ID: 1133041957

View in Genome Browser
Species Human (GRCh38)
Location 16:3065596-3065618
Sequence GGTTTTATGGGGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133041957_1133041965 -3 Left 1133041957 16:3065596-3065618 CCCCCCACTTTCCCCATAAAACC 0: 1
1: 0
2: 0
3: 23
4: 276
Right 1133041965 16:3065616-3065638 ACCAGCTGAGTATTTGTGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 101
1133041957_1133041969 30 Left 1133041957 16:3065596-3065618 CCCCCCACTTTCCCCATAAAACC 0: 1
1: 0
2: 0
3: 23
4: 276
Right 1133041969 16:3065649-3065671 GCAGAAGGTGACTGTCTCAGTGG 0: 1
1: 0
2: 0
3: 20
4: 229
1133041957_1133041968 15 Left 1133041957 16:3065596-3065618 CCCCCCACTTTCCCCATAAAACC 0: 1
1: 0
2: 0
3: 23
4: 276
Right 1133041968 16:3065634-3065656 CCAGGAAGACTGCGTGCAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133041957 Original CRISPR GGTTTTATGGGGAAAGTGGG GGG (reversed) Exonic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901493068 1:9606438-9606460 AGTTTTATAAGGAAAGTGTGGGG - Intronic
903332765 1:22604547-22604569 GGTTTTGTGGGGAAAGGGCCTGG - Intergenic
905255254 1:36677531-36677553 GAATTTATGGGCGAAGTGGGTGG + Intergenic
905326249 1:37154019-37154041 GGTTTTCTGGGCAAAGAGGGAGG - Intergenic
905978894 1:42204709-42204731 GGGTTTATGGGGCAGTTGGGGGG - Intronic
906054341 1:42903166-42903188 AGTTTGAAGGGGAAGGTGGGAGG - Intergenic
906167363 1:43696782-43696804 GGTGCTATGAGGAAATTGGGGGG + Intronic
908929692 1:69303836-69303858 GGTTCTATGAGAAAATTGGGTGG - Intergenic
909328523 1:74383457-74383479 AGTTTTATGGAGAAAGTGTGAGG - Intronic
910624820 1:89295209-89295231 GGTTTGACTGGGAAAGTGAGAGG + Intergenic
910837282 1:91528507-91528529 CATTTTATGGGGAAGTTGGGTGG - Intergenic
911485340 1:98498137-98498159 GGTTTTATGGGCAAATTGGTGGG - Intergenic
914875044 1:151507127-151507149 GGTTTTGTGGGGAGACTGGTGGG - Intergenic
915938587 1:160103844-160103866 GGTGGTATGGGGAAAGAGGGAGG + Intergenic
916457052 1:164981804-164981826 AGTTTTTTGGGGGGAGTGGGGGG - Intergenic
918456336 1:184720797-184720819 GTTTTTTTGGGAAAAGTGGGAGG - Intronic
922988709 1:229886697-229886719 GGTTTTCGGTGGTAAGTGGGTGG + Intergenic
924019803 1:239769144-239769166 TGTTCTATAGGGAAAGTGGCAGG + Intronic
924284805 1:242475489-242475511 GGTTTTATGTGAAAAGTTGTTGG - Intronic
1065838898 10:29683811-29683833 GGTTCTCTGGGGCAAGTTGGGGG - Intronic
1068209138 10:53897698-53897720 GGGTTTAGGGGTGAAGTGGGAGG - Intronic
1070845153 10:79516001-79516023 GATTTTATGGGGAAAGCAGCTGG + Exonic
1070928644 10:80244307-80244329 GATTTTATGGGGAAAGCAGCTGG - Intergenic
1072726060 10:97814949-97814971 GGGTTGATGGGGGAAGCGGGTGG - Intergenic
1073059015 10:100722377-100722399 GCCTTTTTGGGGAAAGTGGGGGG + Intergenic
