ID: 1133026000

View in Genome Browser
Species Human (GRCh38)
Location 16:2989242-2989264
Sequence CTAGGGCAGTGGAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133026000_1133026013 25 Left 1133026000 16:2989242-2989264 CCCTCTAGCCTCCACTGCCCTAG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1133026013 16:2989290-2989312 CTCTACCCTCCTGTGACAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 166
1133026000_1133026014 26 Left 1133026000 16:2989242-2989264 CCCTCTAGCCTCCACTGCCCTAG 0: 1
1: 0
2: 0
3: 18
4: 222
Right 1133026014 16:2989291-2989313 TCTACCCTCCTGTGACAGCAGGG 0: 1
1: 0
2: 3
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133026000 Original CRISPR CTAGGGCAGTGGAGGCTAGA GGG (reversed) Intergenic
900176121 1:1292167-1292189 CTAGGACAGAGAAGGGTAGAAGG + Intergenic
901679263 1:10903760-10903782 CCAAGGCAGTGCAGGCCAGAAGG + Intergenic
903862538 1:26373488-26373510 CCAGGGCAGTGAAGGAAAGAAGG + Intronic
904259777 1:29281658-29281680 CTGGGGCAATGGAGGCTGAAAGG + Intronic
904314637 1:29652252-29652274 CTAGGGCAGGGGAGGCTTCAGGG + Intergenic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905090485 1:35427275-35427297 GGAGGGCAGTGGAGACTGGAAGG + Intergenic
906212039 1:44017412-44017434 CTGGGGCAGAGCAGGCGAGAGGG + Intronic
906868485 1:49449496-49449518 ATAGGGCAGAGGAGGCAGGAAGG + Intronic
907657820 1:56362318-56362340 TTAGGGAGGTGGAGGCCAGATGG - Intergenic
907675011 1:56510127-56510149 TTAGGGCAGTGGCGCCAAGAAGG + Intronic
908390514 1:63679428-63679450 CAAGGGCAGTGGAAGTTGGAAGG - Intergenic
911359511 1:96859344-96859366 CTTGGGCAGAGGAGCCAAGATGG - Intergenic
912239859 1:107894985-107895007 CTTTGGCAGTGGAGGTGAGAGGG - Intronic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
912848557 1:113101026-113101048 CTAGGGGATTGGAGGTTAGTTGG + Intronic
914917899 1:151829604-151829626 CAAGGGCAGAGGAGGAGAGAGGG - Intronic
915131390 1:153697843-153697865 CTGGGGCATGGGAGGCTACAGGG - Intergenic
915557899 1:156670284-156670306 CCAGGGGAGTGGAGTCTGGAAGG + Exonic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
918932552 1:190873476-190873498 CTAGGGAAATGGAGGTTACAGGG + Intergenic
918955229 1:191199023-191199045 CTGGAGCCGGGGAGGCTAGATGG + Intergenic
919597495 1:199581711-199581733 TTAGGTCAGTGTAGGGTAGAAGG + Intergenic
920542366 1:206788768-206788790 CTAAGGCAGTGCAGGCAGGATGG + Intergenic
922111779 1:222565784-222565806 CCAGGGAGGTGGAGGCTACAGGG + Intronic
922466663 1:225849313-225849335 CCAGGGCACTGGAGACTGGAGGG - Intronic
923385964 1:233465627-233465649 CTTGGGAAGTGGAGCCTAGTGGG + Intergenic
1063595057 10:7427529-7427551 CTAGGGCAGCTGAGGCAGGAGGG - Intergenic
1065170361 10:23020967-23020989 CTAGGGCACTGGGGGCTACCAGG - Intronic
1066160651 10:32724054-32724076 CTAGGGAATTGGAAGCTAAAAGG + Intronic
