic
1119725611 14:76920319-76920341 TCAGAGCCTCGGAAGAGACCCGG - Intergenic
1120369046 14:83608092-83608114 ACAGAGAATCTGCACAGCTCTGG + Intergenic
1121015386 14:90545839-90545861 TAAGAGCCTCTGCAGTGCTCTGG + Intronic
1122038530 14:98965393-98965415 TAAGAGACAGTGCAGTGCCCTGG - Intergenic
1122055268 14:99093803-99093825 ACAGGGACACTGCAGGGCCCGGG + Intergenic
1122155548 14:99748125-99748147 TGACAGACCCTGCAGGGCCCCGG - Intronic
1122283259 14:100636676-100636698 TCAGAGACTGCACAGGGCCCTGG + Intergenic
1122356514 14:101126064-101126086 TCCGAGACGCTGCAGACACCTGG - Intergenic
1122497251 14:102166901-102166923 TCAGAGGCTGTACAGTGCCCAGG - Intronic
1122782706 14:104150331-104150353 TCAGAGGCTCTGCAGGCCCTGGG + Intronic
1123116578 14:105897322-105897344 ACAGACACTCTGAAAAGCCCTGG - Intergenic
1123118632 14:105906573-105906595 ACAGACACTCTGAAAAGCCCTGG - Intergenic
1123403571 15:20007772-20007794 ACAGACACTCTGAAAAGCCCTGG - Intergenic
1123512907 15:21014417-21014439 ACAGACACTCTGAAAAGCCCTGG - Intergenic
1124126182 15:26939707-26939729 TCAAAGGCTCTTCAGAGACCAGG + Intronic
1126341112 15:47641998-47642020 GCAGATACTGTGCTGAGCCCTGG - Intronic
1126602705 15:50444848-50444870 TGAGAGAATCAGCTGAGCCCAGG - Intronic
1127968015 15:63938396-63938418 TCAGAGACCCCACAGATCCCAGG - Intronic
1129166590 15:73781790-73781812 TCAGAAAATCTCCAGAGGCCAGG + Intergenic
1129244480 15:74271258-74271280 TCAGAGACCCCTCACAGCCCTGG + Intronic
1130062159 15:80577881-80577903 TCTGAGGCTCTGGGGAGCCCTGG + Intronic
1132500772 16:283676-283698 CCACAGACTCTGCAGAGGCTCGG + Intronic
1133023390 16:2976755-2976777 TCAGAGACTCTGCAGAGCCCTGG - Exonic
1134327957 16:13224314-13224336 TCTGAGAATTTGCAGAGACCTGG - Intronic
1135023761 16:18983876-18983898 GCAGAGGGGCTGCAGAGCCCGGG - Intergenic
1136071564 16:27790777-27790799 GCAGAGACTGTGCAGAGGCCAGG - Exonic
1136604583 16:31324761-31324783 TCAGAGACTCTTCACAGCCTTGG + Exonic
1138370930 16:56525805-56525827 TCAGAGACCCATCAGAACCCTGG + Intergenic
1138416833 16:56876472-56876494 GCAGGGGCCCTGCAGAGCCCTGG + Intronic
1138939175 16:61769216-61769238 TCAAAGACTCTAAAGATCCCTGG + Intronic
1139517619 16:67461015-67461037 TCAGTGTCTGTGCAGTGCCCTGG - Intronic
1140948425 16:79793193-79793215 TCTCAGACACTGCAGAGCACTGG + Intergenic
1141097711 16:81174740-81174762 TCAGTGACTGTCCTGAGCCCTGG + Intergenic
1141213610 16:82003947-82003969 TCTTAGACACTGCAGAGCCCTGG - Intronic
1141427489 16:83953444-83953466 CCGGAGGGTCTGCAGAGCCCTGG + Intronic
1141817032 16:86418027-86418049 TCATAGGCTCTGCTGTGCCCTGG + Intergenic
1142124385 16:88402894-88402916 TGAAAGAGTCAGCAGAGCCCAGG - Intergenic
1142611236 17:1109959-1109981 TCACAGGCGCTGCAGAGACCAGG + Intronic
