ID: 1133033654

View in Genome Browser
Species Human (GRCh38)
Location 16:3023189-3023211
Sequence GCCTTCTGCAGAATCACAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 188}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133033654_1133033661 6 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033661 16:3023218-3023240 AGTGGAGGAACCTACCTGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 121
1133033654_1133033663 8 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033663 16:3023220-3023242 TGGAGGAACCTACCTGAGTGGGG 0: 1
1: 0
2: 0
3: 14
4: 135
1133033654_1133033665 13 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033665 16:3023225-3023247 GAACCTACCTGAGTGGGGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 136
1133033654_1133033666 14 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033666 16:3023226-3023248 AACCTACCTGAGTGGGGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 158
1133033654_1133033669 19 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033669 16:3023231-3023253 ACCTGAGTGGGGGCAGGGCTGGG 0: 1
1: 0
2: 4
3: 58
4: 582
1133033654_1133033658 -9 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033658 16:3023203-3023225 GCAGAAGGCCTGGCCAGTGGAGG 0: 1
1: 0
2: 5
3: 45
4: 350
1133033654_1133033672 26 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033672 16:3023238-3023260 TGGGGGCAGGGCTGGGGAGAAGG 0: 1
1: 1
2: 31
3: 342
4: 2333
1133033654_1133033671 20 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033671 16:3023232-3023254 CCTGAGTGGGGGCAGGGCTGGGG 0: 1
1: 0
2: 11
3: 102
4: 920
1133033654_1133033662 7 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033662 16:3023219-3023241 GTGGAGGAACCTACCTGAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 92
1133033654_1133033668 18 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033668 16:3023230-3023252 TACCTGAGTGGGGGCAGGGCTGG 0: 1
1: 0
2: 3
3: 39
4: 401
1133033654_1133033664 9 Left 1133033654 16:3023189-3023211 CCGCCTGTGATTCTGCAGAAGGC 0: 1
1: 0
2: 2
3: 22
4: 188
Right 1133033664 16:3023221-3023243 GGAGGAACCTACCTGAGTGGGGG 0: 1
1: 0
2: 2
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133033654 Original CRISPR GCCTTCTGCAGAATCACAGG CGG (reversed) Intronic
901023851 1:6268918-6268940 GCCTTCTGCAGACCCAGAGTTGG - Intronic
904602670 1:31682467-31682489 GTGTTCTGCACAACCACAGGTGG - Intronic
905755989 1:40509291-40509313 GCCTTCTGCAGAATTGCCGATGG - Exonic
910652440 1:89584015-89584037 GCCCTCTGCAGTCTCACAGCTGG + Exonic
911554444 1:99326387-99326409 GCGGCCTGCTGAATCACAGGTGG - Intergenic
911941137 1:104049100-104049122 GCCTTCTGCAAAGTCAGAGTGGG + Intergenic
916170185 1:161995995-161996017 GCAGTCTGCAGAAACACAGCAGG + Intronic
918398362 1:184138867-184138889 GCCTTCTACAGAATGAGAAGGGG + Intergenic
918758194 1:188364648-188364670 GACATCTCCAGAATCACAGTAGG - Intergenic