1067848421 10:49740332-49740354 GCAGGGCAGAGGAGGCAAGATGG + Intronic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069856152 10:71442397-71442419 CTAGGTCAGGGGTGTCTAGAGGG - Intronic
1071466414 10:85944060-85944082 CTAGGGCAATGGAGGCCAGTGGG - Intronic
1071847426 10:89535339-89535361 CTAGGGCAGCGGAGAATGGAGGG + Intronic
1072107586 10:92289431-92289453 CTTGGGAAGCTGAGGCTAGAAGG + Intronic
1072161756 10:92773736-92773758 GTAGGGGAGTGGAGGATAGAAGG - Intergenic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1073719683 10:106153316-106153338 ATAGGGCAGTGGTGGCTATATGG + Intergenic
1076599658 10:131648956-131648978 CAAGGGCATTGGAGGCAGGAAGG - Intergenic
1076725515 10:132411181-132411203 CCAGGTCTGTGGAGGCAAGAGGG - Intronic
1077282551 11:1752287-1752309 CTAGGGCCTGGGAGGCAAGAAGG + Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078551240 11:12281768-12281790 CTTGGGCAGTGGTGGCTGGAGGG - Intronic
1078867310 11:15310026-15310048 GAAGGGCAGTGGAGGTGAGATGG + Intergenic
1078878722 11:15425902-15425924 CTAGGACACTGGAGACCAGAGGG - Intergenic
1080569148 11:33540733-33540755 GTGGGCCAGTGGAGGCCAGAGGG + Intergenic
1081775965 11:45676109-45676131 CTTGGGCAGTGGAGGAGGGAGGG - Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1083160632 11:60852145-60852167 CTAGGGCAGTGGAGTCGGAAGGG - Exonic
1085409374 11:76282278-76282300 CGATGGGAGTGGAGGCTGGATGG + Intergenic
1086497330 11:87418111-87418133 ATGGGGCAGGGGAGGCAAGAAGG + Intergenic
1089060169 11:115619908-115619930 CTGCGGCAGTGGAGGCTTAAGGG + Intergenic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089943366 11:122442135-122442157 CCATGGCAGCGGAGGCTATAGGG - Intergenic
1090707338 11:129350639-129350661 CAAGGGCAGAGGAAGATAGATGG - Intergenic
1090814304 11:130277941-130277963 TTATAGCAGTGGAGGCCAGAAGG - Intronic
1091161569 11:133426566-133426588 CTGGGGCAGAGGAGGAGAGAGGG - Intronic
1091628642 12:2141535-2141557 CTAGGGAAATGAAGGCTGGATGG - Intronic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095854445 12:46844625-46844647 GTAGGGCAGAGGAGGGAAGATGG + Intergenic
1096809592 12:54161055-54161077 CAAGGACAGTGGAGGCTGGTGGG - Intergenic
1098001673 12:65950553-65950575 CTAGGGACGTGGAGGGTAGTGGG + Intronic
1099529615 12:83761855-83761877 CTATGGCAGTGCAGGCTAGGCGG + Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1101656886 12:106730286-106730308 ATAAGGTAGTGGAGGCTAGTTGG - Intronic
1101959135 12:109235082-109235104 CTAGGGCTGTGGTGGGGAGAGGG - Intronic
1102969055 12:117151726-117151748 CAAGGGCAGGGGAGGAGAGAGGG + Intronic
1105432176 13:20346339-20346361 CGAGGGCAGTAGAGGCAGGAAGG - Intergenic
1109128411 13:58547989-58548011 CTAGAGCAAGGGAGTCTAGAAGG - Intergenic
1111531057 13:89538467-89538489 CTAGGGAAGGGGAGGCTCAAGGG - Intergenic
1111702972 13:91713946-91713968 ATAGGGCAGTGGAGGAGAGAGGG - Intronic
1111766711 13:92539704-92539726 CTGGGGCAAAGGAGGCTATAAGG - Intronic
