ID: 1133042027

View in Genome Browser
Species Human (GRCh38)
Location 16:3065932-3065954
Sequence CAGGGGCACCCAGCGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 506}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133042021_1133042027 -3 Left 1133042021 16:3065912-3065934 CCTGTGTGTCAGGGCTCAGTCAG 0: 1
1: 0
2: 3
3: 17
4: 162
Right 1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 506
1133042016_1133042027 17 Left 1133042016 16:3065892-3065914 CCTCAGTATTTCCCGAGGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 506
1133042020_1133042027 5 Left 1133042020 16:3065904-3065926 CCGAGGTGCCTGTGTGTCAGGGC 0: 1
1: 0
2: 1
3: 19
4: 216
Right 1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 506
1133042018_1133042027 6 Left 1133042018 16:3065903-3065925 CCCGAGGTGCCTGTGTGTCAGGG 0: 1
1: 1
2: 1
3: 23
4: 242
Right 1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 506
1133042015_1133042027 18 Left 1133042015 16:3065891-3065913 CCCTCAGTATTTCCCGAGGTGCC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133042027 Original CRISPR CAGGGGCACCCAGCGGCAGG AGG Intronic
900010738 1:104990-105012 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
900026841 1:281554-281576 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
900313024 1:2043563-2043585 CAGGGACACACACCAGCAGGGGG - Intergenic
900369215 1:2323977-2323999 CCGGGGCCCCCAGAGGTAGGTGG - Intronic
900824140 1:4912738-4912760 CATGGGCACCCAGGAGCTGGTGG - Intergenic
902649826 1:17829843-17829865 CAGGGGCAGCCAGGTGCAGAGGG + Intergenic
902882506 1:19381988-19382010 AAGGGCCACCCAGGGGAAGGAGG - Intronic
903341014 1:22654315-22654337 CTGGGGAAGCCAGGGGCAGGGGG - Intronic
903369724 1:22827369-22827391 CAGGGGCCCGCAGGAGCAGGTGG + Intronic
903875720 1:26472094-26472116 CTGGGGCCCCCAGCGGGAGCAGG + Intergenic
904462144 1:30686471-30686493 CAGGGGCACCTGTCAGCAGGAGG + Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904617436 1:31757578-31757600 GAGGGTCACCCACCAGCAGGTGG - Intronic
904751116 1:32741899-32741921 CATGGGCACCGCGCCGCAGGGGG + Exonic
905013911 1:34764217-34764239 CAGGTGCCCCCAATGGCAGGAGG + Intronic
906125803 1:43426312-43426334 CGGGGGCACCGGGCAGCAGGAGG + Intronic
906585803 1:46976711-46976733 GAGGGGCACCCAGCTGTATGAGG - Intergenic
906955430 1:50370082-50370104 TAGGGGCACCCAGCTGCAATTGG - Intergenic
907309536 1:53531303-53531325 CATGGGCTCCCAGCAGCAGGTGG + Intronic
908215161 1:61943853-61943875 GAGGGGCACCCAGCCGTATGAGG - Intronic
909232370 1:73106314-73106336 CTGGGGCAGCCAGCCGCAGGAGG - Intergenic
909770443 1:79414910-79414932 GAGGGGCACCCAGCTGTATGAGG - Intergenic
910383660 1:86658183-86658205 GAGGGGCACCCAGCTGTATGAGG - Intergenic
910717452 1:90247718-90247740 GAGGGGCACCCAGCTGCATGAGG - Intergenic
911090486 1:94013407-94013429 CAGTGGGGCCCAGAGGCAGGTGG + Intronic
911490033 1:98553057-98553079 GAGGGGCACCCAGCTGTATGAGG - Intergenic
912742400 1:112212383-112212405 GAGGGGCACCCAGCTGTATGAGG - Intergenic
914246027 1:145886193-145886215 GAGCGGCAGCCAGAGGCAGGAGG + Intergenic
914323088 1:146584247-146584269 CAGGGCCACCCATCCTCAGGAGG + Intergenic
915225056 1:154405742-154405764 CTGGGGCAGCTAGCGGCTGGGGG + Intronic
915360904 1:155285759-155285781 CATGGGCAAACAGCGGCATGTGG - Exonic
915623220 1:157098750-157098772 CAGGGGCCCCCAGCAGCAAGTGG + Exonic
915711422 1:157902574-157902596 GAGGGGCACCCAGCTGTATGAGG - Intergenic
916038327 1:160941280-160941302 GAGGGGCACCCAGCTGTATGAGG + Intergenic
916251925 1:162746737-162746759 GAGGGGCACCCAGCTGTATGAGG - Intronic
916507423 1:165440732-165440754 CAGGGGCTCCCAGAGGAAGCTGG - Intronic
916722975 1:167498863-167498885 CAGGGACACCCAGAGTCAAGTGG + Intronic
917536730 1:175879612-175879634 CGGGGGAACCCAGAGGCTGGTGG - Intergenic
917638340 1:176958486-176958508 CAGGGACACCCAGTGCCAGGTGG + Intronic
918015929 1:180632384-180632406 CAGTGGCTCCCCGCGGCAGCGGG - Intronic
918802134 1:188985993-188986015 CAAGGGCACAGAGCTGCAGGAGG - Intergenic
919138697 1:193542913-193542935 CAGAGGCACACAGTGGCAGCTGG - Intergenic
919332813 1:196192954-196192976 GAGGGGCACCCAGCTGTATGAGG + Intergenic
920781148 1:208992190-208992212 GAGGGGCACCCAGCTGTATGAGG - Intergenic
922259179 1:223920999-223921021 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
922552279 1:226504654-226504676 GAGGGGCACCCGGCTGTAGGAGG + Intergenic
922571494 1:226637198-226637220 CAGGGGCAGCAGGCAGCAGGTGG - Intronic
923335746 1:232968601-232968623 CAGGGGCAGCCAGTGACAGACGG - Intronic
924207578 1:241729259-241729281 AAGGGGCTCCCAGTTGCAGGTGG + Intronic
924340366 1:243023747-243023769 CAGTGGCCCCCAACAGCAGGTGG - Intergenic