1073079171 10:100846924-100846946 GGTTTGATGGCCAAGGTGGGCGG + Intergenic
1075978172 10:126714826-126714848 GGTTTTATGTGGTTAGGGGGTGG + Intergenic
1076708903 10:132320381-132320403 GGTTTTAAAGGGACAGTGAGGGG + Intronic
1077059313 11:610775-610797 GGGAACATGGGGAAAGTGGGAGG - Intronic
1078880556 11:15444805-15444827 GGTTTTGTGGGGAATGGGGAGGG - Intergenic
1080934272 11:36845545-36845567 GGTTTGAGTGGGTAAGTGGGAGG + Intergenic
1081868498 11:46372526-46372548 GGTTTTGTGGGGGACATGGGGGG + Intronic
1082127009 11:48445237-48445259 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1082560590 11:54616218-54616240 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1083848675 11:65352497-65352519 GGTTTTGTGGGGAGAGGGGAAGG + Exonic
1084195891 11:67523464-67523486 GGTTTTGTGGGGAAGATCGGGGG + Intergenic
1087070410 11:94074150-94074172 GGTTTTGTGGTGATAGTGAGGGG + Intronic
1088151272 11:106748115-106748137 GATTTTGAGGGTAAAGTGGGTGG + Intronic
1089399550 11:118156560-118156582 GGGTTTATGGGGGAAGAGGAGGG - Intergenic
1090682435 11:129076198-129076220 GGTTTTCTAGGGAAAAAGGGTGG - Intronic
1091847759 12:3670394-3670416 GGTTTTAGAGAGGAAGTGGGAGG - Intronic
1093231301 12:16546330-16546352 GGCTTTACGGGCAAAGTGGTTGG - Intronic
1093260017 12:16924413-16924435 GGTTTTTGGGGGATTGTGGGGGG - Intergenic
1096247913 12:50005115-50005137 GATTTTGTGGGGAGAGTAGGTGG - Intronic
1096521469 12:52187035-52187057 AGTGTGATGGGGAAAGTGGTGGG - Intronic
1098770163 12:74541151-74541173 TGTGTTATGGGGGAAGGGGGGGG + Exonic
1100107809 12:91198307-91198329 GGTTTTCTGGAGACAGTTGGAGG - Intergenic
1100581188 12:95942478-95942500 GGCGTTGTGGGAAAAGTGGGCGG + Exonic
1101526785 12:105538296-105538318 GGTCTGGTGGGGAAACTGGGGGG + Intergenic
1102317759 12:111903758-111903780 GGTTTTATTGGGAAGTTGGGAGG - Intergenic
1103108316 12:118251093-118251115 GGCTTTATAGGGAAAGGGGATGG + Intronic
1103967333 12:124648091-124648113 GGATTTATGGAAACAGTGGGGGG - Intergenic
1106464365 13:29999644-29999666 GGATTTATTGGGAAAGGAGGAGG - Intergenic
1106543113 13:30707482-30707504 GATTTTCTGGTGCAAGTGGGTGG - Intergenic
1108097964 13:46924401-46924423 GGTTTTTTGGGGGAGGTGGGTGG - Intergenic
1108557532 13:51609609-51609631 GGTTTTTTGGGGAGGGCGGGGGG - Intronic
1108589863 13:51903552-51903574 GGTGTTCTGGGGAGAGTAGGGGG - Intergenic
1108954076 13:56129265-56129287 GCTTTTTTGGGGGAGGTGGGTGG + Intergenic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1110216372 13:73029100-73029122 GCTTTTCTGGGTAATGTGGGAGG - Intergenic
1110906150 13:80892298-80892320 TGTTTCATGGGGAAAGAAGGGGG + Intergenic
1111396025 13:87671626-87671648 GGGTTTCTGGGGGAAGGGGGGGG - Intergenic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1114291120 14:21289326-21289348 GGTTTTTTGGGGGAGGGGGGTGG - Intronic