919911751 1:202115388-202115410 GCCTTCATCAGAATCCCTGGAGG + Intergenic
922194564 1:223348836-223348858 GCTTTCAGCAGAATCTCAGATGG - Intronic
923096545 1:230779527-230779549 GCTTTCTTTATAATCACAGGAGG + Intronic
923282316 1:232455789-232455811 GTCTTTTGCAGCAACACAGGTGG + Intronic
923322661 1:232850711-232850733 GCCTTCTTGATAATCACAGGAGG + Intergenic
923871402 1:237997951-237997973 GCTTTCTGAAGAACCAAAGGAGG - Intergenic
1063426028 10:5950795-5950817 GCCTTCATCAAAATCAGAGGAGG - Intronic
1065109150 10:22423200-22423222 CCCTTCTCCAGAATCCTAGGGGG - Intronic
1067361856 10:45589358-45589380 GCCTCCTGGAGAATCCTAGGTGG - Intronic
1068125831 10:52840841-52840863 GCCTTCAACAGAATCACAGCAGG - Intergenic
1070665915 10:78343241-78343263 GTTATCTGCAGAATCCCAGGTGG + Intergenic
1070725561 10:78785650-78785672 ATCCTCTGCAGAATCACAGCAGG + Intergenic
1071141592 10:82515836-82515858 ACCTTCTGCAGAATGAGATGGGG + Intronic
1071859779 10:89660599-89660621 TCATTCTGCAGAATAATAGGGGG + Intergenic
1072704824 10:97673641-97673663 GCCGTCTCGACAATCACAGGTGG - Exonic
1076250038 10:128978269-128978291 GCCTACTGCAGATACACAGGAGG - Intergenic
1077643473 11:3902768-3902790 GCCTTCAGCAGTCTCACAGGTGG - Intronic
1079954478 11:26845656-26845678 TCATTATGCAGAATCACAGTTGG - Intergenic
1080304471 11:30821442-30821464 GCTTTGTGCAGAATTAAAGGAGG + Intergenic
1081715946 11:45250613-45250635 GACTTCTGTGGAATCACAGATGG - Intronic
1081991431 11:47339661-47339683 GCCTTCTGCCAGATCACAGTGGG + Exonic
1085776563 11:79371818-79371840 TCTTTCTTCAGAATTACAGGGGG - Intronic
1085903409 11:80729999-80730021 GCTGTTTTCAGAATCACAGGTGG - Intergenic
1086353492 11:85967564-85967586 GCCTACTGCAGAATACCATGAGG - Intronic
1086879781 11:92139568-92139590 GCCATATGCAGAATTTCAGGTGG - Intergenic
1087094581 11:94306860-94306882 CCCTGCTGGAGAATCACATGGGG + Intronic
1090026189 11:123169405-123169427 GCCTACGGCAGAATCACCGTGGG + Intronic
1091566303 12:1651000-1651022 GCTTTCAGCAGAATATCAGGAGG + Intergenic
1094143244 12:27202246-27202268 ACCTTCTGCAGGCTCGCAGGAGG - Intergenic
1095279027 12:40327716-40327738 GCTTTCTGCTGAGTCCCAGGAGG - Intronic
1100163120 12:91884453-91884475 ACCTTCTGTAAAATCACAGATGG - Intergenic
1100687665 12:97004333-97004355 CCCTTCTGCAGAATGGCAGTGGG + Intergenic
1102765025 12:115425301-115425323 GCCTTTTGCAGCAACACAGATGG + Intergenic
1103055410 12:117816271-117816293 GCCGTCTGCAGAACTCCAGGTGG - Intronic
1103433368 12:120905990-120906012 GCCTTCTGCAGAGAAACAGGGGG - Intergenic
1103850298 12:123928558-123928580 GACTTCTGCAGAATCCCAATGGG - Exonic
1106209401 13:27627428-27627450 GCCTTCTCCAAAACCACAGAAGG - Intronic
1109208498 13:59508137-59508159 TCATCTTGCAGAATCACAGGTGG + Intergenic
1109663234 13:65493315-65493337 GTCTTTTGCAGAAACACAGATGG + Intergenic
1109906296 13:68846313-68846335 GAACTCTGCAGAGTCACAGGAGG + Intergenic