1143411830 17:6713739-6713761 TCCGGGACCCTTCAGAGCCCAGG - Intergenic
1143538464 17:7555909-7555931 CTGGAGACTCTGCAGAGCACAGG + Intronic
1144420770 17:15096074-15096096 TCAGGGACAGTGCAGAGCACTGG + Intergenic
1144460726 17:15456744-15456766 CCAAAGACTCTGTGGAGCCCTGG + Intronic
1144484177 17:15651412-15651434 ACAGCGACTCTGCAGAGCAGGGG - Exonic
1145906830 17:28520977-28520999 TCAGAGAAGCTGTAGAGCCTGGG + Intronic
1145948655 17:28798287-28798309 TCAGAGAATCACCTGAGCCCAGG + Intronic
1146611938 17:34313822-34313844 TCAGAGACTCTCCAGTGCACTGG - Intergenic
1146890312 17:36502345-36502367 TCAGGGAGGCTGAAGAGCCCGGG - Intronic
1147452845 17:40516747-40516769 CCAGACACTGTGCAGTGCCCTGG - Intergenic
1147512540 17:41083890-41083912 TAAAAGACACTGCAGAGACCAGG + Intergenic
1147514707 17:41105072-41105094 TAAAAGACACTGCAGAGACCAGG + Intronic
1147952708 17:44115866-44115888 TGAGAGCCACTGCTGAGCCCTGG - Intronic
1148242948 17:46012256-46012278 CCAAAGACGCTGCAGTGCCCAGG + Intronic
1148889599 17:50798384-50798406 TAAGAGACTCTGCAAGGCCGAGG - Intergenic
1149086566 17:52724489-52724511 TCAGTGTCTCTGGAGAACCCTGG + Intergenic
1149478464 17:56983099-56983121 TCAGAGTTTCTGGATAGCCCTGG + Intronic
1150971170 17:70029733-70029755 CCTGAGTCTATGCAGAGCCCAGG - Intergenic
1152043851 17:77923374-77923396 TCAGAGACCAGGCACAGCCCTGG - Intergenic
1152057728 17:78044399-78044421 TCAGATACTCTGCTGAACACTGG + Intronic
1152072696 17:78141850-78141872 TGTGAAACTCAGCAGAGCCCTGG + Exonic
1152408769 17:80111733-80111755 TCTGGGGGTCTGCAGAGCCCAGG + Intergenic
1152566428 17:81102406-81102428 TCAGAACGTCTGCCGAGCCCTGG - Intronic
1152911191 17:83005791-83005813 TCTGAGGCTCTGCAGGGCCCGGG - Intronic
1152922076 17:83070801-83070823 GCAAAAACTCTGCAGAGCTCTGG - Intergenic
1154332059 18:13438108-13438130 TCAGACTATCTGGAGAGCCCAGG - Intronic
1154343463 18:13523610-13523632 CCAGTGGCTCTGAAGAGCCCAGG - Intronic
1155185423 18:23383140-23383162 TCAGCTCCCCTGCAGAGCCCTGG - Intronic
1157096824 18:44693269-44693291 TCAGAAACTGTGCCAAGCCCTGG + Intronic
1157176390 18:45456333-45456355 GCACTGACTCTGCAGAGCTCTGG - Intronic
1158545519 18:58392968-58392990 TCTGTGACTCTGGTGAGCCCTGG - Intronic
1158596770 18:58823534-58823556 TGAGTTGCTCTGCAGAGCCCAGG + Intergenic
1159537330 18:69730871-69730893 TGAGAGAATCTCCTGAGCCCAGG + Intronic
1159764384 18:72470231-72470253 TCAGAAACTATACATAGCCCTGG - Intergenic
1160192030 18:76722551-76722573 CCAGAGGCTCTGCAGGCCCCAGG - Intergenic
1160332051 18:78002989-78003011 TCACAGGCCCTGCAGAGCCTGGG + Intergenic
1160444301 18:78915217-78915239 TCAGAGATTCTGCAGTCCCAGGG - Intergenic
1160483029 18:79260479-79260501 TCAGCAACTCTGCAGAAACCAGG + Intronic
