ID: 1133039267

View in Genome Browser
Species Human (GRCh38)
Location 16:3051527-3051549
Sequence TGGTGTTTCACCAACCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133039265_1133039267 -8 Left 1133039265 16:3051512-3051534 CCATGGCATCTAGACTGGTGTTT 0: 1
1: 0
2: 2
3: 19
4: 181
Right 1133039267 16:3051527-3051549 TGGTGTTTCACCAACCAGCTGGG 0: 1
1: 0
2: 6
3: 59
4: 254
1133039263_1133039267 -2 Left 1133039263 16:3051506-3051528 CCTTCACCATGGCATCTAGACTG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1133039267 16:3051527-3051549 TGGTGTTTCACCAACCAGCTGGG 0: 1
1: 0
2: 6
3: 59
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133039267 Original CRISPR TGGTGTTTCACCAACCAGCT GGG Intronic
901074918 1:6548054-6548076 TGGTGTTTTCCCAACCTTCTTGG - Intronic
901587955 1:10314081-10314103 TGGGGTTTCACCAGTCAGCCAGG + Intronic
901777953 1:11573587-11573609 GAGTGTTTGACCAAACAGCTGGG + Intergenic
902074057 1:13768568-13768590 TGGGGTTTCACCCACCATGTTGG + Intronic
903628951 1:24751652-24751674 TGGGGTTTCTCCATCCAGCTTGG + Intronic
904347717 1:29884210-29884232 TGGTAACTCACCAGCCAGCTGGG - Intergenic
905972027 1:42149133-42149155 TGGTGTTTTATCAAACAGCTGGG - Intergenic
907242548 1:53088791-53088813 AGATCTTCCACCAACCAGCTCGG - Intronic
907367934 1:53978037-53978059 TGGTGTTTGACCAAACAACTGGG - Intergenic
907621412 1:55984786-55984808 TGGAGCTTCAGCAACCAGGTAGG - Intergenic
907966675 1:59337526-59337548 CAGTGCTTCACTAACCAGCTAGG + Intronic
909022023 1:70442152-70442174 TGGTGTTTGACCAAACAACTGGG + Intergenic
909880128 1:80864963-80864985 TAGGCTTTCACCAAACAGCTAGG + Intergenic
910118413 1:83757853-83757875 TGATGTTTTACCAGCCACCTGGG - Intergenic
910624378 1:89291203-89291225 TGGTGTTTTACCAAAGAACTGGG + Intergenic
910880068 1:91915248-91915270 TGGGGTTTCACCATCCAGGCTGG - Intergenic
913227287 1:116711332-116711354 AAGTGCTTCACCAACCATCTAGG - Intergenic
915609985 1:156984116-156984138 TGGTTTTTCACTTTCCAGCTAGG + Intronic
916537382 1:165716417-165716439 TGGTGTTTGACCAAATAACTAGG + Intergenic
917630297 1:176884970-176884992 TGGGGTTTCCCCCACCAGCACGG - Intronic
917942936 1:179941379-179941401 TGGTGTTTAACCAAGTATCTGGG - Intergenic
917957986 1:180119799-180119821 TGATGTTTGACCAAATAGCTGGG - Intergenic
918481987 1:184988508-184988530 TAGTGTTTCACCAGACAGCTGGG - Intergenic
918741672 1:188139884-188139906 TGGTGTTTGACCAAAAACCTGGG - Intergenic
919049887 1:192499789-192499811 TGGTGTTTGACTAAACACCTGGG - Intergenic
919523746 1:198621635-198621657 TGCAGTTGCACCACCCAGCTAGG + Intergenic
920882416 1:209892904-209892926 TAGTGTTTGACCAAACAACTGGG - Intergenic
921454337 1:215349808-215349830 TGGTGTTTGACCAAACTACTGGG - Intergenic
921730226 1:218569801-218569823 TAGTGTTTGACCAAACAACTGGG - Intergenic
923440941 1:234019684-234019706 TGGTGTTTGACCAAAAAACTGGG + Intronic
923441246 1:234022602-234022624 TGGTGTTTGACCAAACAACTTGG + Intronic