1115092837 14:29598933-29598955 GGTTTTAAGGGAAAAATGGAAGG + Intronic
1118550623 14:66945599-66945621 GGTTTTTTGGGGGAAGCAGGTGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121219531 14:92275262-92275284 GGGTTCCTGGGGAAAGTGTGGGG - Intergenic
1121956400 14:98217515-98217537 GGTTTCAGGGGGAAAGGGAGAGG - Intergenic
1122310778 14:100792729-100792751 GGTTTTCTGGAGAAAGTCAGGGG + Intergenic
1124989995 15:34663268-34663290 GGCTTTAAGAGGGAAGTGGGTGG + Intergenic
1125132078 15:36294484-36294506 TGTGTTATGGGGAAAGGGGAGGG + Intergenic
1126031485 15:44503926-44503948 GCTTTTATGGGAAAAGTTGGGGG + Intronic
1126557153 15:50001837-50001859 GATTTTATAGGGAAAATGAGAGG - Intronic
1126653258 15:50948488-50948510 TGCTTTTTGGGGAAAGTGGAGGG + Intronic
1127028281 15:54832865-54832887 GGTTTTCTTGGGAGAGTGTGGGG - Intergenic
1128446988 15:67771468-67771490 AGTTTTATGGAGACAGAGGGAGG + Intronic
1128917126 15:71573131-71573153 GGGTTTCTGGGGAGAGTTGGTGG + Intronic
1129219402 15:74122781-74122803 GCTTTGATGGGGACAGTGGAGGG + Intronic
1131340141 15:91591239-91591261 GGATTGATGGAGAAAGTGGTGGG + Intergenic
1131759808 15:95609923-95609945 GGTTTAGTGGGGGATGTGGGAGG - Intergenic
1132399093 15:101494422-101494444 GGTTTGTTGGGGACGGTGGGAGG - Intronic
1132890748 16:2203403-2203425 GCTTTTATGGGGGATGGGGGTGG + Intergenic
1132973090 16:2698425-2698447 GGTTTTATTGGGAAGAGGGGCGG + Intronic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133479705 16:6158244-6158266 GGTATTTTGCTGAAAGTGGGTGG + Intronic
1133831839 16:9330473-9330495 GGTTTTGTGGGGAGAGTGAGGGG + Intergenic
1134676259 16:16092687-16092709 GGTTTTAAAGGAAAAGTTGGTGG + Intronic
1135244101 16:20839577-20839599 GGTTCTTTGGGGAAGGTGTGTGG + Intronic
1137732182 16:50697238-50697260 GCTTTGATGGGGGAAGAGGGTGG + Exonic
1138894214 16:61183328-61183350 GTTTTTATACGAAAAGTGGGAGG + Intergenic
1139145512 16:64320018-64320040 GACTTTGGGGGGAAAGTGGGAGG - Intergenic
1141740383 16:85887820-85887842 AGTATTGTGGGGAGAGTGGGAGG - Intergenic
1148164309 17:45472354-45472376 GCTATTATGGGGAAACTGGAGGG - Intronic
1149355060 17:55831134-55831156 GCTTTTGGAGGGAAAGTGGGAGG - Intronic
1149753408 17:59167642-59167664 AGTTTTCTGGGGAAAGGGTGGGG + Intronic
1150301362 17:64049769-64049791 GGTTTCATGGGATAAGTGAGAGG - Intronic
1152026878 17:77815683-77815705 GTTGTTATGGGGCCAGTGGGAGG - Intergenic
1152049007 17:77958465-77958487 GGTATTAAGGGGAAAGGAGGAGG + Intergenic
1153933245 18:9897416-9897438 GGATTAACGTGGAAAGTGGGAGG + Intergenic
1154406553 18:14097047-14097069 GGTTTGATGGAGAAGGTGGTTGG - Intronic
1155165297 18:23227253-23227275 AATTTTCTGGGGAAAGTGGGTGG - Intronic