1160503547 18:79414483-79414505 TCAGAGGCTCTGCATAGCACTGG - Intronic
1161068833 19:2250638-2250660 GCAGAGGCTCTGCGGAGACCAGG - Exonic
1161161296 19:2763088-2763110 TCAGGGCCCCTACAGAGCCCAGG + Intronic
1161417718 19:4157039-4157061 GCAGTGAGTCTCCAGAGCCCAGG - Exonic
1161575727 19:5053259-5053281 TCAGAGCCGCTGCGGTGCCCTGG + Intronic
1162604693 19:11697593-11697615 TCTGAGAAGCTGCAGTGCCCTGG - Intergenic
1162609081 19:11735513-11735535 TGAGAGAAGCTGCAGAGCACTGG - Intronic
1162625300 19:11880209-11880231 TCCGAGAAGCTGAAGAGCCCTGG + Intronic
1162630532 19:11923978-11924000 TCCGAGAAGCTGCAGAGCCCTGG + Intergenic
1162635448 19:11964218-11964240 TCCGAGAAGCTGCAGAGCCCTGG + Intronic
1162637976 19:11985238-11985260 TCTGAGAAGCTGCAGGGCCCTGG + Intergenic
1162646845 19:12056335-12056357 TCTGGGAAGCTGCAGAGCCCTGG - Intergenic
1162651309 19:12091108-12091130 TCTGAGAAGCTGCAGAGCCCTGG + Intergenic
1162659979 19:12161300-12161322 TCTGAGAAGCTGCAGAGCCCTGG + Intergenic
1163884528 19:19954124-19954146 TGAGAGAAGCTACAGAGCCCTGG - Intergenic
1163905103 19:20145311-20145333 TGAGAGAAGCTACAGAGCCCTGG - Intergenic
1163915040 19:20233795-20233817 TCAGAGAAACTGCAGAGCCCTGG - Intergenic
1163933668 19:20422755-20422777 TGAGAGAAGCTACAGAGCCCTGG - Intergenic
1163948544 19:20563219-20563241 TGAGAGAAGCTACAGAGCCCTGG - Intronic
1163969565 19:20779056-20779078 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1164042926 19:21509637-21509659 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1164080054 19:21854481-21854503 TGAGAGAAGCTACAGAGCCCTGG + Intergenic
1164095524 19:22006558-22006580 TGAGAGAAGCTACAGAGCCCTGG - Intronic
1164101382 19:22057440-22057462 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1164114993 19:22211243-22211265 TGAGAGAAGCTACAGAGCCCTGG - Intergenic
1164136262 19:22419347-22419369 TGAGAGAAGCTACAGAGCCCTGG - Intronic
1164241297 19:23391720-23391742 TGAGACAATCTACAGAGCCCTGG - Intronic
1164306628 19:24009649-24009671 TGAGAGAAGCTACAGAGCCCTGG - Intergenic
1164473253 19:28553260-28553282 TCAGAGTCTCTGAAAAGCCTGGG - Intergenic
1164744037 19:30598374-30598396 GGAGAGTCTCTGCAGAGACCTGG + Intronic
1166043174 19:40215173-40215195 CCAGACACTCCGGAGAGCCCTGG + Exonic
1166523687 19:43497807-43497829 CCAGAGACTCCGCAAGGCCCAGG - Exonic
1166596134 19:44051926-44051948 CCAGACACTCTGCGGAGTCCCGG + Intronic
1168227468 19:55006310-55006332 TCAGTGACTGGGCACAGCCCAGG + Intergenic
1168362477 19:55753737-55753759 TCAAAGACTCTGCAGGACGCTGG + Intergenic
925112882 2:1351755-1351777 TCAGAGACACTTCAGAGCAGTGG - Intronic
926692963 2:15749898-15749920 TCAGAGACACCAGAGAGCCCAGG + Intergenic
