ID: 1133024171

View in Genome Browser
Species Human (GRCh38)
Location 16:2980493-2980515
Sequence GACGGGCTGCACTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 412}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133024171_1133024185 -2 Left 1133024171 16:2980493-2980515 CCCCCTCCCCAGTGCAGCCCGTC 0: 1
1: 0
2: 5
3: 32
4: 412
Right 1133024185 16:2980514-2980536 TCAGGGGTGCCCGGGCTCCGAGG 0: 1
1: 0
2: 1
3: 30
4: 236
1133024171_1133024182 -10 Left 1133024171 16:2980493-2980515 CCCCCTCCCCAGTGCAGCCCGTC 0: 1
1: 0
2: 5
3: 32
4: 412
Right 1133024182 16:2980506-2980528 GCAGCCCGTCAGGGGTGCCCGGG 0: 1
1: 0
2: 0
3: 14
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133024171 Original CRISPR GACGGGCTGCACTGGGGAGG GGG (reversed) Exonic
900119581 1:1042824-1042846 CCAGGGCTGCACGGGGGAGGAGG - Intronic
900584831 1:3427792-3427814 GTGGGGTTGCACTGGGGTGGAGG - Intronic
900611292 1:3545649-3545671 AAGGGGCTCCACTGGGGTGGCGG - Intronic
900917878 1:5651132-5651154 GAGGGGCTGCACTGGGGGAAGGG - Intergenic
901034735 1:6329624-6329646 GAAAGGCAGCATTGGGGAGGAGG - Intronic
901049765 1:6420233-6420255 GAAGGGCAGCATTGGAGAGGAGG - Intronic
901793237 1:11665309-11665331 GACGGCCTGAACCCGGGAGGCGG - Intronic
903732318 1:25505596-25505618 GAGGGTCTCCACAGGGGAGGTGG - Intergenic
904280199 1:29413539-29413561 GCTGGGATGCACTGGGCAGGTGG + Intergenic
905617168 1:39409104-39409126 GTCGCGCTGCGCGGGGGAGGAGG + Intronic
905819743 1:40980056-40980078 GCCGGGCGGCGCTGGGGAGAGGG + Intronic
905870940 1:41404338-41404360 GGCGGGCTGCACAGGGGTAGAGG - Intergenic
906400668 1:45502000-45502022 CACTGGCTGCAGTGTGGAGGAGG - Intronic
907291171 1:53413904-53413926 GGCGGGATGCACCTGGGAGGCGG - Intergenic
907354766 1:53863121-53863143 GACGGGTTGGACTGTGGAGCAGG - Intronic
910790758 1:91047508-91047530 GAAGGGCTGAACTGGGGACCAGG + Intergenic
912679944 1:111722615-111722637 GATGACATGCACTGGGGAGGCGG - Exonic
913130987 1:115838490-115838512 GCCGGCCTGCTGTGGGGAGGGGG - Exonic
915217702 1:154350913-154350935 GATGGGCTGCAGTGAGGTGGGGG + Exonic
915597185 1:156902379-156902401 GCTGGGCTGCACTGGAGGGGTGG + Intronic
915979270 1:160409959-160409981 CACGGGCTGCAGTGGGAAAGGGG + Intronic
916414642 1:164581072-164581094 GTCTGGCTGCACCAGGGAGGTGG - Intronic
916833124 1:168513337-168513359 GACAGGCTGGACTGCTGAGGTGG + Intergenic
917122539 1:171656733-171656755 GATGGGCTGCACAGGGGAGGTGG + Intergenic
917839656 1:178967492-178967514 GACCGGCTGCTTTGGGAAGGTGG - Intergenic
917930182 1:179817496-179817518 GCTGGGCTGCACTGGGGATCTGG - Intergenic
917967799 1:180189426-180189448 GGCGGGGGGCAGTGGGGAGGAGG - Intronic
919747210 1:201016474-201016496 GGCAGGCTGCCATGGGGAGGAGG - Intronic
919847614 1:201651400-201651422 GAGGGGCAGGAGTGGGGAGGAGG + Intronic
920748495 1:208651627-208651649 GACTGGCTGCAGAGAGGAGGGGG - Intergenic
921029860 1:211327246-211327268 GTCGGGGTGCACTGGCGGGGAGG + Intronic
921034540 1:211364309-211364331 GACTGGCTGCCATGGGCAGGAGG - Intronic
921131576 1:212224412-212224434 GAGGGGCTTCACTGAGGAGGTGG + Intergenic
921314156 1:213874898-213874920 GAAGGGCTGCCCCGGGGAAGGGG - Intergenic
921646982 1:217630889-217630911 GGCTGGCGGCCCTGGGGAGGGGG - Intronic
922216853 1:223526765-223526787 GAGAGGCTGGACTGGGGACGTGG + Intergenic
922784655 1:228276918-228276940 CACGGGAAGCTCTGGGGAGGAGG - Exonic
923233426 1:232009968-232009990 GCAGGGCTGGCCTGGGGAGGTGG - Intronic
923339797 1:232997613-232997635 GGTGGTCTGCACTGGGGAGGAGG - Intronic
924603363 1:245510828-245510850 GCTGAGCTGCACTGGGAAGGTGG + Intronic
1063213859 10:3906203-3906225 GACGGGGTGGAAAGGGGAGGAGG + Intergenic
1063380911 10:5585274-5585296 CTCGGGCTGCTCTGGGGAGAGGG - Intergenic
1063393627 10:5666418-5666440 GATGGCCTGCGCCGGGGAGGTGG - Intronic