1155873516 18:31055993-31056015 AGGTCTCTGGGGAAAGTGGGTGG + Intergenic
1156427973 18:37036689-37036711 GTTTTCATGTGGAAAGAGGGTGG - Intronic
1157737845 18:50066286-50066308 GTTTGTATGGGGATAGTGGTAGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159556308 18:69948988-69949010 GGTTTTATAGAAAAAGTGGGGGG + Intronic
1161946578 19:7440981-7441003 GGTTTCATGGTCAAGGTGGGAGG - Intronic
1162332552 19:10039112-10039134 GGTTCTGTGGGGATAGGGGGTGG - Intergenic
1162434382 19:10648394-10648416 GGTGTGATTGGGAGAGTGGGTGG + Intergenic
1162765113 19:12914519-12914541 GCTTTTATGGGGGGTGTGGGGGG - Intronic
1163302337 19:16455889-16455911 GGTTTTATGCGAAGGGTGGGGGG - Intronic
1163926839 19:20353907-20353929 AGGTTTATGGGGAAGCTGGGTGG + Intergenic
1164881794 19:31738963-31738985 GGCCCTATGGGGAAAATGGGTGG + Intergenic
1165936948 19:39395154-39395176 GGTTTTGAAGGAAAAGTGGGAGG + Intronic
1167666010 19:50823144-50823166 GGTTTTCTGGTGAAATTTGGGGG + Intronic
1168378666 19:55901870-55901892 TGTGGGATGGGGAAAGTGGGAGG - Intronic
925347745 2:3182841-3182863 GGTTGGATGGGGTAAGTGGGTGG - Intergenic
925347782 2:3182966-3182988 GGTTGGATGGGGTGAGTGGGTGG - Intergenic
926645457 2:15285973-15285995 GGTATTTTGGGGGAAGTGTGAGG - Intronic
930098677 2:47586525-47586547 GGTTTTAGTGGGAGAGTAGGTGG + Intergenic
930533160 2:52615248-52615270 GTTTTTATGGGTACAGTGTGGGG - Intergenic
931113443 2:59138554-59138576 GGTTATAGTGGGAAAGAGGGTGG - Intergenic
932395135 2:71439473-71439495 TTTTATATGGGGAAAGTTGGGGG + Intergenic
932400447 2:71477218-71477240 GGTTTTATGGGGCAATGGAGAGG + Intronic
932961388 2:76416021-76416043 GTTTTTATGGGGTTTGTGGGAGG - Intergenic
933928944 2:87128214-87128236 GGTTTTATAGGAAAAGTAGATGG - Intergenic
934000278 2:87704000-87704022 GGTTTTATAGGAAAAGTAGATGG - Intergenic
934150913 2:89146847-89146869 TGCTTTATGGGGAATGAGGGAGG - Intergenic
934216360 2:90035178-90035200 TGCTTTATGGGGAATGAGGGAGG + Intergenic
935809376 2:106782066-106782088 GGTTTTGTGGGGAAAGATTGGGG + Intergenic
935870331 2:107441195-107441217 GGTGGGATGAGGAAAGTGGGAGG + Intergenic
936364001 2:111835187-111835209 GGTTTTATAGGAAAAGTAGATGG + Intronic
937037771 2:118795988-118796010 TGTTTTCTGGGTACAGTGGGGGG - Intergenic
938231168 2:129660429-129660451 GCCTTTATTGGCAAAGTGGGTGG + Intergenic
939527346 2:143313517-143313539 GTTTTTATGGGGGAAATTGGAGG - Intronic
940102503 2:150057577-150057599 GTTTTTAGGGAGAAAGAGGGTGG + Intergenic
940508664 2:154586006-154586028 GGTTTTAAGGGGATAGTAAGGGG + Intergenic
941037095 2:160580430-160580452 GGTTTTAAAGGGAAAATAGGGGG - Intergenic
942560374 2:177212871-177212893 GGTATTAGGGGGAGAGCGGGGGG + Exonic
942701412 2:178715240-178715262 GGCTTTTTGCGGAAAATGGGTGG + Exonic