927599853 2:24431354-24431376 TGAGAGGCTCAGCAGAGCCTAGG - Intergenic
928090246 2:28369363-28369385 TCAGAGGCTGAGCAGATCCCAGG - Intergenic
928401453 2:30981584-30981606 TCTGATGCTCTGCAGGGCCCTGG + Intronic
928686548 2:33755897-33755919 TCAGAGACTCTGACTTGCCCAGG + Intergenic
932001502 2:67889278-67889300 TCAGACTCACTGCAGAGACCTGG + Intergenic
932776810 2:74533117-74533139 TCTGTGATTCTTCAGAGCCCAGG - Exonic
935210381 2:100934867-100934889 TCAGAGACTGTGAAGAATCCAGG + Intronic
935239554 2:101166679-101166701 AAAGAGACTCGGGAGAGCCCTGG + Intronic
937010095 2:118555199-118555221 ACAGAGGCTCTCCAGAGCCATGG + Intergenic
937883496 2:126885508-126885530 TCTGTTTCTCTGCAGAGCCCTGG + Intergenic
938780058 2:134576629-134576651 ACAGAGACTCAGGAGAGGCCAGG - Intronic
939791967 2:146588739-146588761 TCTGACACTCTGAACAGCCCAGG - Intergenic
940175813 2:150876848-150876870 TCAGATTCTCTGCAAGGCCCCGG + Intergenic
940335074 2:152518206-152518228 TCAGACACTCTACAGAGGTCTGG - Intronic
942379904 2:175378256-175378278 ACAGACACTCTGCAGAGCACTGG + Intergenic
943562826 2:189483828-189483850 TCAGCTGCTCTGCAGATCCCAGG + Intergenic
945953901 2:216067228-216067250 AGAGAGACTCTGCAGATCTCTGG - Intronic
946021413 2:216642875-216642897 TCAGGGATTCTCCAGAGCTCTGG - Intronic
947569877 2:231224962-231224984 TCAGAGACTAGGCAGGGCCTAGG + Intronic
947712528 2:232324194-232324216 TCATGGCCTCGGCAGAGCCCAGG + Intronic
947731319 2:232433119-232433141 TCACAGCAGCTGCAGAGCCCAGG - Intergenic
947731493 2:232433874-232433896 TCATGGCCTCGGCAGAGCCCAGG + Intergenic
948467533 2:238159336-238159358 CCTGAGTCTCTGCGGAGCCCCGG - Intronic
948889934 2:240902637-240902659 TCAGTGACTCTGCACCCCCCAGG + Intergenic
1170119049 20:12892651-12892673 TCAGGAACTCTGCTGAGCTCTGG + Intergenic
1171220851 20:23396195-23396217 TCAGAGAATCTTCAGTGACCTGG - Intronic
1171500415 20:25588674-25588696 TCAGAAGTTCTGCAGAGGCCCGG - Intergenic
1172969552 20:38863384-38863406 GCTGAGCCCCTGCAGAGCCCAGG + Intronic
1173142149 20:40493948-40493970 TCAGAGAGGCTTCAGAGACCTGG - Intergenic
1173167012 20:40692544-40692566 TCCGAGCCGCTGCAGAGCCTTGG + Intergenic
1175308125 20:57991965-57991987 TCTGAGTCTATGCAAAGCCCAGG + Intergenic
1177683002 21:24398991-24399013 TCAAAAACTCTGCATAGACCTGG - Intergenic
1178411473 21:32366986-32367008 TAAGAGACTCTGCAGACCACAGG - Intronic
1179575882 21:42308222-42308244 TCTGAGGCCCTGCAGGGCCCTGG - Intergenic
1179729512 21:43359965-43359987 TCAGGTTCTCTGCAGACCCCAGG - Intergenic
1180183567 21:46128705-46128727 GCAGAGACGTTGCAGAGGCCAGG + Intronic
1181038330 22:20180350-20180372 TCAGAGCCTTGGCAGAGCCAAGG - Intergenic
1183240936 22:36657914-36657936 TCAGACACTCTGGAGAGCTTGGG - Intronic