1063563048 10:7147713-7147735 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563059 10:7147754-7147776 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563070 10:7147795-7147817 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563081 10:7147836-7147858 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563112 10:7147959-7147981 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563123 10:7148000-7148022 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563134 10:7148041-7148063 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563144 10:7148082-7148104 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563155 10:7148123-7148145 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563165 10:7148164-7148186 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563176 10:7148205-7148227 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063563186 10:7148246-7148268 GAGGGGCTGCACCTGGAAGGAGG - Intergenic
1063657618 10:8008059-8008081 GACGGGCTGCAGAGGTAAGGAGG - Intronic
1065528092 10:26642939-26642961 GGCGGGCTGCTGTGGGGATGGGG + Intergenic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067834496 10:49629816-49629838 GCAGGGCTGCTCTGGGGAGGGGG - Intronic
1067937358 10:50623588-50623610 GGCGGGCTGCTCTGGGGCGAGGG - Intronic
1068730518 10:60353068-60353090 GATGGCCTGAGCTGGGGAGGTGG - Intronic
1069195538 10:65546288-65546310 TAAGAGCTGGACTGGGGAGGGGG - Intergenic
1069949559 10:72009652-72009674 GGCGGGCTTCTCAGGGGAGGGGG - Exonic
1070781538 10:79140228-79140250 GATGTGCTTCACTGGGGATGTGG + Intronic
1071295538 10:84216828-84216850 GCCGGGCTGCACTGGTAGGGTGG - Exonic
1072619260 10:97068763-97068785 GACAGACTACACTGGGGAGCTGG - Intronic
1074663200 10:115687963-115687985 GAAGGGTTGCAGTGGGGAGCGGG - Intronic
1075094335 10:119461049-119461071 GATGGGCTGGGCTGGGCAGGAGG + Intergenic
1075101005 10:119506237-119506259 AACGGGCTGCACCCAGGAGGAGG + Intronic
1075355415 10:121768462-121768484 GAGGGGCTGGGCAGGGGAGGGGG + Intronic
1075410549 10:122224842-122224864 GACACTCTGCACAGGGGAGGAGG - Intronic
1075566985 10:123512078-123512100 GAGGGGCTGGGCTGGGGAGCAGG + Intergenic
1076251095 10:128984419-128984441 GCCTGGCTGCACTGGGGCTGTGG + Intergenic
1076433995 10:130427149-130427171 GACGGGCAGCACAGTGGAGAAGG + Intergenic
1077160683 11:1111130-1111152 GTCGGGTGGCCCTGGGGAGGTGG + Intergenic
1077162745 11:1121141-1121163 GATGGGCAGCCCTGGGGCGGTGG + Intergenic
1077285911 11:1765897-1765919 GAGGTGCTGCTCTGAGGAGGTGG - Intergenic
1077499601 11:2903165-2903187 GGAGAGCTCCACTGGGGAGGGGG + Intronic
1077499937 11:2904743-2904765 CAGGGGCTGCAGTGGGAAGGGGG + Intronic
1080937728 11:36881585-36881607 GGAGGGCTGTAGTGGGGAGGAGG + Intergenic
1081656186 11:44858972-44858994 GACGGTGTGAACTGGGGAGCGGG - Intronic
1083173280 11:60935145-60935167 CACGGGCTGCCCTCCGGAGGTGG - Intronic
1083275021 11:61592020-61592042 GACAGGCTTCACTGAGAAGGTGG + Intergenic
1083341232 11:61959688-61959710 GACTGGCTGCAGGAGGGAGGAGG - Intronic
1083434198 11:62631547-62631569 AACTGGTTGAACTGGGGAGGTGG - Intronic
1084357693 11:68650959-68650981 GCCGGGCTGCCTTCGGGAGGGGG - Intergenic
1084512913 11:69617274-69617296 GGTGGGGTGCACTGGGCAGGGGG + Intergenic
1084689580 11:70717134-70717156 GGCAGGCTGCACTCGGGAGCAGG + Intronic
1084864021 11:72041238-72041260 GAGGGGGTGCACTGGAGAGGAGG + Intronic
1085318637 11:75561419-75561441 GAGGGGATGCAATAGGGAGGGGG + Intergenic
1085423140 11:76380874-76380896 GGCGGACTGCCCTGAGGAGGCGG - Exonic
1085513745 11:77100600-77100622 TCCGGGCAGCACTGGGAAGGAGG - Intronic
1088544735 11:110947824-110947846 GAAGGGGTGCTCAGGGGAGGGGG + Intergenic
1089003723 11:115073549-115073571 GAGGGGCTTCACGGAGGAGGTGG + Intergenic
1089692827 11:120197490-120197512 GCCGGGCTGAACTGGGGGTGGGG - Intergenic
1090035918 11:123249436-123249458 GAAGGGCTGCTCTGAGTAGGTGG + Intergenic
1091793834 12:3286273-3286295 GACTCACTGCAGTGGGGAGGAGG - Exonic
1091918414 12:4285691-4285713 GAATGGCTGCATTGGGTAGGTGG + Intronic
1093989342 12:25572568-25572590 GCAGGGTTACACTGGGGAGGAGG + Intronic
1095949835 12:47775879-47775901 GACTGGCTTTCCTGGGGAGGCGG + Intronic
1096090791 12:48899230-48899252 AACGGCTTGAACTGGGGAGGCGG + Intergenic
1096228987 12:49887175-49887197 GACCGGCTGACCTGGGCAGGAGG - Intronic
1096496477 12:52042032-52042054 GAGGGGAAGCCCTGGGGAGGTGG + Intronic