945188409 2:207163283-207163305 GGTTTTAAGGTGAGAGTGGCTGG + Intronic
945943795 2:215974886-215974908 GGTGTGCTGGAGAAAGTGGGAGG - Intronic
947931630 2:233969593-233969615 TGTATTTTGGGGAAAGTGTGGGG + Intronic
947982887 2:234425433-234425455 GGTTTTATTGGGAATGAGGCCGG + Intergenic
948619299 2:239224090-239224112 GAATTCATGGGGAATGTGGGTGG - Intronic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1169564677 20:6841145-6841167 TGATATATGGGGAAAGTTGGAGG - Intergenic
1169888397 20:10427860-10427882 GGTTTGGTGGGGAAGGTGGTAGG - Intronic
1170812326 20:19684278-19684300 GGTCTTGGGGGGAAAGTGGCTGG - Exonic
1170956916 20:20989536-20989558 GGTTTTGGGGGGAAAGAGGAGGG + Intergenic
1172630780 20:36376854-36376876 GGTGTTGTGGGGAAGGTGGGAGG + Intronic
1173822610 20:46029071-46029093 GGTTTTGGGGGGAGAGCGGGAGG - Intronic
1177459966 21:21397145-21397167 GGTTTTATGGGCTCAGAGGGAGG + Intronic
1177536598 21:22436320-22436342 GGTTTTATGAGGAATTTGAGGGG + Intergenic
1179973728 21:44851125-44851147 GGTTTTATGGGGAATGATGAGGG + Exonic
1180794062 22:18593295-18593317 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181044279 22:20207215-20207237 GGTGTTATGGGGCAGGTGGAGGG + Intergenic
1181227677 22:21402025-21402047 GGCTTTATGGGGAGGGTGGATGG - Intergenic
1181250974 22:21532814-21532836 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181869664 22:25887718-25887740 GGATTTATGGGGACAGGGGAAGG + Intronic
1182420691 22:30247192-30247214 GGCTTTAGGGGGGCAGTGGGAGG + Intergenic
1184617951 22:45650777-45650799 TGTTTGATGGTGACAGTGGGTGG + Intergenic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
950033362 3:9866659-9866681 GGTTTTATCTGGAAGGTTGGAGG - Intergenic
950465358 3:13150004-13150026 GGTTCTAGAGGGAGAGTGGGAGG + Intergenic
950918130 3:16666023-16666045 GGTTTTATGGGGGAATGGAGAGG - Intronic
951348404 3:21574669-21574691 GGATTTAGGGGGTAACTGGGTGG + Intronic
954300196 3:49697126-49697148 GGTTTCCTGGGGAGAGTGAGAGG - Exonic
954414534 3:50386680-50386702 GGTTTCCTGGGGCAAGTGAGAGG - Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
955962030 3:64350479-64350501 TGTTGCATGAGGAAAGTGGGTGG + Intronic
956689248 3:71860898-71860920 GTTTATATGGGGAATGTGGCAGG - Intergenic
957665149 3:83217695-83217717 GGATTTACGGAGAAGGTGGGCGG + Intergenic
957950740 3:87122820-87122842 GGTGTAATGGAGAAAGTGAGAGG + Intergenic
959991321 3:112635455-112635477 AGTTTGATGGGAAAAGTGAGTGG + Intronic
961620945 3:128224489-128224511 GGTTTTATGTGAAAAGTGAAAGG + Intronic
961815997 3:129550704-129550726 GGTTTTATAGGGGAAGAAGGAGG - Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
962658952 3:137581193-137581215 GGTTTTCTGGGAAAAGTATGTGG - Intergenic