923738291 1:236632663-236632685 TGGTGTTCCCTGAACCAGCTTGG + Intergenic
923771644 1:236942745-236942767 TGGTGTTTGACCAAATACCTGGG + Intergenic
924823875 1:247520208-247520230 TGGTGTTTAACCAAATATCTGGG - Intronic
1062923067 10:1294474-1294496 TGGCGTTTCACCTTACAGCTGGG + Intronic
1063706988 10:8440273-8440295 TGGTATTTGACCAAACAACTAGG + Intergenic
1063868264 10:10390365-10390387 TAGTGTTTGACCAAACAACTGGG + Intergenic
1064366750 10:14715525-14715547 TCATGTTTCACCAACTATCTGGG - Intronic
1064380419 10:14837442-14837464 TGGGGAGTCACCAACTAGCTTGG + Intronic
1065291543 10:24235230-24235252 TGGTGTTTGACCGAACAACTGGG + Intronic
1065876475 10:30001505-30001527 TGGTGATTCACCAAATAGCTGGG - Intergenic
1066286237 10:33968843-33968865 TGGTATAGCACCAACCACCTTGG + Intergenic
1066509008 10:36074624-36074646 TGGTATATCACGAACCAGATAGG + Intergenic
1067281039 10:44873117-44873139 TAGTGTTTGACCAATCAACTGGG + Intergenic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1071881640 10:89905172-89905194 TGGTGTTTGACCAAATATCTGGG - Intergenic
1072285921 10:93914853-93914875 TGGTGTTTGACCAAACCACTGGG + Intronic
1073650992 10:105357792-105357814 TGGTGTTTGACCAAACAACTGGG + Intergenic
1073850326 10:107609397-107609419 TAGTGTTTGACCAAACAGCTGGG - Intergenic
1074219920 10:111426461-111426483 TAATGTTTCACCACCCATCTGGG - Intergenic
1074693468 10:116027433-116027455 TAGTGTTTGACCAAACATCTGGG - Intergenic
1075398590 10:122145010-122145032 GGGTGTTTCCCCAAACAGCTGGG - Intronic
1075582793 10:123634811-123634833 TGGTGTTTCCCCAAACAGGAAGG + Intergenic
1075614115 10:123878851-123878873 TGGTGTTTTATCAGCCTGCTTGG + Intronic
1075940895 10:126389161-126389183 TGGTGTTTCTCCAAACACCCTGG - Intergenic
1076191068 10:128483801-128483823 CGGTGTTTCACAACCCAGTTTGG + Intergenic
1076323401 10:129600922-129600944 TAATGTTTCACTAACCAACTAGG - Intronic
1076730142 10:132434395-132434417 TGGTGTTTGACCAAATAGCTGGG - Intergenic
1079324386 11:19479035-19479057 TGGGGTTGCCCCAGCCAGCTGGG + Intronic
1079758767 11:24302202-24302224 TGGTTTAACACCAACCATCTGGG + Intergenic
1084124338 11:67089164-67089186 TGGGGTTTCTCCACCCACCTCGG + Intergenic
1085106336 11:73846544-73846566 TGGGGTTTCACCAACCACGTTGG + Intronic
1085184845 11:74566803-74566825 TGGTTTTTAATCAACTAGCTTGG + Intronic
1085184846 11:74566859-74566881 TGGTTTTTAATCAACTAGCTTGG - Intronic
1086270825 11:85064645-85064667 TAGTGTTTGACCAAACAGCTTGG - Intronic
1086596060 11:88572272-88572294 TGGTGTTACACCAGACTGCTAGG - Intronic
1086809168 11:91283853-91283875 TGGTGTTTGACCAAACAACTAGG - Intergenic
1086989253 11:93285271-93285293 TAATGTTTCACCAACTACCTGGG - Intergenic
1088649728 11:111946767-111946789 TGGTGTTTTCCCAACCTTCTTGG + Intronic
1090060647 11:123461568-123461590 AGCTGTCTCAACAACCAGCTGGG - Intergenic
1090563857 11:127964876-127964898 TGATGCTTCACCAGCCATCTAGG - Intergenic
1090707312 11:129350439-129350461 TGGTGTTTTACCAGCTATCTGGG - Intergenic