1097267201 12:57752751-57752773 GCCTGTCTGCATTGGGGAGGGGG + Intronic
1100315650 12:93442078-93442100 GGCGGGGCGCACGGGGGAGGGGG - Exonic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1101062524 12:100987014-100987036 GAGAGGCTGCTCAGGGGAGGTGG + Intronic
1102247265 12:111363217-111363239 GGAGGGCTGCACTGTGGAGCTGG - Exonic
1102702045 12:114847737-114847759 GTTGGGGTGCACTGGGGCGGAGG + Intergenic
1104033367 12:125081077-125081099 GATGGCTTGAACTGGGGAGGTGG - Intronic
1104067457 12:125317437-125317459 GACGGGCAGAACTGGGAAGTGGG + Intronic
1104910636 12:132238556-132238578 GAGGGGCTGCCCTAGGGATGGGG + Intronic
1104971031 12:132530761-132530783 GGCCTGCTGCACTGGGGATGGGG + Intronic
1106409234 13:29499360-29499382 GATGGGCTGCCCTTGGAAGGAGG - Intronic
1109130126 13:58574640-58574662 GACAGTTTGCACTGGGAAGGTGG - Intergenic
1111672698 13:91348789-91348811 GGCGGGCTGCACGGGGGTGAGGG + Intergenic
1112415473 13:99200610-99200632 AACGGGTGGCACTGGGGAAGCGG - Intergenic
1114302534 14:21391508-21391530 GCCGGGCTGAACTGGAGATGTGG - Exonic
1116328608 14:43567246-43567268 GAATGGCTGAACTAGGGAGGCGG - Intergenic
1116835785 14:49768154-49768176 GACGGGCTGCAATAGGGAGCCGG + Exonic
1116895326 14:50310578-50310600 GACAGGAAGCATTGGGGAGGGGG + Intronic
1118137445 14:63045353-63045375 GATGAGCAGCTCTGGGGAGGAGG + Exonic
1118600736 14:67470130-67470152 GCGGGGCTGCCCTGTGGAGGGGG - Intronic
1119568409 14:75648262-75648284 GAAGGGCTGGGCTGGGGCGGGGG + Intronic
1119903104 14:78278055-78278077 CACTGGGTGTACTGGGGAGGCGG + Intronic
1121560828 14:94874033-94874055 GAGGGGCTGCAGAGGGGAGCAGG - Intergenic
1122145963 14:99688954-99688976 GAGCGGGAGCACTGGGGAGGAGG - Intronic
1122324789 14:100875645-100875667 GAGGGGGTGCATTGGGGAGGAGG - Intergenic
1122548616 14:102538487-102538509 GCCTGGCAGCACTGGGGATGTGG - Intergenic
1122595857 14:102891356-102891378 GACGTGCTGCACGGCGGAGCTGG - Exonic
1122811813 14:104292943-104292965 GAGGGGCTCTGCTGGGGAGGGGG + Intergenic
1122881106 14:104690781-104690803 GCCGCCCTGCACTGGGAAGGTGG + Intronic
1122951544 14:105047772-105047794 GACGGGCGCAGCTGGGGAGGTGG - Intergenic
1122988060 14:105221702-105221724 GGCTGGCTGCAGTGGGGAGGGGG + Exonic
1123090604 14:105740498-105740520 GAAGGGCGGCACTGGGAAGTGGG + Intergenic
1124243458 15:28050960-28050982 GAGTGGCTGTACTGGGGTGGAGG - Intronic
1124612335 15:31216583-31216605 GGCGGGCTGAACTGTGGAGAGGG - Intergenic
1126800531 15:52293642-52293664 GAGAGGCTGGACTGGGGAGTGGG - Intronic
1127023378 15:54775958-54775980 GTCGGGATTCACTGGGGAAGAGG - Intergenic
1128346331 15:66854733-66854755 GACGGCATTCACTGGGGAAGGGG + Intergenic
1129165543 15:73775211-73775233 GGAGGGCGGCACTGTGGAGGAGG + Intergenic
1129253181 15:74319738-74319760 GACCGGCTGGGCTGGGGTGGGGG - Intronic
1130253932 15:82317061-82317083 GGGTGGCGGCACTGGGGAGGGGG + Intergenic
1132011945 15:98283908-98283930 GATTGGCATCACTGGGGAGGTGG - Intergenic
1132392872 15:101451436-101451458 GCTGGGCTGGCCTGGGGAGGTGG - Intronic
1132587145 16:710527-710549 GACCTGCTGCAAAGGGGAGGCGG - Intronic
1132626843 16:895300-895322 GATGGGCTGACCTGGGGAGGAGG - Intronic
1132851177 16:2025681-2025703 GCCTGGCTGGGCTGGGGAGGAGG + Intronic
1133024171 16:2980493-2980515 GACGGGCTGCACTGGGGAGGGGG - Exonic
1133255719 16:4514533-4514555 CACAGGCTGCACTGGGAATGGGG + Intronic
1133770867 16:8866748-8866770 GACGGGAGGCAAAGGGGAGGGGG + Intronic
1134107475 16:11494423-11494445 GACGGGTTGAAGTGGGGAAGGGG + Intronic
1135158164 16:20072057-20072079 GAAGGGCTGAAGGGGGGAGGTGG + Intronic
1136233853 16:28903013-28903035 GACAGGCTGCAGAGGGGAAGGGG - Exonic
1136358320 16:29761149-29761171 GAGGGCCTGGACTGGGGAGGAGG + Intergenic
1138652328 16:58467866-58467888 GATGGAGTGCACTCGGGAGGCGG - Intronic
1139483796 16:67245253-67245275 GAAGGACTGCATTGGGGATGAGG + Intronic
1139748051 16:69090254-69090276 GAGGGCCAGCACGGGGGAGGTGG - Intergenic
1141162912 16:81640991-81641013 GACGTGCTGCAGAGGAGAGGAGG - Intronic
1141635201 16:85310792-85310814 GAGGGGCTGGGCTGGGGAGGTGG - Intergenic