963452739 3:145505499-145505521 AGTTGGCTGGGGAAAGTGGGAGG - Intergenic
964277861 3:155026725-155026747 GCTTTTCTGGGGGAGGTGGGGGG - Intronic
964649249 3:158992400-158992422 AGTTATAAGGGGATAGTGGGGGG - Intronic
965166624 3:165202188-165202210 TATTTTAAGGTGAAAGTGGGAGG - Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
966039325 3:175461929-175461951 GGGTTTCTGGGGAGAGAGGGAGG + Intronic
966040927 3:175486973-175486995 GGTTGTATGGGGCAAAGGGGAGG - Intronic
966886038 3:184378665-184378687 GGTGTTATGGGGAAAGGGTTTGG + Intronic
968805506 4:2769080-2769102 GGTTTCATGCTGAAGGTGGGAGG + Intergenic
969222964 4:5773373-5773395 GGTCTTAGGGGGAAGATGGGAGG - Intronic
970530027 4:16971991-16972013 CGATAAATGGGGAAAGTGGGGGG + Intergenic
970798865 4:19948056-19948078 AGTTTTCTGGGGAAGGTGTGGGG + Intergenic
971412753 4:26392646-26392668 GGTTTCCTGGGGATAGGGGGAGG + Intronic
971730649 4:30375335-30375357 TGATTTATGGAGAAATTGGGAGG + Intergenic
972715691 4:41644083-41644105 GAATTTGTGGGGAAAGAGGGCGG - Intronic
976031084 4:80754522-80754544 GTTTTCAAGGGGAAAGTGAGAGG + Intronic
976184687 4:82431520-82431542 GGTTTTCTGAGGAAAGTGAACGG - Intronic
976683992 4:87790106-87790128 GGTTTTGCAGGGAAATTGGGTGG + Intergenic
976703589 4:87998253-87998275 GTTGTTATGGGAAAAGTAGGAGG - Intergenic
977211836 4:94227190-94227212 GTGTTTTTGAGGAAAGTGGGAGG + Intronic
983235661 4:165176634-165176656 GGTTTGAAGGAGAAAGTGAGAGG - Intronic
985056497 4:186040364-186040386 GCTTATATGGGGGAAGTTGGGGG + Intergenic
985132666 4:186755164-186755186 GCTCGTATGGAGAAAGTGGGAGG + Intergenic
985315211 4:188651326-188651348 AATTTTGTGGGGAAAGTGAGAGG - Intergenic
985396301 4:189548250-189548272 GGCTTTATGGGCACAGTGGAGGG - Intergenic
986473373 5:8097792-8097814 GCTTCTATGTGAAAAGTGGGTGG - Intergenic
988778024 5:34494761-34494783 GTTGTTATGGGGAAAGTCTGAGG - Intergenic
989158207 5:38364931-38364953 GGTTTGATGTGGAAAGAAGGAGG + Intronic
990270239 5:54129599-54129621 AGTACTATTGGGAAAGTGGGTGG - Intronic
992261397 5:74974048-74974070 GGATTTAGGGGGAAAGGGAGTGG - Intergenic
993138194 5:83997103-83997125 GGTTTAATGGGAAAGGTGGCTGG + Intronic
994085214 5:95750750-95750772 GTCTTTATGGGGAATGGGGGAGG + Intronic
996300912 5:121984155-121984177 GATTTTATTGGGAAAGATGGAGG + Intronic
996734709 5:126748041-126748063 GCTTTTAGGCAGAAAGTGGGAGG + Intergenic
997138935 5:131357944-131357966 TGTTTCAAGGAGAAAGTGGGTGG - Intronic
997287619 5:132693129-132693151 GGTTTTATTGGGGGAGGGGGTGG - Exonic
997595218 5:135102883-135102905 GGTAATTTGGAGAAAGTGGGAGG + Intronic
997899156 5:137748179-137748201 GGTCTTATAGAGAAGGTGGGAGG - Intergenic
998951085 5:147393644-147393666 GGTTATTTGGGGTGAGTGGGTGG - Exonic
1000414460 5:160968806-160968828 GGTTTGGTGGTAAAAGTGGGTGG + Intergenic