1110143043 13:72154655-72154677 GTCTTTTGCAGCAACACAGGTGG - Intergenic
1111466313 13:88616007-88616029 GCTTTCTGCATAAGCACTGGTGG + Intergenic
1113260281 13:108553950-108553972 GCCTTCAGAAGGAGCACAGGGGG - Intergenic
1113616081 13:111681535-111681557 CCCTTCTGAAGCAACACAGGTGG + Intergenic
1113621549 13:111766428-111766450 CCCTTCTGAAGCAACACAGGTGG + Intergenic
1114786120 14:25601495-25601517 GCCTTCTCCAGAATTTCAAGTGG - Intergenic
1115375307 14:32669272-32669294 TCCTTCTACAGAATCAGAGCAGG - Intronic
1115790840 14:36876277-36876299 GGCTTCTGCAGAAGCAAAGTGGG - Intronic
1116189684 14:41648178-41648200 GCCTTCTGAAAAATTACTGGTGG - Intronic
1117773559 14:59158775-59158797 TCCTTCTCCAGATTCAGAGGGGG - Intergenic
1121622864 14:95362268-95362290 GCCTTCTGCAGAAACGCCAGAGG - Intergenic
1121775797 14:96589802-96589824 GCATTCTTCAGGGTCACAGGTGG + Intergenic
1122604132 14:102937296-102937318 GCCTGCTGCAGAATAAAGGGTGG + Intronic
1124054039 15:26225127-26225149 TCATTCTGAAGAATCAGAGGCGG + Intergenic
1125270724 15:37935870-37935892 GCTTTCTGCAGAGCCACAAGGGG - Intronic
1127664408 15:61131254-61131276 GCATTTTGCTGAATCACAAGTGG - Intronic
1128764533 15:70243130-70243152 GCTTTCTGGAGAAGCACAGGTGG - Intergenic
1129323880 15:74789460-74789482 GTCCTCTGCAGAACCAGAGGTGG + Intronic
1131985579 15:98040327-98040349 GCCCTCTAGAGAACCACAGGAGG + Intergenic
1132995580 16:2820773-2820795 GCCCTCAGCAGCATCACAGAAGG - Intronic
1133033654 16:3023189-3023211 GCCTTCTGCAGAATCACAGGCGG - Intronic
1133768357 16:8853347-8853369 GCCTTCTGCTGGGTCAAAGGTGG - Exonic
1138502776 16:57458357-57458379 GCTTTCTGCAGGCCCACAGGAGG + Intronic
1139360980 16:66400025-66400047 GCCTTTTGCAGGGTCCCAGGAGG - Intronic
1140812277 16:78589808-78589830 CCCTTCTGTAGAATAACATGTGG + Intronic
1141672545 16:85500218-85500240 CCCTTCCCCAGAATGACAGGAGG - Intergenic
1142227337 16:88884040-88884062 GCCAGCTGCAGCTTCACAGGCGG - Intronic
1143172606 17:4938856-4938878 GCCTTCAGCAGAAAGCCAGGGGG + Exonic
1143597829 17:7925896-7925918 GCCTTCTCCACAATCGCAGTGGG + Intronic
1146224257 17:31052064-31052086 GCCTTCTCCAGGATGACAGGAGG + Intergenic
1146634474 17:34493932-34493954 GCATACTCCTGAATCACAGGAGG + Intergenic
1148209694 17:45800707-45800729 GCCTTCGGCAGAGCCACAGCTGG - Intronic
1149392616 17:56207106-56207128 ATCTGCAGCAGAATCACAGGAGG + Intronic
1149974884 17:61255529-61255551 TCCTTCTCCAGAAACACAGTGGG + Intronic
1150838820 17:68589175-68589197 GCCTCCTGGAGAATGAGAGGTGG + Intronic
1151288359 17:73129987-73130009 GGCTTCTGCAGAAACCCAGTCGG - Intergenic
1151953079 17:77365985-77366007 GCCTTCTTCAGAAAAACAGTAGG + Intronic
1152309675 17:79542284-79542306 GCCCTCTGCAGACTCACAAGGGG + Intergenic
1152633716 17:81421903-81421925 CCCTTCTCCAGTATCACATGGGG - Intronic
1153278175 18:3389602-3389624 ATTTTCTGCAGAATCAGAGGAGG + Intergenic
1154209086 18:12363995-12364017 AGCTTCTGCAGAATTATAGGGGG - Intronic