1141800401 16:86304121-86304143 GAGGGGCTGCGCTGGGGCTGGGG + Intergenic
1142129422 16:88425941-88425963 GACTGCCTGCACCGGGGAGGAGG - Intergenic
1142216365 16:88831897-88831919 CACGGGGTGCATGGGGGAGGTGG + Intronic
1203141919 16_KI270728v1_random:1772307-1772329 CACGGGCTGCAAGGGGGAGGAGG - Intergenic
1142768168 17:2077386-2077408 GGGGGGCTTCACTGGGGAAGTGG + Intronic
1142855884 17:2730022-2730044 GATGGGAAGGACTGGGGAGGTGG + Intergenic
1142863487 17:2777123-2777145 CACAGGCTGTGCTGGGGAGGTGG + Intronic
1143371797 17:6444967-6444989 GACGGGATGCAGCGGGGTGGCGG - Intronic
1143476858 17:7208035-7208057 CGAGGGCCGCACTGGGGAGGGGG + Intronic
1143593344 17:7899229-7899251 GACCGCCTGGACTGGGGAAGTGG + Intronic
1143632560 17:8147376-8147398 GACGGGCTGCAGCAGGGAGAGGG + Exonic
1144735834 17:17554986-17555008 CACGGCCTCCACTGGGGATGCGG + Intronic
1146909515 17:36639615-36639637 GAGGGGCTGCACTGGGCAGCAGG - Intergenic
1146996147 17:37322836-37322858 GAGGGGCTGGAGTAGGGAGGTGG - Intronic
1151704533 17:75759645-75759667 GACAGGCTGGGGTGGGGAGGAGG + Intronic
1151763854 17:76122153-76122175 GCCGGGCTGCGGTGGGGAGCGGG + Intergenic
1151881253 17:76896109-76896131 GAGGGGCTGGACTGGGGGGATGG - Intronic
1152760272 17:82103865-82103887 GCCGGCCTGCCCTGGGGAGGGGG - Intronic
1152928192 17:83097494-83097516 GGCGGGCTTCACAGGGGAGGTGG + Intergenic
1155522452 18:26682750-26682772 GAAAGGCTTCACTGGGTAGGTGG - Intergenic
1155928716 18:31684769-31684791 GAGGGGCTGCAGGTGGGAGGAGG + Intronic
1157220506 18:45825665-45825687 GAGGGCCCTCACTGGGGAGGTGG + Exonic
1157605175 18:48921977-48921999 GACTGGGTGCAGTGGGGGGGCGG - Intronic
1158269899 18:55701426-55701448 GCGGGGGGGCACTGGGGAGGAGG - Intergenic
1158579925 18:58671896-58671918 GGTGGGCTGCGGTGGGGAGGTGG + Intronic
1158648757 18:59268906-59268928 GAGGGGCCGAGCTGGGGAGGGGG + Exonic
1158893275 18:61893000-61893022 GAGCGGGTGCACTAGGGAGGTGG + Exonic
1159104781 18:63993740-63993762 GGCAGGCTGCATGGGGGAGGTGG + Intronic
1160529230 18:79553803-79553825 GAAGGGCTGCACTGTGAAGAAGG + Intergenic
1160730786 19:640804-640826 GGCGGGGGGCACTGGGAAGGGGG + Intronic
1160752620 19:741555-741577 GACGGGCTGCAGGGGTGAGGGGG + Intronic
1160913865 19:1487663-1487685 GACCCGCTGTGCTGGGGAGGTGG - Exonic
1160951913 19:1671913-1671935 GGAGGGCTTCCCTGGGGAGGTGG - Intergenic
1160967905 19:1754548-1754570 CACGGGCCGCACGGGGGAGGCGG + Exonic
1161479659 19:4504223-4504245 GGCAGGCAGCGCTGGGGAGGAGG + Exonic
1161626316 19:5329006-5329028 GACGGGCTGATCTGGAGGGGCGG + Intronic
1162021355 19:7869912-7869934 GACGGGCTGCGCGAGGGCGGCGG + Exonic
1162526718 19:11210557-11210579 GAGGGGATGCACAGGTGAGGGGG - Intronic
1162947681 19:14053770-14053792 GGCGGGCTGCTCTGGGGCTGGGG + Exonic
1163158101 19:15449786-15449808 GCCGGGCCTCACCGGGGAGGCGG + Exonic
1163774990 19:19212519-19212541 GCCGGACTGCAGTGGGGAGGGGG + Intronic
1164394525 19:27851411-27851433 CACGGGCTGCAGCGGGGAGCTGG + Intergenic
1164743795 19:30595920-30595942 GAGGGGGTGCAGTGGGGAGCAGG + Intronic
1165130562 19:33629399-33629421 GACTGGCTCCCTTGGGGAGGAGG - Intronic
1165383400 19:35496175-35496197 GACAGGCTGCCGTGGGGATGGGG - Intergenic
1165448490 19:35869394-35869416 GAGCGGCTGCGCTGGGGTGGGGG + Intronic
1165459576 19:35936624-35936646 GACCGGCTGCGGTGGGGAGGGGG - Intronic
1165789378 19:38482399-38482421 GATGGGCTCCACTGGGAAGACGG + Intronic
1165822111 19:38683304-38683326 CAGGGGCTGCACTGGGAGGGAGG - Intronic
1166083968 19:40462803-40462825 GAATGGCTGAACTCGGGAGGCGG + Intronic
1166342019 19:42143763-42143785 GAAGGACTGCACTGGGCAGGAGG - Intronic
1166855207 19:45779859-45779881 GATGGGCTCCGCTGGGGGGGTGG + Exonic
1167040604 19:47020778-47020800 GGCGGGCGGCGCGGGGGAGGCGG + Intronic
1167510934 19:49895096-49895118 CACGGGCTGGATTGGGGAGCTGG - Exonic
1168649650 19:58085242-58085264 GTCGGGCACCACTGAGGAGGAGG - Exonic
925018627 2:551594-551616 GAAGGGCTGGGCTGGGAAGGTGG - Intergenic
925064972 2:922496-922518 AACGGGCTGCCCTTGGGAGCTGG + Intergenic
925104836 2:1282624-1282646 GACGCGCTGTGCGGGGGAGGCGG - Intronic
925764001 2:7213458-7213480 GAAGGGCTGCAGTTGGGAAGAGG - Intergenic