924632601 1:245754899-245754921 CTGGGGCGCCCAGAGGAAGGAGG + Intronic
1062790159 10:298570-298592 CTTGGTCACCCAGAGGCAGGAGG - Intronic
1063535241 10:6876748-6876770 CAGGGCCAGCCAGCAGCCGGGGG + Intergenic
1063858184 10:10278609-10278631 CAGTGGCACTCAGCATCAGGTGG + Intergenic
1064431137 10:15270645-15270667 AAGGGGCACCCAGCCGTATGAGG - Intronic
1066655290 10:37693585-37693607 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1066736130 10:38481865-38481887 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1067046519 10:42988377-42988399 CAGGGTCACCCAGATGCTGGGGG + Intergenic
1067090811 10:43265061-43265083 CAGTGGCCCCCAGCGGTGGGAGG - Intronic
1067380971 10:45773023-45773045 AAGGGGCAACCTGAGGCAGGAGG + Intronic
1067477964 10:46578833-46578855 CAGGGGCTCCCTGCGGCTTGGGG - Intronic
1067616775 10:47762954-47762976 CAGGGGCTCCCTGCGGCTTGGGG + Intergenic
1067888670 10:50113662-50113684 AAGGGGCAACCTGAGGCAGGAGG + Intronic
1068641534 10:59413693-59413715 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1069658033 10:70104954-70104976 CAGGCCCACCCTGTGGCAGGGGG + Intronic
1069745697 10:70713535-70713557 CAGTGGAACCCAGCAGCAGATGG + Intronic
1069769606 10:70888785-70888807 CAGGGCCACCCAGCTGTAAGCGG - Intergenic
1069926115 10:71851780-71851802 CAGGGGCACGTGGGGGCAGGTGG + Intergenic
1069926182 10:71852316-71852338 CAGGGGCAGCCACAGGCAGAGGG - Intergenic
1070919255 10:80173724-80173746 CAGAGACACCCAATGGCAGGCGG + Intronic
1070987671 10:80702239-80702261 CATGGGGACCAAGCGGCAGCCGG - Intergenic
1071570891 10:86696256-86696278 CGGGGGCACCCATTGGCAGGAGG - Intronic
1072187959 10:93060435-93060457 CAGAGGGAGCCAGCGGCCGGGGG + Intergenic
1072232615 10:93425928-93425950 CAGGGGCCCCGAGAGGCAGGTGG - Intronic
1072245048 10:93535733-93535755 GAGGGGCACCCACCTGCATGAGG - Intergenic
1072784045 10:98268365-98268387 CGGGGGCGCCCAGCCGCAGCCGG + Intergenic
1073010948 10:100359140-100359162 CATGGCCACCCAGAGGCTGGAGG - Intronic
1075521866 10:123148156-123148178 CGGGCGCACCCAGAGCCAGGCGG + Exonic
1076024705 10:127101695-127101717 CAAGGGGAGCCAGCAGCAGGTGG + Intronic
1076056988 10:127383856-127383878 CATGGGCACCTACGGGCAGGAGG - Intronic
1076169243 10:128306113-128306135 CAGCGGCAGCCAGCAGCCGGCGG + Intergenic
1076316575 10:129546230-129546252 CAGGGGCAGACAGGGGCAGACGG + Intronic
1076794074 10:132790395-132790417 CTGGGGTACCCAGCTGTAGGTGG + Intergenic
1076908966 10:133378096-133378118 CAGGGGCCCGCAGCACCAGGAGG - Intergenic
1077034707 11:489034-489056 CCGGGGCACCCACAGGCAGGAGG - Intronic
1077077150 11:706976-706998 CAGGGACACCCCGCAGCAAGGGG - Intronic
1078255139 11:9652354-9652376 CAGGGGGACCCAGTGGCCAGGGG + Intergenic
1078461711 11:11519740-11519762 CAGGAGCAACCAGGGGAAGGAGG + Intronic
1080365994 11:31574552-31574574 GAGGGGCACCCAGCTGTATGAGG - Intronic
1081587362 11:44396594-44396616 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1081639075 11:44740449-44740471 CAGGGCCAGCCAGGGGCATGGGG + Intronic
1082136852 11:48558978-48559000 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1082735054 11:56846106-56846128 GAAGGGGACCCAGCGGCAGTGGG - Intergenic
1083883454 11:65559173-65559195 CAGGGGCTGGCAGCGGCTGGGGG + Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1087718911 11:101639626-101639648 GAGGGGCACCCAGCTGTATGAGG - Intronic
1089508158 11:118978904-118978926 CAGGGGCACCCAAAGCCAGTGGG + Intronic
1089566668 11:119375420-119375442 CAGGGGCCCCCTGGGCCAGGTGG - Intronic
1089614364 11:119686923-119686945 CAGGGGGCCCAAGTGGCAGGTGG + Intronic
1089977231 11:122742997-122743019 AGGGGGCACCCAGGGCCAGGTGG - Intronic
1090042287 11:123301762-123301784 CGGAGGCGCCCAGGGGCAGGCGG + Intergenic
1090865666 11:130698476-130698498 CAAGGGCACCCAGCAGCGGGAGG + Intronic
1091301502 11:134510774-134510796 CAGGGGCAGGCAGGGGCAGCTGG - Intergenic
1091395745 12:153372-153394 CAGACGCTCCCAACGGCAGGGGG - Intronic
1091657034 12:2353504-2353526 CTGGGGCTCCCTGCAGCAGGAGG + Intronic
1091807390 12:3366129-3366151 CAGGGCCACCCAGCGGCACACGG + Intergenic
1091907003 12:4197143-4197165 TAGGGGCACCAGGCGGCAGTGGG + Intergenic
1092109045 12:5945837-5945859 GAGGGGCTGCCAGAGGCAGGAGG + Intronic
1095140613 12:38657639-38657661 GAGGGGCACCCAGCTGTATGAGG - Intronic
1095913877 12:47457172-47457194 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1096071569 12:48778245-48778267 CATTGGCACCGAGCTGCAGGAGG + Exonic
1096613200 12:52816470-52816492 CAGGGTCACACAGCAGCACGTGG + Intergenic
1096807363 12:54148855-54148877 AAGGGGCACCCAGGAGCTGGGGG - Intergenic
1097052146 12:56230086-56230108 CAAGGACACCCAGAGGAAGGGGG - Intronic