1157223023 18:45840559-45840581 GCCTTCAGCAGAGTGCCAGGGGG - Intronic
1159270233 18:66139852-66139874 GCCTTCTGGAAAGTCTCAGGTGG - Intergenic
1159483399 18:69021381-69021403 GCCATCTGCAGGTTCACATGGGG + Intronic
1160882577 19:1328244-1328266 GACATCTGCAGAATCACAGACGG - Intergenic
1161407438 19:4098527-4098549 GCTTGGTGCAGAATCACAGGAGG - Intronic
1167165637 19:47798155-47798177 GGCATCTGCAGAATCTCAGCCGG - Intergenic
1168245368 19:55110504-55110526 ACCTCCTGCAGAACCACAGTAGG - Intronic
925636553 2:5946720-5946742 GGCTTCTGCAGCAGCACGGGTGG + Intergenic
927281949 2:21316731-21316753 ACCTTCACCTGAATCACAGGGGG + Intergenic
927364158 2:22274744-22274766 GCCTTCTCCAGAAGAAGAGGAGG - Intergenic
928258816 2:29748691-29748713 GCCTTCTTCTGAATCACTGAGGG - Intronic
928755102 2:34515187-34515209 GTCCTTTGCAGAAACACAGGTGG + Intergenic
929789218 2:45011321-45011343 GCTTTCTGCAGAAATCCAGGTGG + Intergenic
931409983 2:62019993-62020015 GAATTCTGCAGAATAATAGGAGG - Intronic
933093212 2:78146403-78146425 CCCTTCTGCAAGATCACAGTGGG - Intergenic
935841909 2:107122604-107122626 ACCTCATGAAGAATCACAGGTGG + Intergenic
937581132 2:123489353-123489375 GTTTGCTGCAGAATCACAGAAGG + Intergenic
939164538 2:138626443-138626465 ACCTGCTTCAGAACCACAGGAGG + Intergenic
941783406 2:169473750-169473772 GCCTTCTACAGAATGTCATGTGG - Intergenic
945509875 2:210687642-210687664 GCCTTGGGCAGAATGACTGGAGG + Intergenic
947677095 2:231992162-231992184 GCCTTCTCCACAATCCCAAGTGG - Intronic
1170028891 20:11923341-11923363 GTATTCTGCAGAACCACAGCTGG - Exonic
1170818889 20:19739416-19739438 GCCTTTGGCAGAATCACAGAGGG - Intergenic
1172196841 20:33097677-33097699 TCCTTCTGCAGCATCACAGATGG - Exonic
1172700352 20:36849880-36849902 ACCCTCTGCAGAAACACAAGTGG + Intronic
1173884840 20:46447972-46447994 GCATTCTGCAGCATCCCTGGTGG + Intergenic
1175407942 20:58746996-58747018 GCCTTCAGCAGTGTCACATGGGG - Intergenic
1175793893 20:61759276-61759298 TCCTTCTCCAGAACCACAGAGGG - Intronic
1175945804 20:62558177-62558199 GTGTTCTGCAGCATCCCAGGCGG - Intronic
1178461684 21:32807861-32807883 GCCTTTTGTAAAGTCACAGGAGG - Intronic
1181895669 22:26105345-26105367 GCCCTCTGTAGACTCCCAGGTGG - Intergenic
1183615201 22:38940178-38940200 GCTTTCTCCAGAATCTCAGGTGG + Intergenic
1185156791 22:49197859-49197881 TCCTTCTGCAGAAACACGGCTGG - Intergenic
1185377404 22:50488677-50488699 GCCCACTGCAGAGTGACAGGAGG - Intronic
950416904 3:12873975-12873997 GCCTTCCCCAGAGTCACAGTAGG - Intergenic
951094877 3:18616907-18616929 GTCTTTTACAGCATCACAGGGGG + Intergenic
954463712 3:50642235-50642257 AGCTTCTGCAGAAACAGAGGAGG - Exonic
954947436 3:54438949-54438971 ACCTTCTGCAGAGTTATAGGAGG - Intronic
955634745 3:61015252-61015274 ACCTTCTGCAGATTCGAAGGGGG + Intronic
956846105 3:73184277-73184299 GCCCTTTGCAGCAACACAGGTGG - Intergenic
959672318 3:108992902-108992924 GTCTTCTTCAGAATTACAGAAGG + Intronic