1091068182 11:132537040-132537062 TGGTCTTTCAGCAACAAGTTGGG + Intronic
1091232103 11:133995094-133995116 TATTGTTTGACCAAACAGCTGGG + Intergenic
1091777913 12:3196769-3196791 TGTTGTTTCCCCTACCTGCTGGG + Intronic
1092012842 12:5129811-5129833 TAGTGTTTGACCAAACAACTAGG + Intergenic
1092314543 12:7396494-7396516 TGGTGTTTGACCAAATAACTGGG - Intronic
1092870464 12:12801417-12801439 TGGGGTTTCACCATCCAGGCTGG - Intronic
1092949339 12:13486854-13486876 TGGTGCTCCATGAACCAGCTTGG - Intergenic
1094221172 12:27995214-27995236 TGGTGTTTGACCAAACAACTGGG - Intergenic
1095444611 12:42271610-42271632 TGGGGTTTCACCAACATGGTTGG + Intronic
1097685373 12:62686127-62686149 AGGTTTCTCACCAACCACCTGGG + Intronic
1099111171 12:78563173-78563195 TGGTGTTTGAGCAAACAACTGGG - Intergenic
1102405687 12:112672396-112672418 TGGTATTTGACCAAACAACTGGG + Intronic
1102435650 12:112921226-112921248 TGATGTTTCACCAGCTATCTTGG + Intronic
1102939596 12:116927740-116927762 TGGTGCTTCACAAAGCAGCAGGG - Intronic
1106079928 13:26491877-26491899 TGGTGTTTGACCAAATATCTGGG + Intergenic
1107260324 13:38482650-38482672 TGATGTTTAACCAAGCAACTGGG + Intergenic
1107543862 13:41418350-41418372 TGGTGTTTTATCACACAGCTGGG + Intergenic
1107672385 13:42759452-42759474 TAGTGTTTGACCAAACAACTGGG + Intergenic
1107680639 13:42846230-42846252 TAGTGTTTGACCAAACAACTGGG - Intergenic
1107996496 13:45866007-45866029 TGGTGTTTGACCAAATATCTGGG + Intergenic
1108259546 13:48643103-48643125 TGGTGATTGACCAAACAGTTGGG + Intergenic
1111261716 13:85749260-85749282 TGGTGTTTGACCAAACAACTGGG + Intergenic
1112436899 13:99396939-99396961 CAGTGTTTGACCAAACAGCTGGG - Intergenic
1112647463 13:101350659-101350681 TGGTGTTCAACCAAACAGCCAGG - Intronic
1113066839 13:106381425-106381447 TAGAGTTTGACCAAACAGCTGGG + Intergenic
1114830920 14:26140483-26140505 TAGTGTTTGACCAAACAACTTGG - Intergenic
1117107436 14:52412188-52412210 TGGTGTTTGATCAAACAACTAGG + Intergenic
1117145373 14:52832160-52832182 TGGTGTTTCACCAAACAACTGGG - Intergenic
1117442620 14:55774146-55774168 TAATGTTTCACCAAACATCTGGG - Intergenic
1117891917 14:60431210-60431232 TGGTGTTTCACCAAACAACTGGG - Intronic
1119619407 14:76120494-76120516 TGGTGCTTGACCAAACAACTGGG - Intergenic
1119680385 14:76588026-76588048 TAGTGTTTGACCAAACAACTAGG - Intergenic
1119777639 14:77258586-77258608 TGGAATTTCACCAACCAACAAGG + Exonic
1120902411 14:89587314-89587336 TGGTGTTTGACCAAATACCTGGG + Intronic
1124479237 15:30063375-30063397 TGATGTTTGACCAAACAACTGGG - Intergenic
1124924523 15:34058249-34058271 TGGTGTTTGACAAAACAACTGGG + Intronic
1124933294 15:34144760-34144782 CGGGGTTTCACCAACCAGGCTGG + Intronic
1126919224 15:53502245-53502267 TGGTGTTTGACCAAACAACTTGG + Intergenic
1127090172 15:55458883-55458905 TGGTGTTTCACCATCTTGGTTGG - Intronic
1127123481 15:55790772-55790794 TGGTGTTTGTGCAAGCAGCTGGG + Intergenic
1128235422 15:66064045-66064067 TGGCGTTTCATCAACGTGCTAGG - Intronic
