ID: 1133034635

View in Genome Browser
Species Human (GRCh38)
Location 16:3028009-3028031
Sequence GCTTCTTTTGGAAGACAATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 214}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133034619_1133034635 21 Left 1133034619 16:3027965-3027987 CCCGATGAGCCCTTGCCCAGCAT 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034618_1133034635 27 Left 1133034618 16:3027959-3027981 CCTGCTCCCGATGAGCCCTTGCC 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034631_1133034635 5 Left 1133034631 16:3027981-3028003 CCAGCATCCTGGGGCGGGGAGGG 0: 1
1: 0
2: 3
3: 53
4: 464
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034617_1133034635 28 Left 1133034617 16:3027958-3027980 CCCTGCTCCCGATGAGCCCTTGC 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034633_1133034635 -2 Left 1133034633 16:3027988-3028010 CCTGGGGCGGGGAGGGCATCAGC 0: 1
1: 0
2: 0
3: 29
4: 263
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034624_1133034635 12 Left 1133034624 16:3027974-3027996 CCCTTGCCCAGCATCCTGGGGCG 0: 1
1: 0
2: 0
3: 12
4: 238
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034616_1133034635 29 Left 1133034616 16:3027957-3027979 CCCCTGCTCCCGATGAGCCCTTG 0: 1
1: 0
2: 2
3: 10
4: 147
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034625_1133034635 11 Left 1133034625 16:3027975-3027997 CCTTGCCCAGCATCCTGGGGCGG 0: 1
1: 0
2: 2
3: 20
4: 313
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034620_1133034635 20 Left 1133034620 16:3027966-3027988 CCGATGAGCCCTTGCCCAGCATC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214
1133034629_1133034635 6 Left 1133034629 16:3027980-3028002 CCCAGCATCCTGGGGCGGGGAGG 0: 1
1: 0
2: 0
3: 39
4: 356
Right 1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG 0: 1
1: 0
2: 2
3: 18
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133034635 Original CRISPR GCTTCTTTTGGAAGACAATC TGG Exonic
900177770 1:1298375-1298397 GCTTCTTCTGGTAGACCAGCTGG + Exonic
900906187 1:5560905-5560927 GTTTCTCTTGGAAAACCATCAGG - Intergenic
902225060 1:14991587-14991609 GCTTCTTTTGGATGATCTTCAGG + Intronic
904321291 1:29699092-29699114 GCTTGTTTTTGATGAAAATCAGG + Intergenic
908961163 1:69698414-69698436 GCATGATTTGGAAGACATTCTGG - Intronic
910200923 1:84697689-84697711 GCTTCTAATGGGAGTCAATCAGG + Intergenic
910542384 1:88374894-88374916 TCTGCTTTTGGAATACACTCTGG - Intergenic
921754460 1:218837779-218837801 GCATCTATAGGAAGAAAATCCGG + Intergenic
922399812 1:225240747-225240769 GTTACTTTTGCAAGAGAATCAGG - Intronic
922552413 1:226505690-226505712 GCTTCTTATGCAACACATTCTGG + Intergenic
923116396 1:230942866-230942888 GCTTCTTTGGGAAGAGAAGAAGG - Intronic
923314370 1:232765627-232765649 ACCTCTTTTGGAAAACTATCAGG + Intergenic
923751421 1:236749980-236750002 GCTTCTTATGGTTTACAATCTGG - Intronic
1065231739 10:23605648-23605670 GCTTCTTTGGGAAGGGAAGCAGG - Intergenic
1065424914 10:25590543-25590565 GCTTTTCTTGGAAGAAAGTCTGG - Intronic
1066596726 10:37059177-37059199 AGTTCAATTGGAAGACAATCAGG + Intergenic