961064126 3:123860160-123860182 GCTGTCTGCAGAATCAAAGGAGG - Intronic
961338789 3:126203506-126203528 GCCTTCTGCAGACACCCTGGTGG - Intergenic
961954246 3:130784887-130784909 GACTTTTTCAGAATCAAAGGTGG - Intergenic
963522594 3:146373724-146373746 GCCTTATGCATAATCACAAAGGG + Intergenic
965221401 3:165931490-165931512 CCAGGCTGCAGAATCACAGGTGG - Intergenic
965599111 3:170437917-170437939 GCCTCCTGCGGAAGCACAGACGG + Intronic
967768647 3:193310170-193310192 GACTTCTGCAGGAACACAGATGG - Intronic
968634449 4:1670707-1670729 TCCTTCTGAAGCATCACAAGTGG - Intronic
969687883 4:8686418-8686440 GCCATCTGCAGACTCACATGGGG - Intergenic
971668903 4:29530064-29530086 GCCCTCTGCAGCAACACAAGTGG + Intergenic
971768063 4:30859738-30859760 GCCTTCTAAAGAATCAGAGCTGG - Intronic
971990985 4:33893472-33893494 GACTTTTTCATAATCACAGGGGG - Intergenic
976732520 4:88278485-88278507 GCCTGCTGCAGGACGACAGGCGG - Exonic
976748238 4:88427450-88427472 GACTTCTGCAGGGCCACAGGAGG + Intronic
978646950 4:110945548-110945570 GCTTTCACCAGATTCACAGGAGG - Intergenic
981087479 4:140698857-140698879 GCCTCCTGCAGAATTAGAGGAGG - Intronic
981831989 4:149012369-149012391 CCATTCTGCAGAAACAGAGGGGG - Intergenic
982336464 4:154244726-154244748 GCCTTCTGCATTATCAGAGTTGG + Intronic
984825829 4:183923956-183923978 TCCTTCTGCAGAATCATCTGGGG + Intronic
984941758 4:184938947-184938969 GCCTCCTGTCGAATCACTGGTGG - Intergenic
986548707 5:8928558-8928580 GGCTTCTGCAGAATTCGAGGTGG - Intergenic
988696309 5:33625983-33626005 GCCTTCAGCAGAATCAGAGGTGG + Intronic
990497257 5:56360999-56361021 GCGTTCTGCAGCATCACAGGGGG - Intergenic
993205850 5:84877540-84877562 GCCTTTTGCAGGAACATAGGTGG + Intergenic
994135258 5:96279267-96279289 GCCATCTGCAGCACCACAGTGGG - Intergenic
995534044 5:113118010-113118032 GCCATCTATAGAAACACAGGCGG + Intronic
995970661 5:117966461-117966483 GCCTTCTGAAGAAGCCCATGGGG + Intergenic
998926622 5:147133651-147133673 GCCTTTTGCAGGAACACAGATGG - Intergenic
999315180 5:150579070-150579092 GCGTTCTGCAGAGCCAGAGGGGG + Intergenic
1000467173 5:161594197-161594219 GCCTTCTCCATTATCACAGAAGG + Intronic
1000875733 5:166635907-166635929 GCCTTCTGAAAAATAACAAGAGG + Intergenic
1001509749 5:172311749-172311771 GCCAACTGCAGAAACACAGGTGG + Intergenic
1002866564 6:1127192-1127214 CCCGTCTGCTGGATCACAGGAGG + Intergenic
1003526717 6:6904268-6904290 GACCTGTGCAGCATCACAGGTGG + Intergenic
1004905842 6:20236186-20236208 GGCTACTGCAGAATCAAAGCAGG + Intergenic
1005159439 6:22842128-22842150 GCCTTCTGCAGCAACACAGAAGG + Intergenic
1006079585 6:31557730-31557752 CTCTTCAGCAGAATCCCAGGGGG - Exonic
1010021537 6:71165307-71165329 GCTTTCACCAGATTCACAGGAGG + Intergenic
1011735349 6:90304707-90304729 GCCTTCTGCAAAATCACCAAAGG - Intergenic
1012155438 6:95813604-95813626 GGCTTCTGCAGAATCAAATCTGG + Intergenic
1014258356 6:119186743-119186765 GGCTGCTGCTGAAACACAGGAGG + Intronic