1128618077 15:69125983-69126005 TGGCTTTTCACCAACCAGTATGG - Intergenic
1130789375 15:87136008-87136030 TGGTGTTTGAACAGACAGCTGGG + Intergenic
1133039267 16:3051527-3051549 TGGTGTTTCACCAACCAGCTGGG + Intronic
1133677251 16:8085810-8085832 TGTTGTTTCATCAACCTGATAGG - Intergenic
1133678155 16:8095374-8095396 TAATGTTTCACCAAACATCTGGG + Intergenic
1135590890 16:23704720-23704742 TGGTTATTTACCAACCAGTTGGG + Intronic
1137343227 16:47630682-47630704 TAGTGTTTGACCAAATAGCTGGG - Intronic
1140557922 16:75942884-75942906 TGCTGTTTGACCAAGCAACTGGG - Intergenic
1143743361 17:8971123-8971145 TGGTTTTTCACCATCCCTCTTGG + Intergenic
1148915475 17:50973618-50973640 TGGTGTTTGACCAAATATCTGGG - Intronic
1149201436 17:54190257-54190279 TGGTGTTTGGCCAAACAACTGGG + Intergenic
1149321222 17:55483386-55483408 TGGTGTTTGACCAAATATCTGGG - Intergenic
1150678399 17:67264556-67264578 TGGAGCTTGAGCAACCAGCTTGG + Intergenic
1153914007 18:9729672-9729694 TGGTATTAAAGCAACCAGCTAGG - Intronic
1155059177 18:22213363-22213385 TGGTGTTTGATCAAGCAACTAGG + Intergenic
1155198240 18:23495174-23495196 TAGTGTTTGACCAAACACCTGGG + Intergenic
1155743200 18:29316163-29316185 TGGTGTTTGACCAAACAACTGGG - Intergenic
1155981498 18:32184896-32184918 TGGTGTTTGACCAAACATCTGGG - Intronic
1157669718 18:49518093-49518115 TAATGTTTCACCAACTATCTGGG + Intergenic
1158781873 18:60662527-60662549 TGGTGCTGGACCAGCCAGCTCGG + Intergenic
1159567411 18:70067972-70067994 TTGTGTTTCCCCAACCACATGGG - Intronic
1161836649 19:6652115-6652137 GGGTGTTTCACCCACAAGCCAGG - Intergenic
1166703934 19:44897930-44897952 TGGTGATTCAACAACCAGTGGGG + Intronic
928092242 2:28382033-28382055 AGGTCTTCCACCTACCAGCTGGG - Intergenic
929016565 2:37503302-37503324 TGGTGTTTGACCAAACAACTGGG - Intergenic
930457430 2:51623319-51623341 TGGTGCTTCACCAAGCAACTAGG - Intergenic
933208352 2:79536316-79536338 TGGTTTGTCACCATCCAGATTGG + Intronic
935327749 2:101952989-101953011 TGATGTTTCACCAACTATCTGGG + Intergenic
935422155 2:102880434-102880456 TGATGTTTTACCAAATAGCTGGG + Intergenic
935600445 2:104916848-104916870 TGGTGTTTTACCAACTATCTGGG - Intergenic
935815315 2:106841920-106841942 TAGTGTTTGACCAACCAGCTGGG - Intronic
936288300 2:111198717-111198739 TGGTGCTTGACCAAACAGCTGGG + Intergenic
936580841 2:113699147-113699169 TAAGGTTTAACCAACCAGCTGGG + Intergenic
936867979 2:117098530-117098552 TGCTGTTTGACCAAACAGCTGGG - Intergenic
937797949 2:126047746-126047768 TGGTGTTTGACCAACTATCTGGG + Intergenic
938141378 2:128797530-128797552 TGGTGTTTGACCAAACAGCTGGG + Intergenic
939133477 2:138266131-138266153 TGGTACTTGACCAAACAGCTAGG + Intergenic
940296290 2:152128524-152128546 TGGTGTTTCATCAGCATGCTGGG - Intronic
941059648 2:160831635-160831657 TGGTGTCTGACCAAACAACTGGG + Intergenic
943665266 2:190602509-190602531 TGGTGTTTGACCAAACAACTGGG + Intergenic
944192365 2:197017036-197017058 TGATTTTTCACCTACCAGATTGG + Intronic
945171323 2:206999064-206999086 TAGTGTTTCCCTAACCATCTGGG - Intergenic