1002578417 5:180191991-180192013 TGTGTTGTGGAGAAAGTGGGTGG - Intronic
1002834523 6:854842-854864 GTTTTTATTTGGACAGTGGGTGG - Intergenic
1003002322 6:2347753-2347775 GGTTGTTTGGGAAAAGTAGGAGG - Intergenic
1003094767 6:3133537-3133559 GGTTGGGAGGGGAAAGTGGGGGG - Intronic
1003899481 6:10640724-10640746 GGTTTTCTGGGGAAAGTGCCTGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006359717 6:33580349-33580371 GGTGGGGTGGGGAAAGTGGGCGG - Intergenic
1006360205 6:33583462-33583484 GGATTTTGGGGGAAAGGGGGTGG - Intergenic
1007431830 6:41781007-41781029 AGATTTCTGGGGACAGTGGGAGG - Intronic
1008021624 6:46584795-46584817 GATTTCCTGGGGAAAGTGGCGGG - Intronic
1008199722 6:48571430-48571452 GGCTTTAGTGGGACAGTGGGTGG - Intergenic
1010124303 6:72414365-72414387 GGTTTGCTGGGGAAGGAGGGTGG - Intergenic
1010833901 6:80563435-80563457 GCTTTCATGGGTAAAGAGGGTGG - Intergenic
1013611980 6:111804278-111804300 GATTTTATGGGGGAACTGGGGGG + Intronic
1013637333 6:112041609-112041631 AGTTTTATTGGGAATGGGGGTGG + Intergenic
1013710265 6:112888810-112888832 TGGATTAAGGGGAAAGTGGGTGG - Intergenic
1014447775 6:121548268-121548290 GATTTTAAGGGGAAAGAGTGAGG - Intergenic
1014903327 6:126995837-126995859 GGGTTTATGGGGAGAGAGAGAGG + Intergenic
1015256353 6:131183549-131183571 GGTTTTGTGGGGAGAGGGGAAGG - Intronic
1017577333 6:155819277-155819299 TGTCTTATGGGGGAAGTCGGAGG + Intergenic
1021140075 7:17013367-17013389 AGTGTTAAGGGGAAAGTGGGTGG + Intergenic
1022240971 7:28512116-28512138 GGGTTTAAGGGGAAAATTGGGGG + Intronic
1022957761 7:35397204-35397226 GATTTTCTGGGGAAAGTGTTAGG - Intergenic
1025156184 7:56607754-56607776 GGTTTCATGGGAAAAGTAGCTGG + Intergenic
1025760687 7:64387990-64388012 GGTTTCATGGGAAAAGTAGCTGG - Intergenic
1025780326 7:64595726-64595748 TTTTTTTTGGGGGAAGTGGGGGG - Intergenic
1026560589 7:71445014-71445036 GGTTTTATGGGGGAATGGAGAGG + Intronic
1027372168 7:77517962-77517984 GGTTGTGTGGGCCAAGTGGGTGG - Intergenic
1028671657 7:93407642-93407664 GCTTTAATGGGGACAGTTGGAGG + Intergenic
1029008713 7:97236160-97236182 GAATTTATGGGGGAGGTGGGTGG + Intergenic
1029291389 7:99504736-99504758 GGGTTTGTTTGGAAAGTGGGTGG + Intronic
1030821197 7:114094031-114094053 TTTTTTATGGGGAAAGATGGAGG + Intronic
1031247528 7:119335048-119335070 AGTTTTATTGGGAAAGTGTTTGG - Intergenic
1033505613 7:141996834-141996856 GGTTTCCTGTGGAATGTGGGAGG + Intronic
1033650844 7:143342171-143342193 GATCTGATGGGGAGAGTGGGAGG + Intronic
1033742050 7:144283381-144283403 GGCTTTATTGGGAAACTGGGAGG + Intergenic
1033751852 7:144366233-144366255 GGCTTTATTGGGAAACTGGGAGG - Intronic
1035053309 7:156017031-156017053 GGTCTCATCTGGAAAGTGGGAGG + Intergenic