925825680 2:7846547-7846569 CACGGGCTGGACTTGGAAGGAGG + Intergenic
926123364 2:10256600-10256622 GACGCCCTGCACTGGGGACAGGG - Intergenic
927713407 2:25339489-25339511 GAGGAGCTGCACAGAGGAGGGGG + Intronic
928162208 2:28938961-28938983 GCCTGGCAGCACTGGTGAGGGGG + Intronic
929427178 2:41855205-41855227 AACTGGCTGCCCAGGGGAGGGGG - Intergenic
929776987 2:44935942-44935964 CACCGGCTGCTCAGGGGAGGAGG - Intergenic
929923221 2:46188497-46188519 CATGGGCTGCATGGGGGAGGCGG - Intergenic
929934229 2:46282626-46282648 GAGGGGCTGCACTGAGGAGGGGG + Intergenic
932369829 2:71177743-71177765 TCCTGGCTGCCCTGGGGAGGAGG + Intergenic
932447010 2:71787401-71787423 GATGGGGTGGAATGGGGAGGGGG - Intergenic
932667353 2:73708228-73708250 GATGGGGTGCCCTGGGGAGCTGG + Intergenic
934764063 2:96870411-96870433 GGCGGGCTGGGCTGGGGAGAGGG + Intronic
934989700 2:98912653-98912675 GCAAGGCTGCAATGGGGAGGGGG - Intronic
936388710 2:112054309-112054331 GACGGGCCTGAGTGGGGAGGCGG - Intergenic
936980757 2:118262955-118262977 TACGGGCTGCTCTGGGATGGTGG + Intergenic
937081265 2:119141725-119141747 GAGGGGAGGAACTGGGGAGGAGG - Intergenic
937888156 2:126914735-126914757 GATGAGCTGCCCTGGGGAAGGGG - Intergenic
937950881 2:127387517-127387539 GACAGGCCGCGCTGGGGCGGAGG - Intronic
938727401 2:134120531-134120553 GAGGGGCTGCCCGGGGCAGGTGG - Intronic
944641191 2:201727671-201727693 GACGGGGTGGGGTGGGGAGGGGG + Intronic
944885423 2:204057999-204058021 GAAAGGCTGCACTGGAGAAGAGG - Intergenic
946015534 2:216601139-216601161 GAAGGCTTGCACAGGGGAGGTGG + Intergenic
946140961 2:217690237-217690259 GGTGGCCTGGACTGGGGAGGTGG - Intronic
947542129 2:230986605-230986627 GCCGGGCTGGACTGGGGGTGGGG + Intergenic
947636564 2:231683390-231683412 GTTGGGAGGCACTGGGGAGGAGG + Intergenic
947749202 2:232523970-232523992 GACGGGGGGCAGAGGGGAGGGGG + Intronic
948086624 2:235255898-235255920 GAAGTGCTGCTGTGGGGAGGAGG + Intergenic
948182985 2:235997681-235997703 GACGGACTGCGCTGGGGAGCTGG - Intronic
948992294 2:241561293-241561315 CACAGGCAGCACTGGGGCGGTGG + Intronic
1170201920 20:13753394-13753416 GAGTGGAGGCACTGGGGAGGAGG - Intronic
1172700763 20:36852335-36852357 GAAGGGCTGCTCTGTGGAGTGGG + Intronic
1172767537 20:37358792-37358814 GGAGGGGTGCACTGGGGACGGGG - Intronic
1173662568 20:44744774-44744796 TCCGGGATGCACCGGGGAGGTGG - Intergenic
1174486680 20:50865737-50865759 GCTGGGCTGGACTGGGCAGGAGG + Intronic
1175552728 20:59827593-59827615 GACTGGCTGCACCCAGGAGGTGG + Intronic
1175917024 20:62430698-62430720 GCCAGGCTGCACTGGGCAGGAGG + Intergenic
1176169464 20:63690447-63690469 GACGGGCAGCGCTGGGTGGGCGG + Intronic
1176172280 20:63701396-63701418 GAGGGGCTGCCCTGGGGGTGGGG + Intronic
1178392474 21:32210548-32210570 GATGGGGGGCAATGGGGAGGAGG - Intergenic
1178948491 21:36966895-36966917 GAGGGGCAGCGCTGGGGCGGGGG + Intronic
1179080946 21:38170226-38170248 GAAATGCTGCAGTGGGGAGGTGG - Intronic
1179799409 21:43803899-43803921 GAAGGGCGGCACTGGAGAGATGG + Exonic
1179947637 21:44688837-44688859 GGAGGGCTGCAGTGGAGAGGGGG + Intronic
1180129999 21:45821207-45821229 GAGAGGCTGCACAGGAGAGGGGG - Intronic
1180871656 22:19150149-19150171 GGCGGGCTGCGGTGGGCAGGCGG + Exonic
1181033915 22:20160932-20160954 GCTGGGCTGCACCAGGGAGGAGG + Intergenic
1181269874 22:21652724-21652746 GACGGGCCACGCAGGGGAGGGGG - Intronic
1181312056 22:21950215-21950237 GAGGGGCTGCCCTAGGGTGGGGG - Intronic
1181534343 22:23533976-23533998 GAAGGGCAGGGCTGGGGAGGAGG + Intergenic
1181935627 22:26436417-26436439 GACGGGGTGCCCTGGGGAGGTGG + Intronic
1181979660 22:26757059-26757081 GACGGACTGGACGGAGGAGGAGG - Intergenic
1182039696 22:27227304-27227326 GATGGCATGAACTGGGGAGGCGG - Intergenic
1182254817 22:29030776-29030798 GACGGGTGGGAGTGGGGAGGAGG + Intronic
1182273409 22:29170027-29170049 GACAGGCTGAGCTGGGGAGAAGG + Intergenic
1182296032 22:29311643-29311665 GACTGGCTGCGCAGGGCAGGAGG - Intronic
1182660811 22:31923954-31923976 GACGGGCTGCCATGTGGAAGAGG + Intergenic
1183310472 22:37106919-37106941 CAAGGGCTGCCCAGGGGAGGGGG - Intronic