945339950 2:208640519-208640541 TGGTGCTTGACCAAACAACTGGG - Intronic
945466587 2:210176569-210176591 TGGGGTTCCACCAGCCATCTGGG - Intergenic
946101452 2:217328247-217328269 TGGGGTTTGACCAAACAACTAGG + Intronic
947767194 2:232645333-232645355 TGCTGTTTCACCACCCAGAAGGG - Intronic
947853598 2:233307996-233308018 TGATTTGTCACCAACCAGGTGGG - Exonic
948069923 2:235112444-235112466 TGGTGTTTGACCAAACAACCAGG - Intergenic
948619160 2:239223182-239223204 ATGTGTTTCACCTAACAGCTGGG + Intronic
1168788032 20:556676-556698 TGGGGTTTCACCATCTAGCCAGG - Intergenic
1169511214 20:6266326-6266348 TTGTGTTTGACCAAACAACTGGG + Intergenic
1169596318 20:7203733-7203755 TGGTGTTTGACCAAACACCTGGG + Intergenic
1170718885 20:18857737-18857759 TGGTGTCTGACCAAACAACTGGG + Intergenic
1173193799 20:40897070-40897092 TGGTCCTTCCCCAACCACCTGGG + Intergenic
1176916586 21:14633142-14633164 TGGTGTTTCACTAAATATCTGGG - Intronic
1177000079 21:15601483-15601505 TAGGGTTTTACCAACCAACTGGG - Intergenic
1177860814 21:26451630-26451652 TAGTGTTTGACCAAACAGCTGGG + Intergenic
1178366187 21:31990880-31990902 TGGTGTTTGGCCAAACAACTGGG + Intronic
1178601392 21:33997813-33997835 TGGTGTTTGACCAAATATCTGGG + Intergenic
1178728848 21:35080440-35080462 TGGTGTTTGACCAAACAACTAGG + Intronic
1184925662 22:47635066-47635088 TGGTGTTTGACCAACCAACTGGG - Intergenic
949267656 3:2177845-2177867 TAGTGTTTGACCAAACAACTGGG + Intronic
951099749 3:18673511-18673533 TGGTGTTTGACCAAACAACTGGG + Intergenic
951529268 3:23683580-23683602 TAGTGTCTGACCAAACAGCTGGG + Intergenic
951768815 3:26231776-26231798 TGGAGTTTCTCCAACCAGGCTGG - Intergenic
953129050 3:40120301-40120323 TCTTGTTCCAACAACCAGCTAGG + Intronic
953644240 3:44739310-44739332 TGATGTTTGACCAAACATCTGGG - Intronic
953965182 3:47299193-47299215 TGGTGTTTGACCAAACAACTGGG - Intronic
956103865 3:65796396-65796418 TGGTGTTTCACCAAATACCTGGG + Intronic
957413016 3:79864591-79864613 TGGTGTTTGACCAAACAACTGGG + Intergenic
957934480 3:86924889-86924911 TGGTGTTTGACCAAATACCTGGG - Intergenic
959135383 3:102412225-102412247 TGGTGTTTGAACAAACAGCTGGG + Intronic
959420748 3:106125044-106125066 GGCTTTTTCACTAACCAGCTTGG - Intergenic
959983464 3:112545836-112545858 TGGTGTTTGACCAAACATCTGGG - Intronic
961527749 3:127517791-127517813 TGGGGTTCTACCACCCAGCTGGG - Intergenic
961581645 3:127888119-127888141 TCATGTTTTACCAACCATCTGGG + Intergenic
962654376 3:137528153-137528175 TGGTGTTTGACCAAACAACTGGG - Intergenic
963168558 3:142228673-142228695 TGGTGTTTGACCGAACAGCTGGG + Intergenic
963301281 3:143599964-143599986 TGGCGTTTTACCTACCAGCCCGG + Intronic
963548163 3:146686853-146686875 TGCTTTTTCACCATCTAGCTTGG - Intergenic
966834709 3:184040278-184040300 TGGGGTTGCAGCATCCAGCTGGG - Intergenic
966902391 3:184496089-184496111 TGATGTTTCACCAAACAATTGGG - Intronic
967296832 3:187973605-187973627 GGGTGTTTCACCAGCCAGGCTGG - Intergenic
