ID: 1133025036

View in Genome Browser
Species Human (GRCh38)
Location 16:2985450-2985472
Sequence AAGGCAACTCACACCAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133025036_1133025045 17 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025045 16:2985490-2985512 ATACTGGAGGCTCCGATGCTTGG No data
1133025036_1133025042 1 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025042 16:2985474-2985496 GGATGCCTAGGAAGGTATACTGG No data
1133025036_1133025043 4 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025043 16:2985477-2985499 TGCCTAGGAAGGTATACTGGAGG No data
1133025036_1133025040 -7 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025040 16:2985466-2985488 TTGCCTTGGGATGCCTAGGAAGG No data
1133025036_1133025047 23 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data
1133025036_1133025046 18 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025046 16:2985491-2985513 TACTGGAGGCTCCGATGCTTGGG No data
1133025036_1133025048 24 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025048 16:2985497-2985519 AGGCTCCGATGCTTGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133025036 Original CRISPR AAGGCAACTCACACCAGCAA AGG (reversed) Intergenic
No off target data available for this crispr