1097701070 12:62820508-62820530 GAGGGGCACCCAGCCGTATGAGG - Intronic
1097917419 12:65035827-65035849 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1098638444 12:72812941-72812963 TAGGGGCACCCAGCTGTATGAGG + Intergenic
1098951532 12:76645157-76645179 GAGGGGCCCAAAGCGGCAGGGGG - Intergenic
1102501894 12:113358776-113358798 CAGGAGCACCGAGCGGCTGCGGG - Exonic
1102558165 12:113742521-113742543 GAGGGGCAACTAGGGGCAGGGGG + Intergenic
1102587557 12:113933653-113933675 CAGGGGGACCCGCGGGCAGGGGG + Intronic
1103699875 12:122843562-122843584 CAGGGGCACCCAGGGGCCCAGGG - Intronic
1103736669 12:123065077-123065099 CAGGGGCCTCCAGCGGCTGTGGG - Intronic
1103998457 12:124844957-124844979 CATGGTCACACAGCAGCAGGAGG + Intronic
1104643366 12:130481159-130481181 CGGGGGCACCCAGGCTCAGGGGG + Intronic
1105804775 13:23946573-23946595 CAGGTGCACCCAGCAGCCGGAGG - Intergenic
1106823287 13:33490563-33490585 TTGGGCCACCCAGCGGCCGGAGG - Intergenic
1108308510 13:49163012-49163034 GAGGGGCACCCAGCTGTATGAGG + Intronic
1108417137 13:50209175-50209197 CAGGCGTCCCCAGGGGCAGGGGG + Intronic
1108988827 13:56629432-56629454 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1111375082 13:87368106-87368128 TAGGGGCACCCAGCTGTATGAGG + Intergenic
1111434094 13:88183918-88183940 CAGGGGCACGCAGCTGGAAGAGG + Intergenic
1112192321 13:97190069-97190091 CAGGGGTCCACTGCGGCAGGTGG - Intergenic
1113034773 13:106037092-106037114 AAGGGCCACCCAGCTGCTGGTGG + Intergenic
1113658395 13:112085962-112085984 CAAGGCCACCCAGCAGGAGGTGG - Intergenic
1113899336 13:113788012-113788034 CAGGGGCACCATGCCGCAGAGGG + Intronic
1114599555 14:23943198-23943220 GAGGGGCACCCACCTGTAGGAGG - Intergenic
1114602983 14:23970732-23970754 CAGGGGCACCCACCTGTATGAGG - Intronic
1114607344 14:24007858-24007880 CAGGGGCACCCACCTGTATGAGG - Intergenic
1114796489 14:25720934-25720956 CAGGGGCACCCAGCTGTATGAGG + Intergenic
1115362359 14:32517963-32517985 GAGGGGCACCCAGCTGTATGAGG - Intronic
1115546535 14:34469404-34469426 CAGGGATAGCCAGCGGCAGCAGG - Intergenic
1117378651 14:55138265-55138287 CAGGGCCACCCAGCGGCCCTGGG + Exonic
1117856717 14:60042122-60042144 GAGGGGCACCCAGCTGTATGAGG + Intronic
1118345393 14:64936877-64936899 TAGGGGCACCCAGAAGGAGGGGG - Intronic
1121634660 14:95445788-95445810 CAGGGCCACACAGTGGCAAGCGG + Intronic
1122048926 14:99042133-99042155 CAGGAGCACCCTGTGGGAGGTGG - Intergenic
1122265113 14:100542986-100543008 AAGGAGCGCCCAGCGGGAGGGGG - Intronic
1122347454 14:101069389-101069411 CAAGGTCACCCAGCTGGAGGTGG + Intergenic
1122370611 14:101227107-101227129 TAGGCGCACCCAGGGACAGGCGG + Intergenic
1122370619 14:101227139-101227161 CAGGCGCACCCAGAGACAGGCGG + Intergenic
1122421609 14:101581452-101581474 CAGGGCCACCCAGCAGCCAGTGG + Intergenic
1122594867 14:102883175-102883197 CCGGAGCACCCATCAGCAGGTGG + Intronic
1122768201 14:104085627-104085649 CGGGGGCACCCACGGGGAGGGGG - Intergenic
1122953980 14:105061411-105061433 CAGAGGCTCCCAGGGGCAGTAGG - Intronic
1122956673 14:105074547-105074569 CAGGGGCCCTGAGCTGCAGGTGG - Intergenic
1123193361 14:106592600-106592622 CTGGGGAAATCAGCGGCAGGGGG - Intergenic
1123201995 14:106674939-106674961 CTGGGGGAATCAGCGGCAGGGGG - Intergenic
1123949455 15:25256342-25256364 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1125301039 15:38253105-38253127 CAGCAGCACCGAGGGGCAGGAGG - Exonic
1125501079 15:40240690-40240712 CCGGAGCACGCAGCGGCAGTGGG - Intronic
1125884409 15:43218011-43218033 AAGGGGCACCCAGGGACATGAGG - Intronic
1129670573 15:77605696-77605718 CAGGGTCATCCAGAGGCAGGAGG - Intergenic
1130653237 15:85774087-85774109 CAGAGGCTCCCAGCGGCGGGGGG + Intronic
1130768829 15:86903720-86903742 CAGGGGCACCCAGTGTGGGGAGG + Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1131048333 15:89330248-89330270 CTGGTGCAGCCAGCGGCTGGTGG - Exonic
1131477824 15:92755375-92755397 GAGGGGCACCCAGCTGTATGAGG - Intronic
1132251707 15:100340265-100340287 CAGGTGCTCCCAGGGGGAGGGGG - Intronic
1132544851 16:528261-528283 CAGAGGAACCCAGAGGAAGGCGG + Intronic
1132589816 16:721742-721764 CAGGGGCGCCCGCCAGCAGGTGG - Intronic
1132761517 16:1510732-1510754 GCCGGGCACCCAGAGGCAGGTGG + Exonic
1132905845 16:2282599-2282621 CAGGGACACCCAGTGCCCGGAGG - Intronic
1132905869 16:2282673-2282695 CAGGGACACCCAGTGCCCGGAGG - Intronic
1132905893 16:2282747-2282769 CAGGGACACCCAGTGCCCGGAGG - Intronic
1132905916 16:2282821-2282843 CAGGGACACCCAGTGCCCGGAGG - Intronic
1132905939 16:2282895-2282917 CAGGGACACCCAGTGCCTGGAGG - Intronic
1133042027 16:3065932-3065954 CAGGGGCACCCAGCGGCAGGAGG + Intronic
1133230922 16:4366160-4366182 CAGGGAAGCCCAGCGGCCGGAGG - Intronic