1183437093 22:37802588-37802610 TCAGGGACACTGCAGAGCTGGGG - Intergenic
1184373515 22:44097602-44097624 TCAGAGGCTCTGCACAGACCAGG - Intronic
1184450385 22:44579013-44579035 TGAGGGGCTCTGCAGTGCCCAGG - Intergenic
1185040792 22:48503164-48503186 TCACAGACATGGCAGAGCCCTGG - Intronic
1185116766 22:48942314-48942336 TTCCAGACTCTGCAGATCCCAGG + Intergenic
1185197259 22:49479684-49479706 TCAGGGACCCTGCAGACCACAGG - Intronic
1185210024 22:49565450-49565472 TCAGAGACGCTTCTCAGCCCAGG - Intronic
950137561 3:10592436-10592458 ACAGAGACTCTGCCCATCCCAGG + Intronic
950555170 3:13691224-13691246 TCAAAGACTCTTCTGAGTCCAGG - Intergenic
950655200 3:14432284-14432306 AAACAGGCTCTGCAGAGCCCAGG - Intronic
950667260 3:14505221-14505243 TCAGCCACTCGGCACAGCCCAGG + Intronic
950899219 3:16482133-16482155 TCAGAGACTCTGTGGGTCCCAGG + Intronic
950951466 3:17004332-17004354 TCATAGACTCTGCAAAGCTAGGG + Intronic
950986581 3:17376524-17376546 CCAGTGAGTCTGCACAGCCCAGG - Exonic
951025050 3:17818728-17818750 TCAGAGACTCATAAGGGCCCAGG - Intronic
951090834 3:18572294-18572316 CCAGAGGCTCAGCAGAACCCTGG + Intergenic
952139138 3:30458966-30458988 TCTGAGACTGTGCAGAGCAGTGG - Intergenic
953000013 3:38923925-38923947 TCAGGGACTCTCCAGTGACCTGG - Intronic
953890569 3:46749281-46749303 CCAGAGGCTCTGCAGAACCAAGG + Intronic
954137485 3:48588733-48588755 ACACAGACTCTGCAGAGATCCGG - Exonic
954411301 3:50372372-50372394 CCAGAGGCTTTGCTGAGCCCCGG - Intronic
954740421 3:52745283-52745305 TCAAAGATTCTGCTGAGGCCGGG + Intronic
954975150 3:54686627-54686649 TAAAATATTCTGCAGAGCCCTGG - Intronic
955533206 3:59895927-59895949 TCAGAGCCTCTGCACTGGCCTGG + Intronic
958868124 3:99525145-99525167 GCAGAGACTCTGCAGAGGGGTGG - Intergenic
958868178 3:99525553-99525575 GCAGAGATTCTTCGGAGCCCAGG - Intergenic
961133728 3:124491509-124491531 CCAGAGACTCTACTGAGCCATGG + Intronic
961371180 3:126433019-126433041 TCAGTCACTCAGCACAGCCCTGG - Intronic
961658458 3:128456015-128456037 ACTGAGCATCTGCAGAGCCCCGG + Intergenic
962323280 3:134408673-134408695 TGGGAGACCCTACAGAGCCCAGG + Intergenic
962479100 3:135783010-135783032 TCAGAAACCCTGCAGAGGCTGGG - Intergenic
964408367 3:156373701-156373723 TCTGAGACTCTGCATGGCCTGGG + Intronic
967115480 3:186333748-186333770 GAAGAGACATTGCAGAGCCCTGG + Intronic
968228491 3:196990660-196990682 ACACAATCTCTGCAGAGCCCTGG - Intronic
968895713 4:3401918-3401940 GGAGAGGCTCTGCAAAGCCCTGG - Intronic
969282126 4:6177812-6177834 TCAGAGACAATGCAGAGGCAGGG - Intronic
969402911 4:6968765-6968787 TCAGAGGCTCTGCAAAGCCTTGG - Intronic
969645967 4:8428935-8428957 TGAGAAACTCTGCAGAACCACGG - Intronic
976136874 4:81947211-81947233 TCAGAGACTCTGCAGGGAGCTGG - Intronic
