ID: 1133025043

View in Genome Browser
Species Human (GRCh38)
Location 16:2985477-2985499
Sequence TGCCTAGGAAGGTATACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133025036_1133025043 4 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025043 16:2985477-2985499 TGCCTAGGAAGGTATACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133025043 Original CRISPR TGCCTAGGAAGGTATACTGG AGG Intergenic
No off target data available for this crispr