1134394828 16:13853252-13853274 CAGGGGCACCCAGTCACAAGGGG + Intergenic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136600496 16:31284100-31284122 GAGGGGCACCCAGCCGTATGAGG + Intronic
1136996670 16:35195502-35195524 CAGGCGCCCCCAGCTGGAGGTGG + Intergenic
1137023326 16:35451568-35451590 CAGGTGCCCCCAGCTGAAGGTGG + Intergenic
1137023510 16:35452509-35452531 GTGGGGCACCCAGTGGCAGATGG + Intergenic
1137335655 16:47546488-47546510 GAGGGGCACCCAGCTGTATGAGG + Intronic
1137471135 16:48759453-48759475 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1137680937 16:50344031-50344053 GAGGGGCACCCAGCTGTATGAGG - Intronic
1137696939 16:50468075-50468097 CAGCGGCCGCCAGCGGGAGGGGG - Intergenic
1138007261 16:53349762-53349784 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1138345073 16:56315707-56315729 CCTGGGCCCCCAGAGGCAGGGGG - Intronic
1138505317 16:57475557-57475579 CAAGGAGACCAAGCGGCAGGCGG - Exonic
1138553198 16:57758346-57758368 CAGAGGCAGCCAGCGGGTGGGGG - Exonic
1138713154 16:58992628-58992650 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1140010471 16:71126603-71126625 CAGGGCCACCCATCCTCAGGAGG - Intronic
1140054089 16:71510555-71510577 GAGGGGCACCCAGCTGTATGAGG + Intronic
1141632967 16:85298816-85298838 CAGGGGCACTCCGCTGCAGATGG + Intergenic
1142080339 16:88145809-88145831 CAGGAGGCTCCAGCGGCAGGGGG - Intergenic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1142374779 16:89701347-89701369 CGGGGGCGCCCAGCCGCTGGGGG - Intronic
1142453609 16:90201926-90201948 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1142745312 17:1953913-1953935 CAGCCACACCCAGAGGCAGGAGG - Intronic
1143126118 17:4641778-4641800 CTGGGGGCCCCAGCGGTAGGCGG - Intronic
1143176252 17:4956844-4956866 CAGACGCTCCGAGCGGCAGGGGG - Exonic
1143375427 17:6464268-6464290 CAGGTGTACCCAGCGGCCTGAGG + Exonic
1143568450 17:7739559-7739581 GAGGGCCAACCAGCTGCAGGGGG - Intronic
1143646208 17:8231956-8231978 TGGGGGCACCCAGAGGAAGGAGG - Exonic
1144652479 17:17015741-17015763 AAGGGCCATCCTGCGGCAGGGGG + Intergenic
1144738013 17:17565641-17565663 CAGGGCCACACAGTGGCAGCTGG - Intronic
1144781244 17:17809667-17809689 CATGGGCAGCCAGGGGCTGGAGG + Intronic
1145160504 17:20570941-20570963 AAGGGCCATCCTGCGGCAGGGGG - Intergenic
1145253435 17:21309352-21309374 CAGGTGCACACAGCGGGAGGCGG + Intronic
1145290609 17:21542684-21542706 CAGGGGCTGCCAGCAGGAGGTGG - Intronic
1146011308 17:29196956-29196978 CTGGGGCACTCACCAGCAGGAGG + Intergenic
1146600883 17:34215123-34215145 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1147189093 17:38728707-38728729 CAGGGGAACCAAGGGCCAGGAGG - Exonic
1147610915 17:41801392-41801414 CATGGGCTCCCAGGGGCAGTGGG - Intergenic
1147902436 17:43797865-43797887 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1147969621 17:44212481-44212503 CACAGGCAGCCAGGGGCAGGGGG + Intronic
1149606261 17:57927211-57927233 AAAGGGCATCCAGGGGCAGGCGG + Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150428982 17:65100714-65100736 CAGCGCCACCTGGCGGCAGGTGG + Intergenic
1150561581 17:66300036-66300058 CAGGGGGACCCAGAGGCTGGAGG - Intergenic
1150647765 17:66990453-66990475 CAGGGGCACACAGCAGCGGGTGG + Intronic
1150666005 17:67139013-67139035 CAGGGGCATACAGAGGAAGGAGG + Intronic
1151341204 17:73472081-73472103 AATGGGGACCCAGGGGCAGGGGG - Intronic
1151362307 17:73596114-73596136 CAGGGAGTCCCAGCTGCAGGTGG + Intronic
1151875242 17:76864261-76864283 CAGCAGGACCCAGGGGCAGGGGG + Intergenic
1151961804 17:77409557-77409579 CAGGGCCACAGAGCTGCAGGGGG - Intronic
1151971683 17:77460636-77460658 CAGGAGCCCCCAGCTGCTGGGGG - Intronic
1152191284 17:78889577-78889599 CAGGGGCACCCAAGGTCAGACGG - Intronic
1152252571 17:79219609-79219631 CAGGGGCTCGCAGAGGAAGGTGG + Intronic
1152375427 17:79916235-79916257 CAGCGGCATCCAGCGGCCAGGGG - Intergenic
1152495599 17:80669129-80669151 CAGGAGCAGCCAGGGGCTGGGGG + Intronic
1152584629 17:81183492-81183514 CGGGGGCACCCAGGGGCTGCAGG - Intergenic
1152780650 17:82226169-82226191 TTGGGGCAGCCAGGGGCAGGTGG + Intergenic
1152879647 17:82807859-82807881 CAGGGCCAGCCAGAGGCAGGAGG - Intronic
1153707137 18:7757529-7757551 CCTGGGCAGCCAGCAGCAGGTGG + Intronic
1154401514 18:14042960-14042982 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1155990438 18:32274036-32274058 GAGGGGCAGCCCACGGCAGGTGG + Intronic
1156443788 18:37219214-37219236 AAGGGGCACCCAGCTGTATGAGG + Intronic
1157123365 18:44933324-44933346 GAGGGGCACCCAGCCGTATGAGG + Intronic
1158452543 18:57580180-57580202 CAGTGGCATCCAGCAGCTGGAGG - Exonic