977243896 4:94606465-94606487 TAGGAGACTGTGCAGAGGCCAGG + Intronic
979674599 4:123397981-123398003 TTCGAGACTCCGCAGCGCCCGGG - Intronic
980252134 4:130331079-130331101 TCATTGACTCTGCAGGGCTCAGG + Intergenic
983287751 4:165760790-165760812 TCTGGGACTCTGCAGACCACTGG - Intergenic
984577972 4:181473497-181473519 TCGGAGACTCAGTTGAGCCCAGG + Intergenic
984639019 4:182143407-182143429 TCAGAGGCTCTGCAAAGGACGGG + Intergenic
985173695 4:187178318-187178340 TCACAGACACTGCAGTGCACGGG - Intergenic
985835972 5:2272209-2272231 TCAGAGACTGGGAAGAGGCCAGG - Intergenic
986011206 5:3717114-3717136 TCAGAAATTATGCTGAGCCCTGG - Intergenic
986032881 5:3910077-3910099 TCAGGGCTGCTGCAGAGCCCAGG + Intergenic
986311136 5:6551875-6551897 CCAGACACCGTGCAGAGCCCGGG - Intergenic
987084774 5:14458298-14458320 CCAGGCACTGTGCAGAGCCCTGG + Intronic
987372207 5:17203562-17203584 GCAAAGGCACTGCAGAGCCCTGG - Intronic
988241223 5:28611699-28611721 TCAGAGATTTTACAGTGCCCTGG - Intergenic
992335178 5:75759975-75759997 TCAGAGGCAGTGGAGAGCCCTGG - Intergenic
992382278 5:76249827-76249849 TCGAAGACTCTGCAGAGCCATGG + Intronic
992420152 5:76595666-76595688 TCGGAGGATCTCCAGAGCCCAGG + Intronic
992818157 5:80465702-80465724 TCAGAAACTATGTAGAGGCCAGG - Intronic
995359429 5:111278233-111278255 TTAGAGTCACTGCATAGCCCTGG + Intronic
997510068 5:134447978-134448000 TCAGAGCTTCTCCAGAACCCAGG + Intergenic
997588464 5:135058458-135058480 TCAGAGACTCAGCTGCTCCCCGG - Intronic
998797479 5:145835307-145835329 TCCGGGCCTCTGCGGAGCCCTGG - Intronic
998817728 5:146030976-146030998 TTAGAGAGTTTGCAGATCCCTGG + Intronic
999178160 5:149646766-149646788 CCAGCAGCTCTGCAGAGCCCAGG + Intergenic
1001101779 5:168820238-168820260 TAAGAGCCTCTGCACAGCCCAGG - Intronic
1001453435 5:171843283-171843305 ACAGAGGTTCTGCAGAGTCCAGG - Intergenic
1003042167 6:2698457-2698479 GAAAAGACTCTGCGGAGCCCAGG - Intronic
1003084751 6:3052618-3052640 TGGGAGGCTCTGCAGTGCCCTGG + Intergenic
1003117889 6:3295420-3295442 TCAGAGCCTCTGCAGTGGCCTGG + Intronic
1003526391 6:6901533-6901555 GCAGATACTGTGCAGGGCCCCGG + Intergenic
1004127164 6:12885080-12885102 TCAGAGACAGTGCAGAGCTGAGG + Intronic
1005838764 6:29726192-29726214 TGAGAGACACCCCAGAGCCCTGG - Intronic
1005848711 6:29802387-29802409 TGAGAGACACATCAGAGCCCTGG - Intergenic
1005859663 6:29890452-29890474 TGAGAGACACATCAGAGCCCTGG - Intergenic
1005860719 6:29897757-29897779 TGAGAGACACATCAGAGCCCTGG - Intergenic
1005868905 6:29958534-29958556 TGAGAGACACATCAGAGCCCTGG - Intergenic
1005875915 6:30009333-30009355 TGAGAGACACATCAGAGCCCTGG - Intergenic
1006042701 6:31269350-31269372 TGAGAGACTCATCAGAGCCCTGG + Exonic
1006052301 6:31354491-31354513 TGAGAGACACATCAGAGCCCTGG + Exonic