1112197864 13:97243076-97243098 CTTGGGCAGTGGGGGATATATGG - Intronic
1115392411 14:32867959-32867981 GCAGGGCAGTGCAGGGTAGATGG - Intergenic
1116222742 14:42110443-42110465 CTAGGGGATAGGAGGCAAGATGG + Intergenic
1117483225 14:56169284-56169306 GGAGGGCAGTCGAGGCCAGAAGG - Intronic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118796791 14:69152077-69152099 CGAGGGCTGTGGAGGCTAAAGGG - Intronic
1119427278 14:74543953-74543975 CTGGGGCAGGGGTGGCTAGGTGG - Intronic
1122505123 14:102227275-102227297 GTAGGGGAGTGGTGGCTAGGAGG - Intronic
1124022833 15:25939617-25939639 CAGGGGCAGTGGGGGTTAGATGG + Intergenic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1125714848 15:41813702-41813724 CTAAGGAAGTGCAGGTTAGAGGG - Exonic
1126107398 15:45155705-45155727 CTTGGGCAGTGGAGTGGAGAGGG + Intronic
1126125524 15:45292137-45292159 CTTGGCCAGTGGAGGCAGGATGG - Intergenic
1126979783 15:54228119-54228141 CTAGGGCAGTGGTGACTATGGGG - Intronic
1129002467 15:72346143-72346165 CTAGTCCAGAGGTGGCTAGATGG + Intronic
1129377907 15:75145614-75145636 CCAGGGCAGTGGACTCTAGGGGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132181012 15:99752872-99752894 CTAGGGCAGTGGGTGCCAGGGGG + Intergenic
1133026000 16:2989242-2989264 CTAGGGCAGTGGAGGCTAGAGGG - Intergenic
1134297778 16:12962079-12962101 CCAGGCCAGTGCAGGCAAGACGG - Intronic
1136316186 16:29455758-29455780 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1136395518 16:29990717-29990739 CTGGGGCAGGGGAGGATAGTGGG + Intronic
1136430763 16:30195100-30195122 CTGGGGCGGTGGAGGCCCGAAGG - Exonic
1137447795 16:48542420-48542442 TGAGGGCAGAGGAGGCTGGAAGG + Exonic
1138806786 16:60099867-60099889 CTGGGGCAGTGGTGGCCACAGGG - Intergenic
1139672032 16:68498632-68498654 CCAGGGGAGTAGAAGCTAGAAGG + Intergenic
1139955442 16:70690877-70690899 CCAGGGCATTGAAGGCTAGGGGG + Intronic
1140176757 16:72668507-72668529 CTAGGGCAGTAGATTCTAAATGG - Intergenic
1141029172 16:80572870-80572892 CTAGAGAAGTGGGGGCAAGAGGG - Intergenic
1141169173 16:81680480-81680502 CCAGGGCAGAGGAGGCTATGTGG - Intronic
1141860148 16:86710872-86710894 GTGGGGCAGAGGAGGCTGGAGGG + Intergenic
1142406634 16:89893895-89893917 CCAGGGCAGTGGTGGCTACATGG - Intronic
1143582429 17:7834910-7834932 CTAGGGATGAGGAGGCTAGCGGG - Intergenic
1147850692 17:43440333-43440355 CTAGAGCAGAAGAGGCCAGAAGG + Intergenic
1148896517 17:50842224-50842246 ATAGGGCAGAGGAGGGTAGTGGG - Exonic
1150871074 17:68911317-68911339 CTGGGGCAGTGGTGACTAGGGGG + Intronic
1151109919 17:71664087-71664109 CTATGTCAGAGGAGGCTAAAAGG - Intergenic
1151370687 17:73644724-73644746 CGAGGGCGGTGGAGCCCAGAGGG - Intergenic
1155173037 18:23281112-23281134 CTAGGTCAGTGGAGGGGAGGAGG + Intronic
1157286141 18:46378732-46378754 CTAGGGCAGAGGGTGCAAGAGGG + Intronic
1157965734 18:52206182-52206204 CAAGGGCAGTGGAGGTCACAGGG + Intergenic