1183351246 22:37335982-37336004 GAGGGGCTGCAGGGAGGAGGAGG - Intergenic
1183649987 22:39148271-39148293 GACGAGCTGCAGTGGGCAGATGG + Intronic
1183830467 22:40416126-40416148 GATGGGGTGAGCTGGGGAGGGGG - Intronic
1184409438 22:44318071-44318093 GATGGGCTGGACTGGGTCGGGGG - Intergenic
1184720460 22:46309556-46309578 TACGTGCTGCCCAGGGGAGGGGG - Intronic
1185222545 22:49636259-49636281 GGTGGGCCGCCCTGGGGAGGGGG + Intronic
1185324663 22:50219815-50219837 GACAGCGTGCAGTGGGGAGGTGG - Intronic
950418024 3:12879691-12879713 GCCCTGCTCCACTGGGGAGGGGG + Intergenic
950529187 3:13543288-13543310 GGCTGGCTGCAGTGGGGAAGGGG + Intergenic
950702801 3:14761720-14761742 GAAGGGATGGAGTGGGGAGGGGG + Intronic
950872364 3:16240825-16240847 GTCAGGCTGTGCTGGGGAGGCGG - Intergenic
952408561 3:33026647-33026669 TATGGGCTTCAGTGGGGAGGAGG - Intronic
952750411 3:36820608-36820630 GATGGGCTGCAATGGGGAACAGG - Intergenic
952876610 3:37950077-37950099 GAGGGGCTGCCCTGGTGAGCTGG + Intronic
953705268 3:45225974-45225996 GACGGGCGGCAGCGGGCAGGCGG + Exonic
953880220 3:46687526-46687548 CACCTGCTGCTCTGGGGAGGGGG + Intronic
954077262 3:48190019-48190041 GAATGGCTGAACTCGGGAGGCGG + Intergenic
954699121 3:52442386-52442408 GGCGGTCAGCTCTGGGGAGGGGG + Intronic
954752998 3:52824142-52824164 GACGTGCTGCACAGGGGAGGCGG - Intronic
954861635 3:53695444-53695466 GACGGGCTGGGCGGGGCAGGAGG - Intronic
956272782 3:67465567-67465589 GACTGGCTGCACTGGGGGCAAGG + Intronic
956804311 3:72793418-72793440 AACGGCGTGAACTGGGGAGGTGG + Intronic
961350723 3:126300364-126300386 GACGCGCTGCACAGGGCAGATGG - Intergenic
961435007 3:126910924-126910946 GACGGGGTGCACAGAGGAGTAGG + Intronic
962411224 3:135143299-135143321 GGTGGGCTGCTCTGAGGAGGAGG + Intronic
962443812 3:135447677-135447699 CAGGGGCTGCACAGGGGAAGTGG - Intergenic
963127108 3:141826483-141826505 AACGGGCTGAACCCGGGAGGCGG + Intergenic
963299110 3:143579209-143579231 GAAGGGTTACACTGGAGAGGAGG - Intronic
963643887 3:147889815-147889837 GTCAGGCAGCACTGGGGAAGGGG - Intergenic
965779761 3:172272476-172272498 GATGGGCTGTAGTGGGGAGAAGG + Intronic
966869977 3:184284047-184284069 GACTGGCTGCCTTGGGGAGATGG - Intronic
967894352 3:194384389-194384411 GAGGGGATGCCCTGGGCAGGGGG + Intergenic
968425540 4:520551-520573 GCCAGTCTGCACTGGGGAAGTGG + Intronic
968555483 4:1244605-1244627 TAGGGGCTGCTGTGGGGAGGGGG - Intronic
968647906 4:1749236-1749258 GAGGGGGCGCAGTGGGGAGGGGG - Intergenic
968647913 4:1749252-1749274 GAGGGGGTGCATTGGGGAGGGGG - Intergenic
968647927 4:1749284-1749306 GAGGGGGGGCAGTGGGGAGGGGG - Intergenic
968647937 4:1749300-1749322 GAGGGGGTGCCTTGGGGAGGGGG - Intergenic
968727866 4:2256603-2256625 GACCCCCTGCACTGGGGTGGGGG + Intronic
968760976 4:2442728-2442750 GGTGGGCTGCCGTGGGGAGGGGG - Intronic
968834012 4:2949620-2949642 GAGGGGCAGGGCTGGGGAGGTGG - Intronic
968997746 4:3956024-3956046 TGCGGGCTGCACTCAGGAGGCGG + Intergenic
969013261 4:4084773-4084795 AACGGGATGCACTGGGGACATGG - Intergenic
969710486 4:8840485-8840507 GAGGGGCTGCAAAGGGGATGGGG - Intergenic
969740588 4:9023034-9023056 AACGGGATGCACTGGGGACATGG + Intergenic
971618823 4:28828337-28828359 GATGGGGCGCAGTGGGGAGGGGG - Intergenic
972553097 4:40151356-40151378 GATGGGTTGCACCTGGGAGGTGG - Intronic
975576141 4:75864659-75864681 GATGGGCTGAACTGGGTAGAGGG - Intronic
975621893 4:76305007-76305029 GAAGGGCTGGGCAGGGGAGGGGG + Intronic
979546901 4:121950392-121950414 GACCGGCTGAGCCGGGGAGGTGG - Intronic
980974309 4:139596367-139596389 GACAGGCTTCTCTGGGGTGGGGG + Intronic
981043784 4:140247468-140247490 TTTGGGCTGCAGTGGGGAGGTGG - Intergenic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
982209761 4:153024928-153024950 TAGGGGGTGCGCTGGGGAGGGGG - Intergenic
984263045 4:177464941-177464963 AACGGCTTGAACTGGGGAGGCGG - Intergenic
984688895 4:182702822-182702844 GAATGGCTGCACCCGGGAGGTGG - Intronic
985924496 5:3005157-3005179 GACGATCTGCAATGGGGAGGAGG + Intergenic
987299896 5:16588030-16588052 GACTGGGAGCAGTGGGGAGGGGG - Intronic
989682576 5:44046602-44046624 GGTGTGCTGCACTGGGGTGGGGG + Intergenic