1159999189 18:75000167-75000189 CAGGGAAACCCAGTGTCAGGGGG + Intronic
1160538747 18:79609322-79609344 GAGCAGCACCCAGCAGCAGGTGG + Intergenic
1160740309 19:682547-682569 AAGGGGCACACAGAGGCAGTGGG - Exonic
1160783901 19:891027-891049 CAGGGGCACCGATGGGCAGTGGG + Exonic
1160866471 19:1258404-1258426 CAGGGGCACTGAGAGGCAGGGGG - Exonic
1160943366 19:1630236-1630258 CAGGGGCCACCCCCGGCAGGGGG + Intronic
1160985057 19:1834745-1834767 CAGGGGCACCTGGAGGCCGGAGG + Intronic
1161029212 19:2050281-2050303 CAGGTGCACCCACCCCCAGGGGG - Intronic
1161458306 19:4381131-4381153 CAGGGGAACAGAGAGGCAGGGGG - Intronic
1161984705 19:7647022-7647044 CTGGGTCCCCCAGAGGCAGGAGG + Intronic
1162938908 19:13996431-13996453 GAGGGTCACCCTGCGGCTGGAGG - Intronic
1162952931 19:14082498-14082520 TAGGGGCACCCATCGGCCGATGG + Exonic
1163085930 19:14979734-14979756 TGGGGGCACCGAGCGGCCGGGGG + Intronic
1163149144 19:15400894-15400916 CAGGAGTTCCCAGAGGCAGGGGG + Intronic
1163435831 19:17294546-17294568 CGGGGGCACCCCACGGCAGTCGG - Intronic
1163556920 19:17998363-17998385 CACGGGCGTCCACCGGCAGGGGG - Exonic
1163686554 19:18715122-18715144 CGGGAGCCCCCAGAGGCAGGAGG - Intronic
1163718424 19:18885986-18886008 CAGGTGCACCAGGAGGCAGGAGG - Intronic
1164394869 19:27853436-27853458 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1164688598 19:30190038-30190060 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1164838627 19:31375380-31375402 CAGTGGCTCCCAGGGGCAAGGGG - Intergenic
1164980670 19:32611377-32611399 CATGTGCATCCAGCAGCAGGGGG + Intronic
1166552356 19:43674644-43674666 CAGGGTCACCCAGAAGCAAGTGG - Intergenic
1166558883 19:43719086-43719108 CACGCGCACCCAGCGGCCGTCGG + Exonic
1167288947 19:48614306-48614328 CAGGGGCAGCCAGCCTGAGGAGG - Intronic
925386084 2:3462804-3462826 CAGGGGCACCCGGGGGAGGGGGG - Intronic
926941697 2:18144538-18144560 GAGGGGCACCCAGCTGTATGAGG + Intronic
927713215 2:25338505-25338527 CAGCGGCGCACAGCAGCAGGGGG + Intronic
927940516 2:27100364-27100386 CTGGGGCAGTCAGCGGGAGGAGG - Exonic
928022895 2:27717276-27717298 CAGGGCAACACAGAGGCAGGAGG - Intergenic
928085064 2:28340802-28340824 CAGGGGCTGGCAGGGGCAGGAGG - Intergenic
928864911 2:35906264-35906286 GAGGGGTACCCAGCGGTATGAGG + Intergenic
929014049 2:37476316-37476338 CAGAGGGACCCAACTGCAGGTGG + Intergenic
929546364 2:42857401-42857423 CAGGGGCAAACAGTGGCATGTGG + Intergenic
929958271 2:46477345-46477367 GAGGGGCACCCAGTGGTATGAGG + Intronic
930893765 2:56421797-56421819 GAGGGGCATCCAGCTGCATGAGG - Intergenic
931558536 2:63531454-63531476 GAGGGGCACCCAGCTGTATGAGG - Intronic
932019138 2:68064510-68064532 GAGGGGCACCCAGCTGTATGAGG - Intronic
932112545 2:69013766-69013788 CAGAGGGACCGCGCGGCAGGCGG + Intronic
932435190 2:71699250-71699272 CAGGGGCACCCACTGGCAGGAGG - Intergenic
932662615 2:73669875-73669897 GAGGGGCACCCAGCTGTATGAGG + Intergenic
935746572 2:106194338-106194360 CGGGGGCGCGCGGCGGCAGGAGG - Exonic
936134336 2:109876657-109876679 GAGGGACACCAAGCAGCAGGGGG - Intergenic
936210361 2:110494828-110494850 GAGGGACACCAAGCAGCAGGGGG + Intergenic
936434947 2:112496221-112496243 GAGGGACACCAAGCAGCAGGGGG + Intronic
936467311 2:112764847-112764869 CAGGCGCACTCAGAGGCGGGCGG - Intergenic
936823593 2:116553536-116553558 GAGGGGCACCCAGCTGTATGAGG - Intergenic
937982886 2:127625296-127625318 CAGGGGCATCCTGGGGAAGGGGG + Intronic
938082969 2:128380076-128380098 CCGGAGCCCCCAGCAGCAGGAGG - Intergenic
938109183 2:128552743-128552765 CAGGGGCAGCCAGCGCCCTGTGG - Intergenic
938262810 2:129907331-129907353 GAGGGGCACACTGGGGCAGGAGG + Intergenic
938383053 2:130847365-130847387 CATGGGCACCCAGAGGCATCTGG + Intronic
939055614 2:137360968-137360990 GAGGGGCACCCAGCTGTATGAGG - Intronic
939974847 2:148705591-148705613 CAGGGGCACCCAGTTGTATGAGG - Intronic
940644382 2:156375634-156375656 GAGGGGCACCCAGCTGTATGAGG + Intergenic
941100242 2:161286920-161286942 GAGGGGCACCCAGCTGTATGAGG - Intergenic
941842989 2:170107653-170107675 CAGGGTCATCCACCAGCAGGAGG - Intergenic
941896151 2:170630662-170630684 GAGGGGCACCCAGCTGTATGAGG - Intronic
942854722 2:180531969-180531991 GAGGGGCACCCAGCTGTATGGGG + Intergenic
944161228 2:196662590-196662612 CCAGGCCACCCAGCAGCAGGTGG - Intronic
945302562 2:208227899-208227921 CTGGGGCACCCAGCAGCTGCTGG + Intergenic
946408835 2:219506588-219506610 CAGGGGCACAGATGGGCAGGAGG + Intronic
947536411 2:230942701-230942723 CAGGGGCAGCCAGTGGGAGATGG + Intronic
948561538 2:238857035-238857057 CAGAGGCCCCCAGAGGAAGGTGG + Intronic
948662530 2:239516026-239516048 CAAGGGCACCCACCGGCCGCAGG - Intergenic
948763812 2:240209317-240209339 CAGGAGCACCCAGAGGACGGGGG - Intergenic