1069024685 10:63526488-63526510 TATTCTTTTGGAAAGCAATCTGG - Intronic
1069032716 10:63614811-63614833 AATCCTTTTGGATGACAATCTGG + Intronic
1069184570 10:65407392-65407414 CCATATTTTGGAAGGCAATCTGG - Intergenic
1069599938 10:69697555-69697577 GCTGTTTTTGGAAGAAAATCTGG + Intergenic
1070535782 10:77376232-77376254 GCCTCTTTTGGAAGCCAACTAGG - Intronic
1071078983 10:81786841-81786863 AGTTGTTTTGGCAGACAATCTGG + Intergenic
1072614339 10:97039448-97039470 GATTTTCTTGGAAGACCATCAGG + Intronic
1075155245 10:119970796-119970818 CCCTTTTTTGGAAAACAATCTGG - Intergenic
1076788759 10:132765222-132765244 GCTTGTTTTGGAAGAGTCTCAGG + Intronic
1078277056 11:9859198-9859220 AGTTCTTTTGAAAGACAATTTGG - Intronic
1078350077 11:10585901-10585923 GCTTCTATTGAAAGAAAAGCGGG - Intronic
1080650023 11:34214915-34214937 ACTGCTTTTGGAAGAAACTCAGG + Intronic
1080685712 11:34513345-34513367 GCTTCTTTAGGAAGGGAAGCTGG - Intronic
1083109683 11:60393149-60393171 GCTCCTTCTGGAGGACACTCTGG + Intronic
1086482879 11:87262319-87262341 GCCTTTTTTGGAGGACAATCTGG - Intronic
1089043619 11:115479404-115479426 TCTTTTTTTGGAAGACAAATAGG - Intronic
1089446557 11:118557394-118557416 AGTTATTTTGGAAGAAAATCAGG + Intronic
1091093664 11:132796459-132796481 GTTGTTTTTGGAAAACAATCTGG - Intronic
1091124832 11:133084565-133084587 GCTTGGCTTGGAAGCCAATCTGG + Intronic
1091608704 12:1983174-1983196 GATTCTTTTCAAAGATAATCAGG + Intronic
1092169749 12:6366219-6366241 GATCATTTTGGAAAACAATCTGG + Intronic
1092937227 12:13375360-13375382 GCTTCTTTTGGAACTCAGTGTGG + Intronic
1094044977 12:26157565-26157587 GCTTCTTTTAAAAAAAAATCTGG + Intronic
1095306984 12:40650569-40650591 GCTAACTTTGGAAGACATTCAGG - Intergenic
1097811790 12:64026898-64026920 CCTTATTTTGGAAGAATATCTGG + Intronic
1098717342 12:73847274-73847296 GCTCCTTGTGGAAGACAGTGTGG + Intergenic
1099284325 12:80697399-80697421 GCTTCTTTGGGAATACAATTTGG - Intergenic
1100103868 12:91144383-91144405 GTTTCTATTGGAAGACATTCAGG - Exonic
1101529542 12:105561607-105561629 AATTCCTTTGGAAGACATTCTGG - Intergenic
1101538266 12:105640750-105640772 GCTACATTTTGAAGACAATGAGG - Intergenic
1102330234 12:112022607-112022629 CCTTCTTCTGGAAGGCAGTCAGG - Exonic
1102619028 12:114178987-114179009 GCTAGTTTTGGAACAAAATCAGG + Intergenic
1103931682 12:124453960-124453982 GCTTCTGATGGAAGACACCCTGG + Intronic
1108382505 13:49867947-49867969 GCTTCTTTTGGAAAATCATATGG + Intergenic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1111572962 13:90111179-90111201 ACTACTTTTGTAAAACAATCTGG - Intergenic
1111611368 13:90612292-90612314 GCTTTTTTTGGAAAGCAATTTGG + Intergenic
1111822852 13:93234288-93234310 GCTTAATTTGGAAGACACTTTGG - Intronic
1112744901 13:102515993-102516015 GCTTATTTTGGAAAACATTTAGG - Intergenic
1112827190 13:103405363-103405385 GATGCTTATGTAAGACAATCTGG - Intergenic
1113270069 13:108663172-108663194 GTTTCTTCTTGAAGTCAATCTGG + Intronic
1113761361 13:112849411-112849433 GCTGCTTTTAAAAGTCAATCAGG - Intronic
1114339636 14:21729743-21729765 GATGCTTTTGGGAGGCAATCTGG + Intergenic
1115100845 14:29697060-29697082 GCTTCTTTTTCTAGAAAATCAGG - Intronic