989779483 5:45247110-45247132 CACGGGCAGCAGTGTGGAGGTGG + Intergenic
990446239 5:55896695-55896717 GAGGGGAGGGACTGGGGAGGGGG - Intronic
991481928 5:67090307-67090329 GACGGGAAGAAGTGGGGAGGGGG - Intronic
995243788 5:109914898-109914920 GAAGGGCTGGACTTGTGAGGTGG - Intergenic
995858238 5:116615760-116615782 GGCGGGCAGCAGTGGGGTGGCGG + Intergenic
996397884 5:123031736-123031758 AATGGCCTGCACTGGGGTGGTGG + Intronic
997990740 5:138542929-138542951 GCCGGGCCGCTCTAGGGAGGAGG - Exonic
999272105 5:150302637-150302659 GCCGGGCTGAGCTGGGGAAGAGG - Exonic
999806681 5:155087719-155087741 GACAGGCTTCTCTGAGGAGGGGG + Intergenic
1001155325 5:169267894-169267916 GACTGGTTGGACTTGGGAGGTGG - Intronic
1001275527 5:170348236-170348258 TACAGGCTGAACAGGGGAGGGGG - Intergenic
1002069346 5:176670150-176670172 GAAGGGCTGCAGTGGGGCTGGGG - Intergenic
1002928733 6:1619648-1619670 GCGGGGCTGCACCGGGGCGGGGG - Intergenic
1003626426 6:7745677-7745699 TACTGGCTGCAGTAGGGAGGGGG + Intronic
1003862066 6:10331403-10331425 GGCGGGGTGCAGTGGGAAGGTGG + Intergenic
1003995603 6:11537506-11537528 GACGGCCCGCAGTGGGGCGGAGG - Intergenic
1005962543 6:30704296-30704318 GACAGGCTGGTCTGTGGAGGTGG + Exonic
1005962626 6:30704665-30704687 GACAGGCTGGTCTGTGGAGGCGG + Exonic
1005962701 6:30705034-30705056 GACAGGCTGCTCTGTGGAGGTGG + Exonic
1005962776 6:30705403-30705425 GACAGGCTGGTCTGTGGAGGTGG + Exonic
1005962825 6:30705649-30705671 GACAGGCTGGTCTGTGGAGGTGG + Exonic
1005962853 6:30705772-30705794 GACTGGCTGGGCTGTGGAGGTGG + Exonic
1005992565 6:30912490-30912512 GACAGGCTGCACTTGGGCTGCGG + Intronic
1006369417 6:33634670-33634692 GAGGGGCTGAGCTGGAGAGGCGG + Intronic
1007615787 6:43179276-43179298 GACGGGCCGCAGGAGGGAGGCGG + Exonic
1007733898 6:43968519-43968541 GTCAGGCTGGCCTGGGGAGGGGG - Intergenic
1011497243 6:87949025-87949047 GACGGTCTTCATTGGGAAGGAGG - Intergenic
1012142680 6:95643165-95643187 GGTGTGCTGCACTGGGGAGAGGG - Intergenic
1012733025 6:102905477-102905499 GACCGCTTGAACTGGGGAGGCGG + Intergenic
1013374480 6:109501282-109501304 GCCTGCCTGTACTGGGGAGGAGG + Intronic
1013998588 6:116339119-116339141 GACGGACAGGACTGGGGTGGAGG - Intronic
1015184170 6:130394507-130394529 CACAGTCTGCTCTGGGGAGGTGG + Intronic
1015843865 6:137497831-137497853 GGCGGGCTGCGCCGCGGAGGCGG + Intergenic
1017951332 6:159137417-159137439 GGCGGGCTGCAAAGGGCAGGGGG + Intergenic
1018030011 6:159834316-159834338 GGGGGGCGGCAGTGGGGAGGAGG - Intergenic
1019004456 6:168784573-168784595 GAAGGCGTGCACTGGAGAGGCGG - Intergenic
1019135410 6:169904741-169904763 GAAGAGGTGCACTGAGGAGGAGG - Intergenic
1019338484 7:496179-496201 GAAGGGCTGCAGTGTGGCGGGGG - Intergenic
1019409073 7:898798-898820 GCCGGGCTGCCCTGAGGAGCAGG + Exonic
1019738627 7:2662267-2662289 GGCGGGCTGCACAGGCGAGGAGG - Exonic
1020105363 7:5420190-5420212 GACGGGCTGCCCAGGCGCGGTGG - Intronic
1021840311 7:24717069-24717091 CATGGGCTGCACTGGGGGAGGGG - Intronic
1024653167 7:51426091-51426113 AACCGGCTGCACCGGGGTGGAGG - Intergenic
1026341914 7:69441588-69441610 AACGGCCTGAACCGGGGAGGCGG + Intergenic
1026539598 7:71268462-71268484 GATGGCTTGAACTGGGGAGGTGG + Intronic
1028164308 7:87520359-87520381 GAAGGTCTGCACTGGAGAAGGGG + Intronic
1029519548 7:101051502-101051524 GGTGGGCTGCGATGGGGAGGTGG - Intronic
1029602994 7:101580725-101580747 CACGGGCTGCCCTGTGGAGGCGG + Intergenic
1032238085 7:130141523-130141545 GCCGGACGGAACTGGGGAGGGGG + Intergenic
1034435575 7:151061358-151061380 GCCGGCCTGTACTGGGGAGGGGG + Intronic
1034490710 7:151391831-151391853 GAGGGGCGGGGCTGGGGAGGAGG - Intronic
1034901388 7:154909979-154910001 GAGGGGCTGGGCTGGGGTGGAGG + Intergenic
1035319593 7:158020153-158020175 AACGGGCAGCACTGGGGCTGGGG - Intronic
1035573325 8:688255-688277 GACGGGCGGAACTGGGGGCGGGG - Intronic
1035609983 8:955417-955439 GGCAGGCAGCAGTGGGGAGGAGG - Intergenic
1036090523 8:5660394-5660416 GATTGGCTGCAATGGAGAGGTGG - Intergenic
1036723760 8:11201227-11201249 GACGGGGAGCCCGGGGGAGGCGG - Exonic
1036888476 8:12578431-12578453 AACGGGATGCACTGGGGACATGG - Intergenic