948834701 2:240620398-240620420 CAGGGGCCTCCTGCTGCAGGTGG + Intronic
949077562 2:242070733-242070755 AAAGGACACCCAGCTGCAGGTGG - Intergenic
949085053 2:242146584-242146606 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1169255133 20:4091411-4091433 CAGAGGATCCCAGCTGCAGGAGG + Intergenic
1171278870 20:23880126-23880148 CAGGGGCATCCAGGAGCACGTGG + Intergenic
1172447935 20:35002870-35002892 CAGGGCCACCCAGAGGTAAGAGG - Exonic
1173137053 20:40447748-40447770 CAGGGGCTCACAGTGGCAGGAGG + Intergenic
1173232046 20:41205914-41205936 GAGGGGCACCCAGCTGTATGAGG - Intronic
1173243358 20:41317337-41317359 CAGGGGCAGCCGGCGGGAGGGGG + Intronic
1173410937 20:42808903-42808925 CAGGGGCTCTCAGCTGCCGGAGG + Intronic
1173672640 20:44809497-44809519 CAGGGGCACACACCAGCGGGCGG + Intronic
1174400536 20:50273585-50273607 CAGGGACACCCAGCCGGAGATGG + Intergenic
1175266088 20:57704320-57704342 CAGGGGCTCCCCGAGGCTGGGGG - Intronic
1175871758 20:62212609-62212631 CAGGGCCTCCCAGAGGCAGAAGG + Intergenic
1178518730 21:33269327-33269349 CAGGCGCAAACAGCAGCAGGAGG + Intronic
1179214050 21:39350498-39350520 AAGGGGAAGCCATCGGCAGGGGG + Intergenic
1179558429 21:42195303-42195325 CAAGTGCACCCAGAGGTAGGTGG + Intergenic
1179994899 21:44969500-44969522 CGGGGACTCCCAGCGACAGGAGG - Intronic
1180012653 21:45061228-45061250 CTTGGGAACCCAGAGGCAGGGGG - Intergenic
1180074684 21:45456519-45456541 CAGGGGCAGGCAGCGACCGGCGG - Intronic
1180091517 21:45535984-45536006 CAGGGGCAGCCACCAGTAGGTGG - Intronic
1180156421 21:45979580-45979602 CACAGGCACACAGCAGCAGGTGG - Intergenic
1180636243 22:17264963-17264985 CAGGGGCAACCACCGCCAGAGGG + Intergenic
1180998837 22:19978527-19978549 CAGGGCCTCCCAGGGGTAGGAGG + Intronic
1181672480 22:24432213-24432235 CAGGGGCACCTGGAGGCAGCGGG + Exonic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1181846313 22:25712095-25712117 CTGGGGAACCCAGTGGCAGCTGG + Intronic
1183075532 22:35424300-35424322 CAATGGCAGGCAGCGGCAGGAGG - Exonic
1183228567 22:36566543-36566565 CTGAGGCACACAGAGGCAGGTGG + Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1183693396 22:39404225-39404247 GAGGGGCACCCTGGGGCAGGGGG + Intronic
1184890082 22:47374117-47374139 CAGGTGCAGGCAGAGGCAGGTGG - Intergenic
1184901699 22:47450401-47450423 CACGGCCCCCCAGAGGCAGGTGG - Intergenic
1184916167 22:47570476-47570498 CAGGTGCAGCTAGCGGGAGGCGG + Intergenic
1185051611 22:48557028-48557050 CAGGGGCACCCACCGTTGGGAGG + Intronic
1185059483 22:48598815-48598837 CAGTGGAACCAAGCGCCAGGTGG + Intronic
1185119046 22:48954900-48954922 CAGGAGGCCCCAGGGGCAGGGGG - Intergenic
1185286160 22:50000765-50000787 CAGGGCCTCCCACCGGCAGCAGG - Exonic
950026473 3:9823675-9823697 CAGGGACAGCCAGATGCAGGGGG - Intronic
950302671 3:11894905-11894927 CAGGGGCACCCAGCTTTATGAGG - Intergenic
950479809 3:13237287-13237309 CAGGGACACCCTGTGGAAGGTGG + Intergenic
950503598 3:13379355-13379377 CAGAGGCTCCCAGCGGTGGGAGG - Intronic
950668752 3:14512746-14512768 CAGGGGCAAACAGCAGCGGGAGG + Intronic
950670824 3:14524380-14524402 CAAGGGCACCCACCGGGCGGGGG + Exonic
950792576 3:15485271-15485293 GAGGGGCACCCAGCTGTATGAGG + Intronic
951155681 3:19350495-19350517 GAGGGGCACCCAGCTGCATGAGG - Intronic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
953031215 3:39181031-39181053 AAGGCGCACCCCGCGGGAGGCGG - Intergenic
953337345 3:42104463-42104485 GAGGGGCACCCAGCTGTATGAGG - Intronic
954238994 3:49278572-49278594 CAGGGGCAGCCATCCTCAGGTGG - Intronic
956217300 3:66861691-66861713 CAGGGCCACCTAGCTGGAGGTGG + Intergenic
959736526 3:109665471-109665493 GAGGGGCACCCAGCTGTATGAGG - Intergenic
961356993 3:126345649-126345671 CAGGGCCACCCAGCGAGAGGCGG + Intronic
962180307 3:133199659-133199681 GAGGGGCACCCAGCCGTATGAGG + Intronic
962344773 3:134610958-134610980 CAGGGGAACCCCGGGGCAGGCGG + Intronic
962907561 3:139818611-139818633 GAGGGGCACCCAGCCGTATGAGG + Intergenic
964442740 3:156728775-156728797 CATGGGCAGCCAGCGGCTGTGGG + Intergenic
965393106 3:168129020-168129042 GAGGGGCACCCAGCTGTATGAGG - Intergenic
968500191 4:946297-946319 CCGGGGCACCTGGCTGCAGGTGG + Intronic
968608067 4:1544959-1544981 CAGGGGCCCACGGCGGCAGCGGG - Intergenic
968623895 4:1617885-1617907 CAGGAGCACCCAGGAGCAGTCGG + Intergenic
968984526 4:3867873-3867895 CAGGGGCCCCCAGCATCATGGGG + Intergenic
969058425 4:4416252-4416274 CAGGGGCTGCCACTGGCAGGAGG - Intronic
969452501 4:7282758-7282780 GAGGCTCAGCCAGCGGCAGGTGG + Intronic
969574685 4:8030047-8030069 CTGGAGCCCCCACCGGCAGGAGG - Intronic
969580763 4:8063547-8063569 CAAGGTCACACAGCAGCAGGTGG + Intronic
969778850 4:9380878-9380900 AAGGAGCACCCAGAGGCCGGCGG - Intergenic