969271670 4:6107421-6107443 TGGTGTTTGACCAAACGACTGGG - Intronic
969928185 4:10604863-10604885 TGGTGTTTGAACAAACAACTGGG - Intronic
970362668 4:15325532-15325554 TGATGTTTGACCAAACAACTGGG + Intergenic
971223335 4:24729116-24729138 TGGTGTTTGATGAAGCAGCTGGG - Intergenic
972354657 4:38269149-38269171 TGGTGTGTCAAGAACCATCTAGG + Intergenic
972770739 4:42194624-42194646 TAGTGTTTTACCAAACACCTGGG - Intergenic
974130681 4:57751843-57751865 TGGTGTTTGACCAAATATCTGGG + Intergenic
974852706 4:67422765-67422787 TGATGTTTGACCAAACAACTGGG - Intergenic
975608119 4:76176600-76176622 TAGTGTTTGACCAAACAACTGGG - Intronic
978311299 4:107387269-107387291 TGGCGTTTCATCAACCAGAAAGG + Intergenic
979081777 4:116352989-116353011 TGGTATTTGACCAAACATCTGGG + Intergenic
979223709 4:118260450-118260472 TAATGTTTCACCAACTATCTAGG + Intergenic
979961681 4:127027812-127027834 TGGTGTTTAACCAAACAACTAGG + Intergenic
980534845 4:134104567-134104589 GGGTGTTTAACCAACCAAGTTGG - Intergenic
980585226 4:134805150-134805172 AGGTGCTTCACCAAACAACTGGG - Intergenic
980983865 4:139676669-139676691 TGGTGTTTGACCAAACAACTAGG + Intronic
981216382 4:142174219-142174241 TGGTTTGTCACTAACTAGCTTGG + Intronic
981564152 4:146080533-146080555 TGGTGTTTGATCAAACATCTGGG + Intergenic
982127243 4:152195068-152195090 TGGTGTTTGACTAAACAACTGGG - Intergenic
982220793 4:153123566-153123588 TGGTGTTTGACCAAACAACTGGG - Intergenic
983014365 4:162592993-162593015 TAGTGTTTGACCAAACATCTGGG + Intergenic
983273064 4:165586116-165586138 TAGAATTTCACCACCCAGCTGGG - Intergenic
984093160 4:175401190-175401212 TGGTGTTTGACCAAATATCTGGG - Intergenic
984531070 4:180916854-180916876 TACTGTTTCACCAACCATCAAGG + Intergenic
984791473 4:183618840-183618862 TAGTGTTTAACCAAGCAGCTGGG + Intergenic
984918356 4:184743137-184743159 TGGTGTTTGACCAAACAACTGGG + Intergenic
985197672 4:187449655-187449677 TAGTGTTTTACCAAACAGCCAGG + Intergenic
985233877 4:187851649-187851671 TGGTGTTTGGCCAAACAGCTGGG + Intergenic
986367767 5:7051303-7051325 TAGTGTTTAACCAAACAACTGGG - Intergenic
986624658 5:9712357-9712379 TGGTGTTTGACCAAACTACTGGG - Intronic
986964480 5:13253962-13253984 TAGTGTTTGACCAAACAACTGGG - Intergenic
987388863 5:17356562-17356584 TAGTGTTTAACCAAACAACTGGG + Intergenic
987542071 5:19269150-19269172 TGGTGTTTGATCAAACAACTGGG + Intergenic
987606736 5:20145601-20145623 TGGTGTTTTACCAAACAACTGGG + Intronic
989399808 5:40996875-40996897 AGATGTTTCCCCAAACAGCTTGG + Intergenic
991121756 5:63024039-63024061 TAGTGTTTGACCAAACAACTGGG - Intergenic
991392498 5:66162111-66162133 TGGTGTTTCACTTAGCAGTTTGG + Exonic
994685675 5:102948128-102948150 TGGTGTTTGACCAAACAACCAGG + Intronic
996842073 5:127857930-127857952 TAGTGTTTGACCAAACAACTGGG + Intergenic
999532315 5:152477398-152477420 TAGTGTTTCACCAAACAGCTGGG - Intergenic
1000116511 5:158159128-158159150 TAGCGTTTGACCAAACAGCTGGG + Intergenic
1001198381 5:169694000-169694022 CGGTGTTTGACCAAACAGCTAGG + Intronic