1161537156 19:4826961-4826983 CTAGAGAAGTGGAGGATAAAAGG + Intronic
1164972891 19:32547702-32547724 CTAGGGCAGAGTAGGGGAGATGG - Intergenic
1166529429 19:43533800-43533822 ATGGGGCCGTGGAGGATAGAGGG - Exonic
1166756035 19:45192186-45192208 CTGGGGCAGTGGTGGCCACAGGG - Intronic
1166810579 19:45512026-45512048 CTCGGGAAGTGGAGGCTGGGAGG + Intronic
1168653776 19:58112108-58112130 CCAGGGCAGTCGAGGCTTCAGGG - Intronic
926590042 2:14730894-14730916 CTAGGGCACATGAGGCTAGTGGG - Intergenic
927404038 2:22747548-22747570 GGAGGGCAGTGGGGACTAGAGGG - Intergenic
927923126 2:26989252-26989274 CTAGGGCTTTGGAGCCTAGCGGG - Intronic
929037632 2:37709657-37709679 CTAGGGCAGTTGGGGCAGGAAGG - Intronic
930289891 2:49480872-49480894 CTAGGAGAGTGGAGCCAAGATGG + Intergenic
933467469 2:82673000-82673022 CTAGAGCTGAGGAGACTAGAAGG + Intergenic
933766701 2:85714143-85714165 CTGGGACAGAGGAGGCTACAAGG + Intergenic
934891912 2:98078096-98078118 CTAGGGCAGTTGAGGCAGGGGGG - Intergenic
936151730 2:110025528-110025550 CCAGGGCAGTAGTGGCCAGAGGG + Intergenic
936192944 2:110345841-110345863 CCAGGGCAGTAGTGGCCAGAGGG - Intergenic
937685670 2:124693680-124693702 GTAGGGCAGTGGAGCCCAGTAGG - Intronic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940539675 2:154995997-154996019 CAAGGGTAGGGGAAGCTAGAGGG + Intergenic
942117591 2:172743362-172743384 CTGGGGCAGGGGAAGCAAGAGGG - Intronic
942243401 2:173984940-173984962 CTAGGACAATGGAGGTTATAAGG - Intergenic
944133211 2:196369789-196369811 CTAGGGCAGTAGTGGCCATAGGG - Intronic
946484451 2:220087806-220087828 CTAGAGTGGTGGAGGGTAGAGGG + Intergenic
948135966 2:235636558-235636580 CTAGGGGAGTGGACGCTGGGGGG - Intronic
948838190 2:240636362-240636384 CTGGGGCATTGGAGGCTTCAGGG + Intergenic
1169075219 20:2755989-2756011 CCAGGGCAGAGGGGGCCAGAGGG - Intronic
1171772060 20:29330481-29330503 CTCGGTCAGTGGAGCCAAGAGGG + Intergenic
1171814024 20:29767696-29767718 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1173003708 20:39123841-39123863 CAAAGGCAGTGGATGCTGGAGGG + Intergenic
1175799315 20:61792125-61792147 CTAGGACAGTAGAGGCGTGAAGG + Intronic
1178611011 21:34080006-34080028 CTAGGGCAGAGAAGACTATATGG - Intronic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1180317477 22:11288298-11288320 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1181495933 22:23287513-23287535 ATAGGGCAGGGGAGCCTAGCAGG + Intronic
1182487817 22:30649759-30649781 CTATGGCAGTGGGGGCCAGTTGG - Intronic
1183030547 22:35100825-35100847 CTAAGGCAGTGGGGAGTAGACGG + Intergenic
1183276682 22:36902664-36902686 AGAAGGCAGTGGAGGGTAGAAGG - Intergenic
1184205065 22:42997013-42997035 TCAGGGAAGTGAAGGCTAGAAGG + Intronic
1184631829 22:45787478-45787500 CTTGGGAACTGGAGGCTAGAAGG - Intronic
950836039 3:15919925-15919947 TGAGGACAGTGGAGGGTAGAAGG + Intergenic