970983040 4:22123765-22123787 GAGGGGCACCCAGCTGTATGAGG - Intergenic
971621263 4:28856885-28856907 GAGGGGCACCCAGCTGTATGAGG + Intergenic
972685671 4:41350198-41350220 GAGGGGCACCCAGCTGTATGAGG - Intergenic
972931103 4:44072250-44072272 CATGGGCACCCAAAGTCAGGAGG + Intergenic
973626006 4:52773536-52773558 GAGGGGCACCCAGCTGTATGAGG + Intergenic
974010203 4:56599556-56599578 CAGGGCCTGTCAGCGGCAGGGGG - Intronic
974055127 4:56976811-56976833 CAGGAGCATCCTGGGGCAGGAGG + Exonic
974127582 4:57714855-57714877 GAGGGGCACCCAGCTGTATGAGG - Intergenic
974176732 4:58334085-58334107 AAGGGGCACCCAGCTGTATGAGG - Intergenic
975753532 4:77549721-77549743 GAGGGGCACCCAGCTGTATGAGG + Intronic
976102528 4:81580730-81580752 CAGGAGCCCACGGCGGCAGGGGG - Intronic
978188053 4:105880915-105880937 GAGGGGCACCCAGCTGTATGAGG - Intronic
979262485 4:118664823-118664845 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
979934124 4:126670476-126670498 GAGGGGCACCCAGCTGTATGAGG - Intergenic
981108703 4:140910939-140910961 CATGGGCACACAGAGCCAGGTGG + Intronic
981208016 4:142067091-142067113 GAGGGGCACCCAGCTGTATGAGG - Intronic
983334465 4:166374654-166374676 GAGGGGCACCCAGCTGTATGAGG + Intergenic
985489313 5:169968-169990 ATGGGGCATCCAGGGGCAGGGGG - Intronic
985636251 5:1037267-1037289 CAGGAGTCCCCAGGGGCAGGAGG + Intronic
985652249 5:1112478-1112500 CAGGGGGGCCCAGCAGGAGGGGG - Intergenic
985671019 5:1206727-1206749 CAGGGACACGCAGCGTGAGGAGG + Intronic
985695249 5:1336476-1336498 CAGGGGCAGGCAGCTGCAGAAGG - Intronic
985717784 5:1472253-1472275 GAGGAGCACCCAGGGGCAGAGGG + Intronic
985725987 5:1515898-1515920 CAGGGGCTCCCTGCAGCTGGGGG - Intronic
986726034 5:10597519-10597541 CAGGGGCACCCAGATTCATGAGG + Intronic
988187780 5:27889273-27889295 GAGGGGCACCCAGCTGTATGAGG + Intergenic
989418305 5:41205986-41206008 GAGGGGCACCCAGCTGTATGAGG - Intronic
989562075 5:42863573-42863595 GAGGGGCACCCAGCTGTATGAGG - Intronic
990164062 5:52975986-52976008 GAGGGGCACCCAGCTGTATGAGG + Intergenic
990244818 5:53854077-53854099 GAGGGGCACCCAGCTGTATGAGG + Intergenic
990759992 5:59118277-59118299 CAGGGTCACTCAGTGGCAGGAGG - Intronic
992756540 5:79911750-79911772 GAGGGGCACCCACCTGCATGAGG - Intergenic
995459818 5:112390810-112390832 GAGGGGCACCCAGCTGTATGAGG - Intronic
995529001 5:113074148-113074170 AAGGGGCACCCAGCTGTATGAGG - Intronic
995750062 5:115444244-115444266 GAGGGGCACCCAGCTGTATGAGG + Intergenic
997237076 5:132278818-132278840 CAGGGGCACCCAGAGGTGGAGGG - Intronic
997432733 5:133851972-133851994 GAGGGGCACCCAGCTGTATGAGG - Intergenic
998129258 5:139643128-139643150 CCAGGGCACCCAGCGGCGGCTGG + Intergenic
999739387 5:154538571-154538593 CAGGGGCAGCCAGCGTCATCTGG + Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1000504374 5:162096643-162096665 CAGTGACACCCAGTGGGAGGTGG + Intronic
1000595749 5:163212721-163212743 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1001076445 5:168631454-168631476 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1001706575 5:173745329-173745351 CAGCTGCACCCAGAGCCAGGTGG + Intergenic
1001924670 5:175627466-175627488 TAGGGGCACTCAGTGCCAGGTGG + Intergenic
1002140112 5:177133152-177133174 CAGGTGAGCCCTGCGGCAGGAGG + Intronic
1002185596 5:177453478-177453500 CAAGGGCACCAAGTGGCACGTGG + Intronic
1002192307 5:177484665-177484687 CAGGGGCACGCTGTGGCAGCTGG - Intronic
1002313989 5:178331601-178331623 CAGAGGCAGCCACCGACAGGAGG + Intronic
1002858873 6:1062072-1062094 CAGAGGCAGCCAGAGGCAGTGGG - Intergenic
1003380669 6:5621856-5621878 CAGAGGCACCCAGAGGCTGAGGG - Intronic
1004426830 6:15512405-15512427 CGGGGGCAGCAAGCGGGAGGAGG - Intronic
1004428374 6:15522148-15522170 GAAGGGGACCCAGTGGCAGGTGG - Intergenic
1006364479 6:33607359-33607381 CAGGGGCCCCCACTGGAAGGTGG + Intergenic
1006443607 6:34067002-34067024 CAGGGGCAGCCCCAGGCAGGTGG - Intronic
1007713299 6:43838494-43838516 CAGGGGCAGCCTGGGGCTGGGGG - Intergenic
1008474545 6:51922329-51922351 GAGGGGCACCCAGCTGTATGAGG + Intronic
1009361320 6:62818162-62818184 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1010682992 6:78818276-78818298 GAGGGGCACCCAGCTCCATGAGG - Intergenic
1012129446 6:95472162-95472184 GAGGGGCACCCAGCCGTATGAGG - Intergenic
1013258305 6:108411524-108411546 GAGGGGCACCCAGCTGTATGAGG - Intronic
1013517883 6:110905050-110905072 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1015430267 6:133123030-133123052 GAGGGGCACCCAGCAGTATGAGG + Intergenic
1015893178 6:137989529-137989551 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1018031561 6:159845497-159845519 CAGGGGCACCCAGCGGGGAAGGG - Intergenic
