ID: 1133025041

View in Genome Browser
Species Human (GRCh38)
Location 16:2985469-2985491
Sequence ATACCTTCCTAGGCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133025041_1133025046 -1 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025046 16:2985491-2985513 TACTGGAGGCTCCGATGCTTGGG No data
1133025041_1133025045 -2 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025045 16:2985490-2985512 ATACTGGAGGCTCCGATGCTTGG No data
1133025041_1133025047 4 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data
1133025041_1133025050 30 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025050 16:2985522-2985544 GAAGAGCTGCCCAAACAGAGTGG No data
1133025041_1133025048 5 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025048 16:2985497-2985519 AGGCTCCGATGCTTGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133025041 Original CRISPR ATACCTTCCTAGGCATCCCA AGG (reversed) Intergenic
No off target data available for this crispr