1036737876 8:11334586-11334608 GTCATTATGGGGAAAATGGGGGG + Intergenic
1038343980 8:26715146-26715168 GGTTTTTTGGGGAGAGGGAGTGG - Intergenic
1038677926 8:29640366-29640388 GGTCTCATCGGGAAAGTGGGAGG - Intergenic
1039249306 8:35643937-35643959 AGTATTATGGGGAAAATGGGGGG - Intronic
1042248705 8:66734482-66734504 GGTTTCCTGGGAAAAGTAGGAGG + Intronic
1042267437 8:66923925-66923947 GGTTTTGTGGGGGAGGGGGGTGG - Intergenic
1042272354 8:66967304-66967326 GCTTTTTTTGGGAAAGAGGGGGG + Intronic
1045903226 8:107310550-107310572 GGTTGTATGGGAAAAGAGAGAGG + Intronic
1046151463 8:110231838-110231860 AGTTTTCTGGGTACAGTGGGAGG - Intergenic
1048998897 8:139811970-139811992 GGCTTGCTGGGGACAGTGGGAGG + Intronic
1049272537 8:141703543-141703565 GGCTTTTTGGGGAGAGGGGGTGG + Intergenic
1051258970 9:15243242-15243264 GGTTTTCTGGGAGATGTGGGAGG - Intronic
1052085864 9:24264689-24264711 GGATTTACTGGGAAAATGGGCGG + Intergenic
1052703043 9:31960596-31960618 AGTTTTAGGGGGGATGTGGGAGG - Intergenic
1057099371 9:92343439-92343461 GAGTTTGTGGGGAAAGTGGCAGG + Intronic
1058329526 9:103741732-103741754 GGATTGATGATGAAAGTGGGAGG + Intergenic
1058421807 9:104839998-104840020 GGTTTTCTGGGGGATGTGGAAGG - Intronic
1058849481 9:108997128-108997150 GGTTTTATGTGGGAAGCAGGGGG - Intronic
1059150109 9:111941813-111941835 GGTTTTATTTGAAAAGAGGGAGG - Intergenic
1060806731 9:126582434-126582456 GGTTCTGTGCGGCAAGTGGGAGG - Intergenic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1189391228 X:40578504-40578526 GGTTTTCTGGGGGAATGGGGGGG + Intergenic
1189916893 X:45864338-45864360 GGTTTGAAGGGGAAAGTAAGAGG + Intergenic
1190072487 X:47290761-47290783 GGTATTGTGGGGAGAATGGGTGG + Intergenic
1190213694 X:48466909-48466931 GGTGTTGTGGGGCAGGTGGGAGG - Intronic
1190598801 X:52069288-52069310 GCTTTTGTTGGGAAAGCGGGCGG - Intergenic
1190610023 X:52184785-52184807 GCTTTTGTTGGGAAAGCGGGCGG + Intergenic
1190783676 X:53622971-53622993 TATTTTATGGGAAAACTGGGAGG + Intronic
1192573519 X:72224970-72224992 AGTATTATGGGGAGAATGGGTGG - Intronic
1193269850 X:79516038-79516060 TGTTTACTGGGGAAAGTGTGTGG + Intergenic
1193490772 X:82145147-82145169 GGTGTTATGGGGAGAATTGGTGG - Intergenic
1194087166 X:89542554-89542576 GGTTTTAGGGGGGAGGAGGGAGG + Intergenic
1195446588 X:104959015-104959037 GGTTTTATGGGGGCAGTCTGTGG + Intronic
1195652593 X:107300722-107300744 AGTTTTGAGGGGAAAGTGAGTGG - Intergenic
1197136407 X:123065401-123065423 AGTTTTATGGAGAAAGGTGGTGG + Intergenic
1199086674 X:143635884-143635906 GGCTTTAAGGCGAAAGTGTGAGG + Intergenic
1200439814 Y:3198427-3198449 GGTTTTAGGGGGGAGGAGGGAGG + Intergenic
1200798590 Y:7364196-7364218 GGATTGATGGGGAAAGTCAGGGG - Intergenic
1201924759 Y:19272294-19272316 GGGGCTATGGAGAAAGTGGGAGG - Intergenic