1007703914 6:43779948-43779970 CCAGACACTCTTCCGAGCCCAGG - Intronic
1008940123 6:57037828-57037850 TCAGTCACCCTTCAGAGCCCTGG + Intergenic
1009204144 6:60781370-60781392 TCCGCGGCTCTGCAGATCCCAGG - Intergenic
1012678760 6:102152569-102152591 TTGGAGAATCTGCTGAGCCCAGG + Intergenic
1016773330 6:147876270-147876292 AGAGAGACTCTGCAGAGCTCAGG - Intergenic
1017821892 6:158054981-158055003 TCTGAGACTCCACAGAGGCCTGG + Exonic
1018170231 6:161138708-161138730 TCTGAGGCTTTGGAGAGCCCGGG - Intronic
1018870497 6:167778808-167778830 TAAGAGGCACTGCAGAGCTCTGG - Intergenic
1019169709 6:170125969-170125991 TCAGATGCTCTCCTGAGCCCTGG - Intergenic
1019541306 7:1552673-1552695 TCTGAGAGTCTGCCCAGCCCAGG - Intronic
1021065489 7:16167347-16167369 TCATAAACTCTGCAAAGCTCAGG + Intronic
1021843798 7:24744827-24744849 TCCAAGCCTGTGCAGAGCCCCGG + Intronic
1021886995 7:25148890-25148912 TCAGAGACTCTGCCGCCGCCAGG + Intronic
1023891339 7:44394026-44394048 CACCAGACTCTGCAGAGCCCAGG + Intronic
1025788977 7:64670031-64670053 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1025802278 7:64797611-64797633 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1025815433 7:64906685-64906707 TGAGAGAAGCTACAGAGCCCAGG + Intronic
1025865534 7:65377385-65377407 TGAGAGAAGCTACAGAGCCCTGG + Intronic
1026111247 7:67460438-67460460 GGAGAGTCTCTGCAAAGCCCTGG - Intergenic
1028378824 7:90176066-90176088 TCTGAGGCTCTGCAGATTCCTGG - Intronic
1028474645 7:91239921-91239943 TCACTTACCCTGCAGAGCCCAGG - Intergenic
1029307220 7:99629295-99629317 TCACAGACCCTTCCGAGCCCAGG - Exonic
1029472494 7:100763462-100763484 TGAGAGAATCTGTTGAGCCCAGG - Intronic
1032515782 7:132505070-132505092 CCAGAAACTCTGCACAGGCCTGG - Intronic
1032613152 7:133438290-133438312 TCAGGAACTCTGAGGAGCCCTGG - Intronic
1034292259 7:149942025-149942047 TCAGGCCCTCTGCAGAGCCAGGG - Intergenic
1034368211 7:150570222-150570244 TAAGAAACTGTGCCGAGCCCTGG - Intronic
1034813815 7:154154872-154154894 TCAGGCCCTCTGCAGAGCCAGGG + Intronic
1034864344 7:154628060-154628082 TCAGAAACCCTGCAGCTCCCAGG - Intronic
1035165142 7:156985128-156985150 TCAGGGACCCTGCTGACCCCAGG + Intergenic
1035395960 7:158534736-158534758 TCAGAGGGTCTGCACAGCCGAGG - Intronic
1035551485 8:530915-530937 TCAGAGACTCAGCAGTGCTGCGG - Intronic
1036422964 8:8614904-8614926 CCAGAGGCTCTGCAGAGGACAGG + Intergenic
1036937490 8:13017704-13017726 TGAGAGAATCTCTAGAGCCCAGG - Intronic
1037133820 8:15438835-15438857 TGAGTGAATATGCAGAGCCCTGG + Intronic
1038753155 8:30315697-30315719 GCAGAGGCTCTGCACAGCCTAGG + Intergenic
1039100371 8:33935040-33935062 CCAGAGACCCTGCTGACCCCTGG + Intergenic
1039456966 8:37713816-37713838 TCAGTAACTCAGCAAAGCCCAGG + Intergenic