950974670 3:17227933-17227955 CTTGGGGAGTGGAGGATAGTGGG + Intronic
951273398 3:20655624-20655646 CTAGGGGTGTGGAGTCTAGCAGG - Intergenic
954937906 3:54343727-54343749 CTTGGGCTGTGGGGGGTAGAGGG - Intronic
956193707 3:66631695-66631717 CTAGGACAGTAGAGACTGGAGGG - Intergenic
959372337 3:105543185-105543207 ATAAGGCAGGGGAGGATAGATGG + Intronic
959692231 3:109210088-109210110 CTAGGTGAGAGAAGGCTAGAGGG - Intergenic
960498976 3:118412175-118412197 CTGGGGCAGTGGAGGCCATGGGG + Intergenic
960782012 3:121330290-121330312 CTAGGGCAGTGGGGAGTAGCAGG - Intronic
960877438 3:122311216-122311238 CCAGGGTAGTGCAGGCCAGATGG + Intergenic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
969280484 4:6167336-6167358 CCAGAGCAGAGGAGGCTGGAGGG - Intronic
973771817 4:54213715-54213737 CTAAGGCCCTGGAGGCAAGAAGG + Intronic
974995998 4:69160017-69160039 CTAGGGCAGTGCATGATATAAGG + Intronic
975442435 4:74426986-74427008 TAAGGGTAGTGCAGGCTAGATGG - Intergenic
977753408 4:100635796-100635818 CTAGGGTGGTGGTGGCTAAAAGG + Intronic
979466765 4:121048490-121048512 CTAGGGCAGTTGAGGATGCAGGG - Intronic
981037828 4:140190682-140190704 GCAGGGCAGTGGAGTCAAGAGGG + Intergenic
983398922 4:167238041-167238063 CTTAGGCAGTGAAGGCTAAAAGG - Intergenic
983991735 4:174128013-174128035 CAATGGCAGTGGAGGGTAAAGGG - Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
988376280 5:30439666-30439688 CTGGGGCAGTGGTGGCCACAGGG + Intergenic
988510628 5:31861703-31861725 CTAGGACTGTGGAGGCTGAAAGG + Intronic
989427858 5:41316734-41316756 CTAGGGTGGTGGTGGCTATAGGG + Intronic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
990041865 5:51386582-51386604 CCAGGGAAGTGCAGCCTAGATGG + Intronic
990395071 5:55369509-55369531 CTGGTACAGTGGAGGATAGAGGG + Intronic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
990774261 5:59287291-59287313 CTGGGGCAGTGGTGGCCACAGGG + Intronic
992837235 5:80653670-80653692 CAAGGGCAGTGGAGAAGAGAGGG - Intronic
993287120 5:86013954-86013976 AAAGGGCAGTGGGGGCTAGGGGG - Intergenic
993374373 5:87132566-87132588 TTAGGGTAGTGAAAGCTAGAAGG + Intergenic
1000133321 5:158320714-158320736 CTGAGGCAGAGGAGGCTATAGGG + Intergenic
1000309419 5:160027789-160027811 CCAGAACAGTGGAGGCCAGAAGG - Intronic
1001132278 5:169074096-169074118 CTGGGGCAGTGGTGGATGGAGGG + Intronic
1002424186 5:179166049-179166071 CTCGGGCAGTGGAGCCCAGTTGG - Intronic
1002945410 6:1756675-1756697 CTGGGGCAGTGGGGCCAAGATGG + Intronic
1003061844 6:2870080-2870102 CTTGGGCAGTGGATGCTACCAGG + Intergenic
1007299166 6:40853299-40853321 CTAGGGTGGTGGGTGCTAGATGG + Intergenic
1007377678 6:41467777-41467799 CTAGGGAGGTGGAGGCGACAGGG + Intergenic
1007933713 6:45714948-45714970 CTAGGGCAGCAGAGGCTGTAAGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1012041809 6:94215692-94215714 CTAGGAGAGTGAAGACTAGAAGG + Intergenic
