ID: 1133023394

View in Genome Browser
Species Human (GRCh38)
Location 16:2976783-2976805
Sequence CGCCCCGGAATGACACCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133023390_1133023394 5 Left 1133023390 16:2976755-2976777 CCAGGGCTCTGCAGAGTCTCTGA 0: 1
1: 0
2: 4
3: 35
4: 382
Right 1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 17
1133023388_1133023394 21 Left 1133023388 16:2976739-2976761 CCGGCTTGGGTCATACCCAGGGC 0: 1
1: 0
2: 1
3: 11
4: 105
Right 1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 17
1133023389_1133023394 6 Left 1133023389 16:2976754-2976776 CCCAGGGCTCTGCAGAGTCTCTG 0: 1
1: 0
2: 1
3: 51
4: 349
Right 1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133023394 Original CRISPR CGCCCCGGAATGACACCCGC CGG Exonic
903220249 1:21865362-21865384 TGCCCTGGAAAGACACCAGCAGG + Exonic
1062969004 10:1631430-1631452 CGCCCTGGCATGACACCAGCTGG - Intronic
1077096694 11:802004-802026 GGACCCGGAATGACAACAGCTGG - Exonic
1132482219 16:172475-172497 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132483067 16:176279-176301 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132754260 16:1474979-1475001 CGCCGCGGAGCGACACCGGCCGG + Exonic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1152558182 17:81065023-81065045 TGCCCCGGAATCACGCCTGCCGG - Intronic
934553789 2:95277096-95277118 CGCCCCAGGAGGACACCCGCTGG - Intronic
937672438 2:124552480-124552502 AGCCCAGGAATGAGACCAGCTGG - Intronic
1171452933 20:25248485-25248507 CGCCCCGCAGAGACCCCCGCTGG - Intronic
1179512034 21:41879437-41879459 CGCCCCGCAGTCCCACCCGCAGG - Exonic
960276968 3:115739686-115739708 TGCTCCTGAATGATACCCGCTGG - Intergenic
967097741 3:186191446-186191468 GGCCCCTGAATGACACCTACAGG + Intronic
1001052453 5:168424010-168424032 CGCCCAGGAAAGATACCGGCTGG + Exonic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG + Intronic
1029437227 7:100570077-100570099 CGCCCCTGAATGAAGCCCGCAGG + Intergenic
1032389677 7:131547800-131547822 CTCCACGGAATACCACCCGCAGG + Intronic
1035530403 8:346302-346324 TGCCCTGGAATGACCCACGCTGG - Intergenic
1188723779 X:33554894-33554916 TTCCCCTGAATGACACCCTCAGG + Intergenic