ID: 1133041749

View in Genome Browser
Species Human (GRCh38)
Location 16:3064719-3064741
Sequence CACGCTGCCCACATTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133041740_1133041749 4 Left 1133041740 16:3064692-3064714 CCCAGCTCCGGGCCCTCAGAAGG No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data
1133041745_1133041749 -9 Left 1133041745 16:3064705-3064727 CCTCAGAAGGACCCCACGCTGCC No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data
1133041742_1133041749 3 Left 1133041742 16:3064693-3064715 CCAGCTCCGGGCCCTCAGAAGGA No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data
1133041744_1133041749 -8 Left 1133041744 16:3064704-3064726 CCCTCAGAAGGACCCCACGCTGC No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data
1133041737_1133041749 16 Left 1133041737 16:3064680-3064702 CCTGAACAGAATCCCAGCTCCGG No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data
1133041743_1133041749 -3 Left 1133041743 16:3064699-3064721 CCGGGCCCTCAGAAGGACCCCAC No data
Right 1133041749 16:3064719-3064741 CACGCTGCCCACATTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133041749 Original CRISPR CACGCTGCCCACATTGACCT TGG Intergenic
No off target data available for this crispr