1014657281 6:124123298-124123320 CTAGAGCATTGGAGGGGAGAAGG + Intronic
1016392747 6:143591627-143591649 CTAGGGCTGTGAAGGCCAAATGG + Intronic
1021451044 7:20784394-20784416 CTCGGGCAGCGGCGGCAAGAAGG - Exonic
1022198662 7:28094854-28094876 TGAGGGCAGTGGAGGAAAGAGGG - Intronic
1023598639 7:41858876-41858898 CCAGGGCAGTGGATGTTTGAAGG + Intergenic
1024562389 7:50655557-50655579 CTAGGGCAGTGGAGTGAAGTTGG - Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1034365173 7:150540071-150540093 ATAGGGCAGTGGGGATTAGAGGG - Intergenic
1035795636 8:2354149-2354171 CTGGGACAGCAGAGGCTAGATGG + Intergenic
1038780334 8:30564509-30564531 GGAGGACAGTGGTGGCTAGAGGG - Intronic
1039418997 8:37420122-37420144 CTAGAGGTGAGGAGGCTAGAGGG - Intergenic
1041606971 8:59793089-59793111 CTGGGGCAGTGGTGGCCACATGG + Intergenic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1049195360 8:141312810-141312832 CCACGGAGGTGGAGGCTAGAGGG + Intergenic
1049377656 8:142296665-142296687 CTAGGGCAGTCGAGGGCAGTGGG + Intronic
1049542899 8:143216438-143216460 CTTGGGGACTGGAGTCTAGAGGG - Intergenic
1051039111 9:12784983-12785005 CTAGGGCAGTGGTGGCCATGAGG - Intronic
1051594021 9:18805976-18805998 CTAAGGCAGTTTAGGCTAGGAGG - Intronic
1054447502 9:65384734-65384756 CCAGGGCGGTGGAGGCTTGGGGG + Intergenic
1056475795 9:86949759-86949781 ATAGGGACGTGGAGTCTAGAAGG - Intergenic
1056829748 9:89906204-89906226 CTAGTGCAGTGTAGGTTACATGG - Intergenic
1057740493 9:97707073-97707095 CCAGGGCTGAGGAGGCTTGAGGG - Intergenic
1057813894 9:98279867-98279889 TCAGGGCAGGGGAGGCAAGATGG - Intergenic
1058522753 9:105828404-105828426 CTCGGGCAGTGGTGGCCACAGGG - Intergenic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1061670370 9:132185074-132185096 CTGGGGGTGGGGAGGCTAGAGGG + Intronic
1062142839 9:134969297-134969319 CCAGGGCAGGGGAGGCTGGAAGG + Intergenic
1062549660 9:137080217-137080239 GTAGGGAAGTAGAGGCTTGAGGG + Intronic
1062615641 9:137394567-137394589 TTAGGGAAGCGGAGGCTGGAAGG - Intronic
1203365707 Un_KI270442v1:254015-254037 CTTGGTCAGTGGAGCCAAGAGGG + Intergenic
1188765784 X:34089139-34089161 TTTGGGAACTGGAGGCTAGAAGG + Intergenic
1189489178 X:41456421-41456443 CTAGGTCATTGAAGGCAAGAAGG + Intronic
1190066471 X:47244945-47244967 CGAGGGCTGGGGAGGCTGGAGGG + Intronic
1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG + Intergenic
1195480816 X:105342571-105342593 CTAGGGCAGTGTAGGATTGAAGG + Intronic
1195883022 X:109612374-109612396 CTAGGAGAGTGGAGGCAAGGTGG - Intergenic
1196059547 X:111392642-111392664 TTAGGGCTGTGGGGGATAGAGGG + Intronic
1196179168 X:112671456-112671478 ATAGGCCAGTGGAGCCTACATGG - Intronic
1197304347 X:124822533-124822555 CAAGTGCAGTGGAAGCTTGAAGG - Intronic
1199704870 X:150415237-150415259 CTTGGGCATTGGAAGTTAGAGGG - Intronic
1201671057 Y:16520518-16520540 CCTGGGAAGTGGAGGCTATAGGG + Intergenic