1116599240 14:46898235-46898257 GTTTATTTTGGAAGAGACTCTGG + Intronic
1116616954 14:47152151-47152173 AATTCTTTTGGGAGACAATTGGG - Intronic
1117645336 14:57845651-57845673 GCTTATTAGGGAAGAAAATCAGG - Intronic
1117649857 14:57892368-57892390 GAGTCTTTTGGGAGACAATGTGG - Intronic
1119345694 14:73921990-73922012 GCTTCTGTTGAAAGAAAATGAGG + Intronic
1119381830 14:74234129-74234151 GATACTTTTGTAAGACAATCTGG - Intergenic
1119923829 14:78472708-78472730 GCTTCTTTTAGAGGACAGTGTGG - Intronic
1120285391 14:82493934-82493956 CCATCTTTTGAAAGGCAATCTGG + Intergenic
1122766259 14:104072980-104073002 GTTTCTTTTGGAAGTCAATCTGG + Intergenic
1128026176 15:64438866-64438888 GCCATTTGTGGAAGACAATCTGG - Intronic
1132045124 15:98557339-98557361 GCTTCCTGTGGTAGACATTCTGG + Intergenic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1135041040 16:19116516-19116538 TTTTCTTTTTAAAGACAATCAGG - Exonic
1137917416 16:52447875-52447897 TCTTCTCCTGGAAGAAAATCTGG + Intronic
1138324315 16:56150893-56150915 TCTACTTTTGGAAGAAACTCAGG - Intergenic
1138721078 16:59080304-59080326 ACTTATTTTGCAAGATAATCAGG + Intergenic
1140785407 16:78336563-78336585 GAGTCTTGTGGAAGACAATAGGG + Intronic
1147460805 17:40567358-40567380 GCTTCTTTTGCCAGAGATTCAGG - Intergenic
1149791253 17:59479380-59479402 GCTTCTTCTGGGAGTCAATTAGG + Intergenic
1151619250 17:75235346-75235368 CCTTCTTTTAGGAGAAAATCAGG + Intronic
1153232858 18:2956521-2956543 GCTTCTTCTGGAACACCTTCTGG + Intronic
1153955237 18:10090462-10090484 GCTGTTTTAGGAAGACAGTCGGG + Intergenic
1155509238 18:26560471-26560493 GGTTCTTTTGGAAAAGGATCTGG - Intronic
1155882136 18:31162717-31162739 GCTTGGTTTGGAAGACAGTCCGG + Exonic
1158323266 18:56286943-56286965 GCCTCTCTTGGAGGACAATGTGG - Intergenic
1158420884 18:57292695-57292717 GCTTCTTTTGCACAACAATACGG - Intergenic
1159027726 18:63201310-63201332 GCGTCTTTTGAAAGACTTTCAGG - Intronic
1159096214 18:63905380-63905402 GGTTCCTTTGGAAGATAATTAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166747055 19:45146427-45146449 GCTGCTTCTGGAAGCCAGTCAGG + Exonic
1168019052 19:53595519-53595541 GCTAATTTTGGAAGACATTTAGG - Intergenic
926213522 2:10889429-10889451 GCATTTTTTGGAAGAGGATCAGG + Intergenic
927390003 2:22583862-22583884 GGTTCTTTAGAAAGACATTCTGG - Intergenic
928347606 2:30515856-30515878 GCTTCTGCTGGAAGAAAATTGGG - Intronic
930916699 2:56700020-56700042 TCTTCTTTTGGAAGAAAAATAGG + Intergenic
931464184 2:62472472-62472494 GCTTCATTTGGGAGACAGACAGG - Intergenic
935410860 2:102760391-102760413 GCAGCTTTTGGCAGAAAATCAGG + Intronic
937171159 2:119870500-119870522 ACTTCCTCTGGAAGAGAATCTGG + Intronic
937257891 2:120567689-120567711 TTTTCTTTTGAGAGACAATCTGG - Intergenic
937530854 2:122825393-122825415 GCTTCTTTTGGGGGACTATTGGG - Intergenic
940052054 2:149475493-149475515 GCTTCATTTGAAAGACACTTTGG - Intergenic
941464248 2:165807022-165807044 GGTTCTCATGGAAGACCATCAGG - Intergenic
942064413 2:172257081-172257103 GCTTCTCTTGGCAGACCAACAGG + Intergenic
945312598 2:208332379-208332401 ACTTGTTTTGGAAGATAATGTGG + Intronic
