ID: 1133025047

View in Genome Browser
Species Human (GRCh38)
Location 16:2985496-2985518
Sequence GAGGCTCCGATGCTTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133025041_1133025047 4 Left 1133025041 16:2985469-2985491 CCTTGGGATGCCTAGGAAGGTAT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data
1133025036_1133025047 23 Left 1133025036 16:2985450-2985472 CCTTTGCTGGTGTGAGTTGCCTT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data
1133025044_1133025047 -6 Left 1133025044 16:2985479-2985501 CCTAGGAAGGTATACTGGAGGCT No data
Right 1133025047 16:2985496-2985518 GAGGCTCCGATGCTTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133025047 Original CRISPR GAGGCTCCGATGCTTGGGTT TGG Intergenic
No off target data available for this crispr