ID: 1133025044

View in Genome Browser
Species Human (GRCh38)
Location 16:2985479-2985501
Sequence AGCCTCCAGTATACCTTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133025044_1133025048 -5 Left 1133025044 16:2985479-2985501 CCTAGGAAGGTATACTGGAGGCT No data
Right 1133025048 16:2985497-2985519 AGGCTCCGATGCTTGGGTTTGGG No data
1133025044_1133025051 28 Left 1133025044 16:2985479-2985501 CCTAGGAAGGTATACTGGAGGCT No data
Right 1133025051 16:2985530-2985552 GCCCAAACAGAGTGGCCTGCAGG No data
1133025044_1133025050 20 Left 1133025044 16:2985479-2985501 CCTAGGAAGGTATACTGGAGGCT No data
Right 1133025050 16:2985522-2985544 GAAGAGCTGCCCAAACAGAGTGG No data
1133025044_1133025047 -6 Left 1133025044 16:2985479-2985501 CCTAGGAAGGTATACTGGAGGCT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133025044 Original CRISPR AGCCTCCAGTATACCTTCCT AGG (reversed) Intergenic
No off target data available for this crispr