ID: 1133038156

View in Genome Browser
Species Human (GRCh38)
Location 16:3046201-3046223
Sequence CTTCCCCCCAGGACCCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133038156_1133038175 28 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038175 16:3046252-3046274 GGCTGGCTGAGCCGAAGGCCCGG No data
1133038156_1133038173 11 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038173 16:3046235-3046257 GATACAGGGATGGGGAGGGCTGG No data
1133038156_1133038174 23 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038174 16:3046247-3046269 GGGAGGGCTGGCTGAGCCGAAGG No data
1133038156_1133038167 -3 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038167 16:3046221-3046243 AAGGAGAGGGGCGGGATACAGGG No data
1133038156_1133038170 3 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038170 16:3046227-3046249 AGGGGCGGGATACAGGGATGGGG No data
1133038156_1133038169 2 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038169 16:3046226-3046248 GAGGGGCGGGATACAGGGATGGG No data
1133038156_1133038171 6 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038171 16:3046230-3046252 GGCGGGATACAGGGATGGGGAGG No data
1133038156_1133038168 1 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038168 16:3046225-3046247 AGAGGGGCGGGATACAGGGATGG No data
1133038156_1133038172 7 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038172 16:3046231-3046253 GCGGGATACAGGGATGGGGAGGG No data
1133038156_1133038166 -4 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038166 16:3046220-3046242 GAAGGAGAGGGGCGGGATACAGG No data
1133038156_1133038176 29 Left 1133038156 16:3046201-3046223 CCCCACGGGGTCCTGGGGGGAAG No data
Right 1133038176 16:3046253-3046275 GCTGGCTGAGCCGAAGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133038156 Original CRISPR CTTCCCCCCAGGACCCCGTG GGG (reversed) Intergenic
No off target data available for this crispr