1001294170 5:170487356-170487378 TGGTGTTTGACCAAACAACTGGG + Intronic
1001434717 5:171691225-171691247 TAATGTTTCACCAAACATCTGGG + Intergenic
1002036637 5:176475914-176475936 TAATGTTTTAACAACCAGCTTGG + Intronic
1002616916 5:180461706-180461728 TGGTGGTTCACCAAGCTCCTGGG + Intergenic
1004321476 6:14634788-14634810 TGGTGTTTGACCAAATATCTGGG - Intergenic
1004723813 6:18291893-18291915 TGATGTTTGACCAACTATCTGGG + Intergenic
1004971498 6:20915594-20915616 TGGTGTTTGACCAAACAACTGGG + Intronic
1008609014 6:53168767-53168789 TGGTGTTTGACCAAATATCTAGG - Intergenic
1009414703 6:63402739-63402761 TGGTGTTTGCCCAAACATCTGGG - Intergenic
1011193166 6:84754685-84754707 TGGTGTTTGACCAAGTATCTGGG - Intronic
1011307364 6:85943103-85943125 TAGTGTTTAACCAAACAACTGGG - Intergenic
1013229181 6:108146063-108146085 TGGTGTTTGGCCAAACAACTGGG - Intronic
1014307961 6:119766058-119766080 TGGCATTTCACCAACCAGAAAGG - Intergenic
1014781452 6:125569679-125569701 TGGTGTTTGACCAAATATCTGGG - Intergenic
1015962528 6:138664993-138665015 TGATGTTTGACCAAACATCTGGG + Intronic
1016216538 6:141610437-141610459 TGGTGTTTGATCAAACAACTGGG - Intergenic
1016722073 6:147310905-147310927 TGGTATTTGACCAAACAGCTGGG + Intronic
1017668023 6:156740236-156740258 TGATGTTTAACCAACTATCTGGG + Intergenic
1018653703 6:166011996-166012018 TGCTGTTTCTCCAACACGCTGGG - Intergenic
1018748771 6:166782996-166783018 TGGTGTTTGACCAAACAACTGGG - Intronic
1018858936 6:167697059-167697081 TGCTGTTACACGAACCAGCAGGG + Intergenic
1019041760 6:169111621-169111643 TAGTGTTTGACCAAACAGCTGGG + Intergenic
1021126352 7:16854577-16854599 TGGTGTTTCCCCACCCATCATGG + Intergenic
1022682159 7:32559050-32559072 TGATGTTTCACATACCAACTTGG + Exonic
1023699622 7:42879507-42879529 TAGTGTTTAACCAACTATCTGGG + Intergenic
1023870783 7:44262053-44262075 TGATGCTTCACCAATGAGCTGGG - Intronic
1024315736 7:48015053-48015075 TGGTGCTTGACCAAACATCTGGG + Intronic
1024928040 7:54638513-54638535 CCATGTTTCTCCAACCAGCTGGG - Intergenic
1026191180 7:68129238-68129260 TAGTGTTGAACCAAACAGCTGGG + Intergenic
1027122694 7:75533265-75533287 TGGTGATTGACCAGCCAGCGTGG - Intergenic
1028508501 7:91596132-91596154 TGGTGTTTAACCAAATAACTGGG + Intergenic
1028515759 7:91676586-91676608 TAGTGTTTGACCAAACAACTGGG + Intergenic
1029795243 7:102887788-102887810 TGGTGTTTGACCAAACAACTAGG + Intronic
1031380777 7:121083454-121083476 TGGTGCTATACAAACCAGCTTGG - Intronic
1032547222 7:132754009-132754031 TGGTGTTTGACCAAACGGCTGGG - Intergenic
1033455702 7:141501515-141501537 TGGTGTTTGACCAAATATCTGGG - Intergenic
1033845402 7:145426122-145426144 TGGTGTTTGACCAAAGAACTGGG - Intergenic
1034789362 7:153954116-153954138 AAGTGTTTGACCAAACAGCTGGG + Intronic
1035043969 7:155952102-155952124 GGCTGTGTCACCAACCAGCCAGG - Intergenic
1036921961 8:12864802-12864824 TAGTGTTTGACCAAACATCTGGG + Intergenic
1037103203 8:15073499-15073521 TGGTGTTTGGCCAAGCATCTGGG - Intronic