945493533 2:210482914-210482936 ACTTCTTTTGGCAGTCAATTAGG + Intronic
946936844 2:224730861-224730883 TCTTCTTTAGGAAGAATATCAGG + Intergenic
947335260 2:229075976-229075998 GCTGCTTCTGGAAGTGAATCAGG - Intronic
947382387 2:229557797-229557819 GCTTATTTTGGAAGACAGTGTGG + Intronic
1169992782 20:11522216-11522238 ACTACTCTTGGAAGACTATCAGG + Intergenic
1170829500 20:19827838-19827860 GGTACTTTTGGAACACAATGTGG - Intergenic
1171161294 20:22926265-22926287 TCTTTTTTGGGTAGACAATCTGG - Intergenic
1173055258 20:39605870-39605892 ACTTCCTTTGGAACCCAATCTGG - Intergenic
1173058730 20:39641286-39641308 GATACTTTTGGAAAACAATTTGG + Intergenic
1173731312 20:45330596-45330618 GCGTATTTTGGAAGAGACTCAGG + Intronic
1173757352 20:45528647-45528669 GCTACTTATGGAAAACAATATGG - Intergenic
1173961335 20:47074635-47074657 GCTTCTTTTGAAAGAAGATCTGG + Intronic
1174445842 20:50590561-50590583 GCTGCTTTGGGAAGACAGACTGG + Intronic
1174869701 20:54171624-54171646 GTTTCTTTTGAAAGGCACTCCGG + Exonic
1176651801 21:9555521-9555543 TACTCTTTTGCAAGACAATCTGG - Intergenic
1177338323 21:19762563-19762585 GCTCATGTAGGAAGACAATCTGG + Intergenic
1178954601 21:37010958-37010980 GATCCTTTTGGAAAACAATCAGG + Intronic
1184571752 22:45329296-45329318 GCTCCTTCTGGAAAACAATTTGG - Intronic
950731066 3:14958374-14958396 ACTTCTTTTGGCAGCTAATCAGG + Intronic
951211860 3:19983902-19983924 TCTTCTTTTGGAAGTCATACTGG - Exonic
951306779 3:21073618-21073640 GATTCTTTTGGAAGACAAACAGG + Intergenic
952159064 3:30675355-30675377 GCTTCATTTGGCAGCCAACCAGG - Intronic
953535461 3:43773838-43773860 GCTTCTCTTGAAAGCCACTCTGG + Intergenic
955942031 3:64155456-64155478 ACTTGTTTTGGAAGACAATTTGG + Intronic
956308570 3:67853769-67853791 GTTTGTTTTGGAAGTCAACCAGG + Intergenic
956490138 3:69762553-69762575 TCTCTTTTTGGAGGACAATCAGG + Intronic
958004708 3:87796072-87796094 GTTTCTGTTGGAAGACAAGAAGG + Intergenic
958479089 3:94624066-94624088 CCTTCTTTTGAAAGAGACTCAGG - Intergenic
959693815 3:109227900-109227922 TCCTTTTTTGGAAGACAATTTGG + Intergenic
960564151 3:119116571-119116593 GCTAACTTTGGAAGACATTCAGG + Intronic
963073320 3:141323062-141323084 GCCTCTTTGTGAATACAATCAGG - Intergenic
963867002 3:150372354-150372376 ACTAATTTTGGAAGACAATCAGG - Intergenic
964110613 3:153083447-153083469 GCTAATTGTGGAAGACAATGTGG + Intergenic
964638887 3:158886945-158886967 GTTTCTTTCAGAGGACAATCAGG + Intergenic
966615164 3:181905176-181905198 GCTTCCTGTGGAAGGCTATCTGG - Intergenic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967358249 3:188598025-188598047 CCTCCTTTAGGAAGCCAATCTGG - Intronic
969922341 4:10552240-10552262 GCTACCTTTGGAACACATTCAGG + Intronic
971125565 4:23750271-23750293 GCTTCTATTTCAAGAAAATCAGG - Intergenic
971855134 4:32033140-32033162 GTTTCTTTTGAAAGACAAATTGG + Intergenic
974094278 4:57345442-57345464 GCTTGTTTTGCAAGAGAATTAGG + Intergenic
975185581 4:71398453-71398475 GCTTTCTTTGGAAGAGAATATGG + Intronic
975399210 4:73915047-73915069 GCTACTCTTGGAATGCAATCAGG - Intergenic
976267873 4:83202409-83202431 GCTTGTTTTGGAAGGCAATGTGG + Intergenic