1020217604 7:6206492-6206514 GCCATGTGCAACATCACAGGAGG - Intronic
1021167949 7:17362925-17362947 CCCTTTTGCAGAAACACATGTGG - Intergenic
1021271940 7:18599521-18599543 GCCTTCTGCAGAATGTCATAGGG + Intronic
1021841692 7:24726343-24726365 GCCTCCTGCAGAGACACAGGAGG + Intronic
1022122911 7:27327057-27327079 GCCTCCTGAAAAATCACAGTGGG + Intergenic
1023859150 7:44206770-44206792 TCCTTGAGCAGAAGCACAGGGGG - Intronic
1027534962 7:79387326-79387348 GCCTTAGGAAGAATCAGAGGTGG - Intronic
1032474952 7:132205264-132205286 TCCTTCAGCAGAATCACCCGGGG + Intronic
1032705280 7:134416069-134416091 TCCTTCTTCAGAGTCCCAGGAGG - Intergenic
1033894837 7:146056912-146056934 AGCTTCTGCAGAAACACAGAGGG + Intergenic
1035168722 7:157006256-157006278 ACCTTCTTCAGAATGAAAGGAGG + Intronic
1035870917 8:3135243-3135265 TACTTCTGCAGAAGCACATGAGG + Intronic
1038397994 8:27261282-27261304 GCCTCCTGGAGAACCACACGGGG - Intergenic
1039086733 8:33787708-33787730 ACCTACTGCAGAATCACCTGGGG - Intergenic
1039854354 8:41399541-41399563 GGCTTCTGCAGTACCTCAGGTGG - Intergenic
1040377611 8:46841644-46841666 GCCTGCTTCATAATCACAGAGGG + Intergenic
1041004254 8:53483884-53483906 ACCTTCTGACGGATCACAGGAGG - Intergenic
1041063892 8:54062287-54062309 GCTTTCACCAGATTCACAGGAGG - Exonic
1041778807 8:61555051-61555073 CAATTCAGCAGAATCACAGGTGG - Intronic
1044602362 8:94018173-94018195 GCTTTCTGCATAATCACAACAGG + Intergenic
1045357820 8:101404918-101404940 GCCTTCAACAGAATCACAGCAGG - Intergenic
1045473309 8:102532178-102532200 GCCTTGGTCAGAAGCACAGGAGG - Intronic
1047713530 8:127575065-127575087 GCTTTCTGCAGAATGGCTGGGGG - Intergenic
1048212747 8:132469041-132469063 GACATCTGCAAAATCAGAGGGGG + Intronic
1058504663 9:105655872-105655894 ACTTGCTTCAGAATCACAGGTGG - Intergenic
1058736222 9:107896582-107896604 CCCTTCTGCAGAGTCAAAGCAGG + Intergenic
1060344135 9:122802037-122802059 TCCTTCTACAGAATGCCAGGTGG - Intronic
1060837424 9:126766962-126766984 GGCTTCTGCAATAGCACAGGTGG - Intergenic
1060899191 9:127242714-127242736 TGCTTCTGGAGAATCACCGGTGG - Intronic
1062166970 9:135112773-135112795 GCCTTCTGCAGGGGCACAGACGG + Intronic
1062457260 9:136645640-136645662 CACTTCTGCAGAAGCACGGGGGG - Intergenic
1062646341 9:137550538-137550560 GCCTTCTGGAGAAGCACGGCTGG + Intergenic
1190074999 X:47310505-47310527 GCCATATGCAAAATCCCAGGGGG + Intergenic
1190582937 X:51906057-51906079 GCATTCTGTAGGATCACAGGTGG - Intergenic
1194535188 X:95097225-95097247 GCCTTTTGCAGCATCACAGAGGG + Intergenic
1196129017 X:112132463-112132485 GCCTTCTTCAGAATCTCAAAGGG - Intergenic
1196683332 X:118490709-118490731 GCCTTCTGGAGAAGCTCATGAGG + Intergenic
1199595340 X:149502517-149502539 GCCTTCTGCAGGAGCTCAGCTGG - Intronic
1199886124 X:152023641-152023663 GCCATCTGCAGCAACACAGATGG - Intergenic
1200849757 Y:7870936-7870958 GCCTGCTTCATAATCACAGATGG - Intergenic
1200901927 Y:8441379-8441401 GCCTACTTCAGAACCACAGATGG - Intergenic