1037596533 8:20358851-20358873 TGTTGTTTCACCAATTATCTAGG - Intergenic
1037635055 8:20694131-20694153 TGGTGTTTGGCCAAACAACTGGG - Intergenic
1038522622 8:28246333-28246355 TGGTGTTTGGCCAAACAACTGGG - Intergenic
1038707281 8:29906399-29906421 TGGTGTTTGACCAAATATCTGGG + Intergenic
1040668918 8:49663343-49663365 TTGTGTTTGACCAAATAGCTGGG - Intergenic
1040675515 8:49744604-49744626 TGGTCTTTGACCAAACAACTGGG - Intergenic
1040995595 8:53398232-53398254 TAGTGTTTGACCAAACAACTGGG + Intergenic
1043678945 8:82997143-82997165 TGGTCTTTCTCCATCCACCTTGG + Intergenic
1044639356 8:94362189-94362211 TAGTGTTTGACCAAACAACTGGG - Intergenic
1045018391 8:98019553-98019575 TGGTGTTTGACCAAACAACTGGG + Intronic
1045688277 8:104734374-104734396 TAGTATTTAACCAAACAGCTGGG + Intronic
1050948889 9:11562794-11562816 TGGGGTTTCACCATCCATGTTGG + Intergenic
1051345093 9:16144231-16144253 TGGTGTTTGTCCAAACAACTGGG + Intergenic
1051547118 9:18289361-18289383 TGATGTTTAACCAAGTAGCTGGG + Intergenic
1052957300 9:34263336-34263358 TGGTGTTTCCCAATCTAGCTTGG - Intronic
1056332818 9:85535785-85535807 TTCTGATTCAACAACCAGCTGGG - Intergenic
1056484322 9:87040231-87040253 TGGTGTTTAACCAAACATGTGGG - Intergenic
1056509276 9:87287594-87287616 TGGTTCTTCAGCAACCATCTGGG - Intergenic
1056678895 9:88699862-88699884 TGGTGTTTGACCAAACAACTGGG - Intergenic
1057184534 9:93049569-93049591 TGGTGCTTCAGCACTCAGCTCGG - Intergenic
1057624151 9:96662590-96662612 TGGTGTTTGACCAAACCCCTGGG + Intergenic
1058180086 9:101787029-101787051 TGGTGTTTGACCAAACAAGTGGG + Intergenic
1058393050 9:104519451-104519473 TGGTATTTGACCAAACAACTGGG + Intergenic
1059210323 9:112508675-112508697 TGTTGTTTCACCTCCTAGCTAGG - Intronic
1059564736 9:115372385-115372407 TACTGTTTCACCAAACAACTGGG - Intronic
1061513774 9:131076686-131076708 TGGTCTATAACCAATCAGCTAGG - Intronic
1186241920 X:7577510-7577532 AGATGTTTCAGCAAACAGCTTGG - Intergenic
1186683134 X:11896809-11896831 TGGTGTTTCTCAAACCAGAAAGG + Intergenic
1187049176 X:15679072-15679094 TGGTATTTGACCAAACATCTGGG + Intergenic
1187985140 X:24802236-24802258 TGGTGTTTGACCAAATATCTGGG + Intronic
1188447080 X:30265729-30265751 TGATGTTTGACCAAACACCTGGG - Intergenic
1188581639 X:31721269-31721291 TGGTGTTTGACCAAACAACTGGG - Intronic
1189425038 X:40892107-40892129 TGGTGTTTGAGCAAACAACTTGG + Intergenic
1189819452 X:44856417-44856439 TAGTGTTTGACCAAGCAACTGGG - Intergenic
1194746855 X:97637585-97637607 TGGTGTTTGACCAAACAGTTGGG + Intergenic
1195031922 X:100934592-100934614 TGGTGTGTGACCAAACAACTGGG + Intergenic
1197829151 X:130623123-130623145 TGGTGTTTGACCAAGCAACTGGG + Intergenic
1198220206 X:134592374-134592396 AGGTGTTTCACCAAATATCTGGG - Intronic
1198845876 X:140909936-140909958 TGGTGTTTGACCAATCAACTGGG - Intergenic
1200341411 X:155400817-155400839 AGGTATTTGACCAACCATCTGGG + Intergenic
1201461961 Y:14235690-14235712 AGATGTTTCAGCAAACAGCTTGG - Intergenic