976329377 4:83811808-83811830 GATTCTTTTAGAAGAAAATGAGG - Intergenic
976376375 4:84350152-84350174 GTTTCTTTTGGTAGCCTATCTGG - Intergenic
976449238 4:85167384-85167406 GCTTCTTGTTGAAGACAAGGAGG + Intergenic
977047635 4:92087939-92087961 GATAATTTTGGAAGACATTCAGG + Intergenic
977590886 4:98825420-98825442 GATTCTCTTGGTAGAAAATCTGG + Intergenic
978281542 4:107021899-107021921 GGCTCTTTTGGCAGACAGTCAGG - Intronic
978411577 4:108431797-108431819 GATTATTTTGGAAGGAAATCAGG - Intergenic
979412026 4:120391672-120391694 GCTTCCTCCGGTAGACAATCTGG - Intergenic
979807196 4:124988785-124988807 GCTAATTTTGGAAGACATTTAGG - Intergenic
980247982 4:130272084-130272106 GCTTCTTGAGGATGAAAATCTGG + Intergenic
981479039 4:145217546-145217568 GTTTCATTTGGAAGACAATGTGG - Intergenic
981593087 4:146387104-146387126 GGGACTTTTGGAAGACAATTGGG + Intronic
981612004 4:146603517-146603539 GCTTCTTTTGCATGACAGTGAGG + Intergenic
982319159 4:154060936-154060958 GCTTCCTTTGGAAGTAAAGCAGG - Intergenic
984164178 4:176287907-176287929 GCATCTTTTGACAGACAATCTGG - Intergenic
984461514 4:180042963-180042985 GCTTTTTTTGGAATATAATATGG - Intergenic
987747616 5:21996397-21996419 GCTTCTGTTGGCATAAAATCAGG + Intronic
989534745 5:42550657-42550679 TCTACTTTTGAAAGACAAACAGG - Intronic
991439591 5:66633206-66633228 GATAATTTTTGAAGACAATCTGG + Intronic
991506921 5:67334921-67334943 ACTTCTTTTGGAGGAGAAACTGG + Intergenic
991639171 5:68736540-68736562 GCTTCTTTTCCAAGACCATGAGG - Intergenic
995187618 5:109288867-109288889 ACGTCTTATGGAAGACAATATGG + Intergenic
995639797 5:114242514-114242536 CATTCTTTTGGTAGACATTCAGG - Intergenic
995673612 5:114636285-114636307 TGTTCATTTGGAAGACAATTTGG + Intergenic
997000537 5:129753898-129753920 GCTTATATTGGATGACAATGTGG + Intronic
999407373 5:151318733-151318755 TCTTCAGTTGGAAGAAAATCCGG + Intronic
1000698858 5:164422593-164422615 GATTCTTGTGGAAAACAGTCTGG + Intergenic
1001112605 5:168909913-168909935 GCTTCTTTTGGGAGACAGAAAGG - Intronic
1001538582 5:172520011-172520033 GCCATTTTTGGAAGACAATGTGG + Intergenic
1001881505 5:175248533-175248555 GTTTCCTTTTGAAGAAAATCAGG + Intergenic
1005145234 6:22682185-22682207 CATTCTTTTGGAAATCAATCTGG + Intergenic
1006220991 6:32491268-32491290 GCCTCATCTGGAAGACACTCTGG - Intergenic
1006524230 6:34590089-34590111 GCTTGTTCTGGAAGAGATTCAGG - Exonic
1007287606 6:40758795-40758817 GCTTCTCTTGGAAGAGTTTCTGG + Intergenic
1009879444 6:69547380-69547402 GCATATTTTGGAGGACAATCAGG - Intergenic
1012579700 6:100851947-100851969 GCCTCTTAGGGAAGACAAGCCGG - Intronic
1012997781 6:105990859-105990881 CCTGCTTTTGGAAGCCAATTTGG - Intergenic
1013184808 6:107748552-107748574 AAGTCTTTTGGAAGACACTCTGG + Intronic
1013848194 6:114480324-114480346 ACTTCTTCTGGAATACTATCTGG - Intergenic
1014056989 6:117027259-117027281 GCTGCTTTGGGAGGAGAATCAGG - Intergenic
1014965853 6:127749430-127749452 GCTTATTTTGAAAGAAAATTTGG + Intronic
1015355349 6:132271350-132271372 GCTCCTTCTGGAAGACCATGTGG + Intergenic
1015625399 6:135176603-135176625 GTTTCTTATGGAAGACATCCGGG - Intergenic
1017062517 6:150498395-150498417 GTTTCTTTTGAAAAGCAATCTGG - Intergenic