1039939281 8:42075557-42075579 CCAGAAACCATGCAGAGCCCAGG + Intergenic
1041398044 8:57412034-57412056 TGAGAGAATCTCCTGAGCCCAGG - Intergenic
1042513215 8:69632795-69632817 TCAGAGGATCAGCTGAGCCCAGG + Intronic
1044896499 8:96898209-96898231 TCAGAGATTCTGAACTGCCCAGG - Intronic
1046086989 8:109450071-109450093 TCAGGAACTCCTCAGAGCCCAGG - Intronic
1046556413 8:115778895-115778917 TAAGAAACTGTGCAGAGCCAAGG + Intronic
1047862450 8:128983299-128983321 ACAGAGACCCTGCCGAGTCCTGG - Intergenic
1048460987 8:134621780-134621802 TAAGCAACTCTGAAGAGCCCTGG + Intronic
1049097077 8:140555160-140555182 ACTAAGACCCTGCAGAGCCCTGG + Intronic
1049488135 8:142876973-142876995 TCAGAGACCCTGGAGTGGCCAGG - Intronic
1049724625 8:144139928-144139950 GCCCAGACTCTGCAGTGCCCTGG - Exonic
1050263715 9:3868385-3868407 TCAGCGACTCTTCAAAACCCTGG + Intronic
1051198747 9:14593858-14593880 TCAGGATCTCTGCAGAGACCAGG - Intergenic
1055409486 9:76013482-76013504 TCAGAAGTTCTGCAGAGTCCTGG + Intronic
1055704586 9:78983785-78983807 TCAGACATTCTGCAGAACACAGG - Intergenic
1056074264 9:83022210-83022232 TGGGAGACTCTGCAGAAACCTGG + Intronic
1056932810 9:90892824-90892846 TCAGAGAACCTGGAGAGCCCAGG - Intronic
1057041851 9:91853706-91853728 TCTGAGAATCTACAGTGCCCGGG + Intronic
1057277339 9:93682995-93683017 TCCCAGACTCTGCACAGCCCTGG + Intergenic
1057481583 9:95449045-95449067 TAAGTGACTCTGCAGAACCAGGG - Intronic
1060437520 9:123607036-123607058 GGAGAGACTGTGCAGAACCCAGG + Intronic
1060889902 9:127181455-127181477 TCAGAGGCTGTCCAGAGCCTTGG - Intronic
1060908054 9:127325794-127325816 TAGGAGAGTCTGCAGAGCCCAGG - Intronic
1061307316 9:129739632-129739654 CCAGAGGATCTGCAGAGCCATGG + Exonic
1061716356 9:132520847-132520869 TTCGAGGCTCTTCAGAGCCCAGG - Intronic
1062253755 9:135611273-135611295 TCCCAGACTCTGCAGAGCCCTGG - Intergenic
1062320642 9:135989117-135989139 TCAGAGACTCGGCTGGGCACTGG + Intergenic
1062341124 9:136094490-136094512 TAAGAAACTCAGCGGAGCCCGGG - Intronic
1187152944 X:16697917-16697939 TCAGAGACTGTGCCCATCCCAGG + Intronic
1193488336 X:82115532-82115554 TCAGAGGCTCATCAAAGCCCTGG + Intergenic
1194108071 X:89796622-89796644 TCATAAACTCTTCAGAGCCCAGG - Intergenic
1195737275 X:108026136-108026158 TCAGAGAGACTGGAGAGACCAGG + Intergenic
1197159592 X:123308594-123308616 TCACACCCTCTGCACAGCCCTGG - Intronic
1200391940 X:155953793-155953815 TCAGAGCCTATGCACAGGCCAGG - Intergenic
1200460727 Y:3451353-3451375 TCATAAACTCTTCAGAGCCCAGG - Intergenic
1201728276 Y:17179023-17179045 TGAGAGACTCTCTTGAGCCCAGG + Intergenic
1202183284 Y:22157607-22157629 TGAGAGCCTCTGCAAGGCCCAGG - Intergenic
1202208075 Y:22428794-22428816 TGAGAGCCTCTGCAAGGCCCAGG + Intergenic