1039550482 8:38439648-38439670 TATTGGCTCCACTGGGGAGGTGG - Intronic
1039847742 8:41337623-41337645 GAGGGGCTGCACTGAGGGGAGGG - Intergenic
1039895820 8:41715717-41715739 CACGGGCTGCAATGTGCAGGGGG + Exonic
1039900947 8:41752159-41752181 GATGGGAGACACTGGGGAGGAGG - Intronic
1043303349 8:78762469-78762491 GGCGGACTGCCCTGAGGAGGCGG - Intronic
1044533730 8:93337001-93337023 GGTGGGCTGCCCTAGGGAGGAGG - Intergenic
1044597707 8:93974538-93974560 GAAAGGCTGCTCTGGTGAGGCGG - Intergenic
1045008179 8:97934118-97934140 GCCAGGCTGGACTGTGGAGGTGG - Intronic
1045432212 8:102124392-102124414 GCGGGGCTGCAGTGGAGAGGGGG - Intronic
1046691597 8:117291724-117291746 GATGTGATGCACTGTGGAGGAGG + Intergenic
1048176338 8:132155810-132155832 GACTGGCTACTCTGGGGAAGGGG + Intronic
1049049433 8:140182858-140182880 GAAAGGCTGCACTGGGAAGCTGG - Intronic
1049286988 8:141781151-141781173 GCTGGGCTGCCCTGGGGATGTGG - Intergenic
1049355588 8:142186651-142186673 GTAGGGCTGGCCTGGGGAGGAGG - Intergenic
1049541550 8:143211348-143211370 GAGGCGGTGCACGGGGGAGGCGG + Intergenic
1049584722 8:143427640-143427662 GACTGGGAGCACAGGGGAGGAGG - Intronic
1049658027 8:143807380-143807402 GACGGGCTGCCCCAGGCAGGAGG + Intronic
1049801105 8:144517895-144517917 GACTGGCTGCCCAGGGGCGGTGG - Intergenic
1052272551 9:26641611-26641633 GACGGCCTGATGTGGGGAGGAGG + Intergenic
1053489338 9:38487636-38487658 GACTGGCTGCGCGGGGCAGGGGG + Intergenic
1054179779 9:61900567-61900589 GAAGGACTGCACTGGGGGTGAGG + Intergenic
1054847250 9:69810199-69810221 GAGGCTCGGCACTGGGGAGGAGG + Intergenic
1055126969 9:72730264-72730286 TACGGCCTGCCCTGGGGAAGGGG + Intronic
1056547723 9:87626956-87626978 GAGGGCCAGTACTGGGGAGGAGG + Intronic
1057062701 9:92019830-92019852 GAGGCCCTGCACTGAGGAGGGGG + Intergenic
1057187588 9:93065578-93065600 GCCTGGCGGCCCTGGGGAGGGGG + Intronic
1057191115 9:93088175-93088197 GAGGGGCTGCACTGGGCAGGGGG + Intergenic
1057280307 9:93706231-93706253 GACGTGCTGCACAAGGGAGGGGG + Intergenic
1057565647 9:96164101-96164123 GAGGGGCTGGGGTGGGGAGGGGG - Intergenic
1057600664 9:96454535-96454557 GAATGGCTGAACTCGGGAGGTGG - Intronic
1057669686 9:97076956-97076978 GACTGGCTGCGCGGGGCAGGGGG + Intergenic
1057980017 9:99650925-99650947 GAACTGCTGCACTGGGGAAGCGG - Intergenic
1058885581 9:109319845-109319867 GACCGTGTGTACTGGGGAGGGGG + Intronic
1059749348 9:117233185-117233207 GAGGGGCTGCAACTGGGAGGAGG + Intronic
1059801053 9:117749989-117750011 GGAAGGCTGCACTGGGGAGGGGG - Intergenic
1060104658 9:120866144-120866166 AAGGGGCTGGACTGGGGTGGGGG - Intronic
1061246086 9:129401851-129401873 GAAGGGCAGGGCTGGGGAGGAGG - Intergenic
1061258800 9:129467836-129467858 CTGGGGCTGCACTGAGGAGGTGG - Intergenic
1061710878 9:132486944-132486966 GCCGGGCTGCCCCGGGGAGCGGG + Intronic
1061819703 9:133220295-133220317 GAGAGGCTTCTCTGGGGAGGTGG - Intergenic
1062185797 9:135217825-135217847 GCCGGGCTGCCCTGGGCAGATGG + Intergenic
1062240938 9:135537587-135537609 GAGAGGCTTCTCTGGGGAGGTGG + Intergenic
1062280261 9:135748757-135748779 CTCGCGCTGCACTGGGCAGGGGG + Intronic
1062361053 9:136188308-136188330 GAGGGGCTGAACTGGGAGGGTGG + Intergenic
1062381301 9:136288131-136288153 GAGGGGCTGCCCTTGGGAAGGGG + Intronic
1062682242 9:137788152-137788174 TACGGGGTGCAGTGGGGAGAAGG - Intronic
1185525706 X:777144-777166 CAAGAGCTGCCCTGGGGAGGTGG - Intergenic
1185550524 X:980189-980211 CACGGGCTGCAAGGGGGAGGAGG + Intergenic
1186393236 X:9182005-9182027 GACGGGTTGCAGTGGCCAGGTGG - Intergenic
1189314044 X:40041239-40041261 GGAAGGCTGCTCTGGGGAGGTGG - Intergenic
1192212512 X:69136935-69136957 GCCGGGCTGGCCTGGGGATGGGG - Intergenic
1192780830 X:74292616-74292638 GACGGGCTCCAGTGGGGCGGGGG - Intergenic
1193087321 X:77458416-77458438 CAGGGGCTGCTCTGGGGAAGAGG - Intergenic
1195410739 X:104566180-104566202 GACTGATTGCACCGGGGAGGAGG - Intergenic
1196833050 X:119791355-119791377 GACGGGCTGCGCTGCGGCCGCGG - Intronic
1199980617 X:152918510-152918532 GCCTGGCTGCACTGGGCTGGGGG + Intronic
1200173830 X:154097860-154097882 GACGGGGAGGACGGGGGAGGGGG + Intergenic