1018934787 6:168266573-168266595 GCTTCTGGTGGAGGAAAATCCGG - Intergenic
1020814285 7:12885762-12885784 AATTATTTTGGAAAACAATCTGG + Intergenic
1020916648 7:14201939-14201961 GCCTCTTATAGAAGACTATCAGG - Intronic
1021932994 7:25600093-25600115 CCTCCTTTTGGATGACAATAGGG - Intergenic
1024534133 7:50416118-50416140 GTTTCTCTGAGAAGACAATCAGG - Intergenic
1024968767 7:55049909-55049931 GTGTGTTTTGGAAGACAATGTGG - Intronic
1028159994 7:87475171-87475193 GCTCCTTTTGGAACAGATTCAGG - Intronic
1028162259 7:87498856-87498878 GCTCCTTTTGGAACAGATTCAGG + Intergenic
1030147362 7:106370320-106370342 GCTTCTGTTTGATGACAGTCTGG + Intergenic
1030182906 7:106729364-106729386 ACATCTTTTGGAAAACAGTCTGG + Intergenic
1030474368 7:110010668-110010690 GGTTGCTTTGGAAGAGAATCTGG + Intergenic
1030502152 7:110373025-110373047 GCATCTTTTGGAAGACTGACAGG - Intergenic
1033383804 7:140851649-140851671 TCTTCTTTTGGAAGACCATTTGG - Intronic
1033622668 7:143076358-143076380 GCTTCTTTTGGAGGATGAGCTGG + Intergenic
1042378071 8:68078932-68078954 GCTCCTTTTAAAAGACAATTTGG + Intronic
1043006857 8:74830600-74830622 GCTTCATGTGGAAGAGAATGTGG + Intronic
1045226513 8:100251836-100251858 GCCTTTTTTGGGAGACAATCTGG + Intronic
1046461247 8:114539442-114539464 GATTATTTTGAAAGACAATTTGG + Intergenic
1048502184 8:134988386-134988408 GCTGCCTTTCGAAGAAAATCAGG - Intergenic
1048735964 8:137502037-137502059 GCTTCTTTTGGAAATAAATGTGG + Intergenic
1051019260 9:12521350-12521372 CCTTCCATTAGAAGACAATCTGG - Intergenic
1051347616 9:16166397-16166419 GCTTCTCTTGGAAGTGCATCTGG - Intergenic
1051596464 9:18829061-18829083 GCTGCTTTTCCAAGAGAATCTGG + Intronic
1052147623 9:25070755-25070777 CATTCTTTTGGAAGAAAATATGG + Intergenic
1052955430 9:34250126-34250148 ACTTCTTTTGGAAGCTATTCCGG + Intronic
1054736914 9:68762819-68762841 ACTTCCTTTAGAAGACAATGGGG + Intronic
1054950671 9:70847754-70847776 GATTATTTTTGAACACAATCAGG + Intronic
1058014676 9:100017011-100017033 TCTTCTTTTAGAAGAAAATGTGG + Intronic
1058046358 9:100361749-100361771 GCTTCTTTAGCATGAAAATCTGG - Intergenic
1059185666 9:112268445-112268467 GCTACTTTGGGAAGACAAGGTGG + Intronic
1059281907 9:113141638-113141660 GCTTCTTTTGGTAAACTATTGGG - Intergenic
1059828196 9:118057619-118057641 ACTTCTCTTGGAATATAATCAGG + Intergenic
1060013854 9:120069027-120069049 GTTTGTTTTGGGAGAGAATCTGG + Intergenic
1061604081 9:131695339-131695361 CCTGCTTTGGGAAGACAAGCCGG - Intronic
1186719768 X:12290919-12290941 GCTTGTTTTGGAAGAAGATGGGG + Intronic
1186807953 X:13159093-13159115 GCTGCTTTGGAAAAACAATCTGG - Intergenic
1189251986 X:39607847-39607869 ACTTACTTTGGAAAACAATCTGG + Intergenic
1191636877 X:63388105-63388127 GCTTCTTTTGGATCAGGATCAGG + Intergenic
1192958674 X:76103483-76103505 TCTTCTTTGGGATGAAAATCAGG + Intergenic
1194945722 X:100064653-100064675 ACTTCTTTTGGAAAACTGTCCGG + Intergenic
1197848586 X:130831970-130831992 ACTTCTTTAGGAAAAGAATCTGG + Intronic
1201969642 Y:19777279-19777301 GCTTCTTTTTGCAGGCAACCTGG - Intergenic
1202095554 Y:21245316-21245338 CCTTCTTTGGGAAGCCAATCAGG - Intergenic