1018114032 6:160565291-160565313 GAGGGGCACCCAGCTGTATGAGG - Intronic
1018890067 6:167976862-167976884 CAGGAAGACCCAGGGGCAGGAGG - Intergenic
1019164550 6:170089275-170089297 CAGGGGAAGCCAGCAGCAGGAGG - Intergenic
1019751261 7:2731513-2731535 CAGGCGCACCAACCGGCTGGTGG - Exonic
1019776961 7:2917532-2917554 CGGGGGCAGGCAGGGGCAGGCGG + Intronic
1020292089 7:6730003-6730025 CAGGGGAACCGGGCGGGAGGTGG + Intergenic
1020349350 7:7201376-7201398 GAGGGGCACCCAGCTGTATGAGG + Intronic
1021269929 7:18573849-18573871 CAGGGGCTCCCTGAGCCAGGGGG - Intronic
1022453649 7:30538234-30538256 GAGGGGCACCCGGCTGCATGAGG - Intronic
1022652544 7:32290320-32290342 CAGAGGCAGCCAGGAGCAGGCGG + Intronic
1023065995 7:36378479-36378501 GAGGGGCACCCAGCTGTATGAGG + Intronic
1023563923 7:41504858-41504880 CAGGGGCACCGATCTGCACGGGG - Intergenic
1024558180 7:50621528-50621550 CAGGGGCACTCAGCTGCATCCGG - Intronic
1024670559 7:51589990-51590012 CAGGGCCATCCAGAGGCAGAGGG - Intergenic
1026479162 7:70763627-70763649 CAGGGAGACCCAGCAGCAGTGGG + Intronic
1027447268 7:78288718-78288740 GAGGGGCACCCGGCTGCACGAGG - Intronic
1029324185 7:99791858-99791880 CAAGGGCACCGAGAGGCTGGAGG + Intergenic
1029461191 7:100694528-100694550 CGGGGGCCCCCAGCTGCGGGCGG + Intergenic
1029606457 7:101602065-101602087 CAGAGGCACCGAGCGTTAGGTGG + Intergenic
1029713727 7:102314398-102314420 CAGGAGCTCACAGCTGCAGGAGG - Exonic
1030181131 7:106710144-106710166 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1030220965 7:107098889-107098911 TAGGGGCACCCAGCTGTATGAGG + Intronic
1033293396 7:140108643-140108665 GAGGGGCACCCAGCTGTATGAGG + Intronic
1033368948 7:140691850-140691872 CGGGAGGACCCAGCAGCAGGCGG - Intronic
1034226492 7:149488730-149488752 CAGGGGTACCCAGTGCCAGCGGG - Intronic
1034781773 7:153887885-153887907 CGAGCCCACCCAGCGGCAGGGGG + Intronic
1034828430 7:154288028-154288050 CTGGGGCACCCCTCGGTAGGGGG - Intronic
1035479072 7:159167570-159167592 CAGGAGCAGCCAGGGGAAGGAGG - Intergenic
1035536117 8:392618-392640 AAAGGACACCCAGCTGCAGGTGG - Intergenic
1038596406 8:28890359-28890381 CAGGGACGCCCGGCGGCAGCAGG + Intergenic
1039843250 8:41308510-41308532 CACCGGGACCCAGCGGCGGGCGG + Intronic
1040071036 8:43189006-43189028 GAGGGGCACCCAGCTGTATGGGG + Intronic
1040383419 8:46894701-46894723 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1041037902 8:53813967-53813989 CAGGCTCACCCAGAGGCAGCTGG + Intronic
1041165793 8:55090994-55091016 GAGGAGCACCCAGAAGCAGGAGG + Intergenic
1042307021 8:67343321-67343343 CCGCGGCTCCCAGCGGCTGGAGG + Exonic
1042611803 8:70608273-70608295 GAGGAGCAGCCAGCGGGAGGCGG - Exonic
1042638537 8:70906001-70906023 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1042887629 8:73569577-73569599 GAGGGGCACCCAGCTGTATGAGG - Intronic
1043497986 8:80823689-80823711 GAGGGGCACCCAGCTGTATGAGG - Intronic
1044755049 8:95452747-95452769 CATGTGCACCCAACTGCAGGAGG - Intergenic
1044960710 8:97528412-97528434 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1047424991 8:124736939-124736961 CAGGGGAACAGAGGGGCAGGGGG + Intergenic
1047512958 8:125529498-125529520 CTGGGGCACACAGAGCCAGGTGG - Intergenic
1048897329 8:139004086-139004108 CAGGGTCACCCAGCAACAAGTGG - Intergenic
1048899285 8:139022286-139022308 CTGCGGCACCGAGCAGCAGGGGG + Intergenic
1048998182 8:139807033-139807055 CAAGGGCCCTCAGAGGCAGGAGG + Intronic
1049182246 8:141228967-141228989 CAGCGGCACCTGGCGCCAGGTGG - Intronic
1049337512 8:142094290-142094312 CAAGGTCACACAGCTGCAGGTGG - Intergenic
1049358433 8:142200167-142200189 CAGGGACGCTCAGCGGGAGGAGG - Intergenic
1049367245 8:142246372-142246394 CAGGGACAGCCAGCAGCAGGAGG - Intronic
1049369120 8:142255099-142255121 CAGAGGCCCCCAGCGGCTGAAGG + Intronic
1049373267 8:142277714-142277736 CAGGGGAGCCCAGCGGCCTGGGG + Intronic
1049425922 8:142537849-142537871 CAGGGGCACAAGGCTGCAGGAGG - Intronic
1049510150 8:143023163-143023185 CAGGGGCACCGTCCAGCAGGAGG + Intronic
1050512891 9:6413379-6413401 CTCGGGCCCTCAGCGGCAGGCGG - Exonic
1051505411 9:17821887-17821909 CATGGATACCCAGCAGCAGGTGG + Intergenic
1052887796 9:33666764-33666786 GAGGGGCACCCAGCTGAATGAGG - Intergenic
1055053152 9:71999877-71999899 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1056016275 9:82391569-82391591 CAGGGGCACCCACCTGTATGAGG + Intergenic
1057741659 9:97717418-97717440 CAGGGGGACTTAGCTGCAGGAGG - Intergenic
1058012060 9:99989296-99989318 GAGGGGCACCCAGCTGTATGAGG - Intronic
1060407867 9:123381719-123381741 CTGGGGGACCCAGCGGCTGTAGG + Exonic
1060670689 9:125466755-125466777 TAGGGGGACCCAGGGGAAGGAGG - Intronic
1061289496 9:129642469-129642491 CAGGGGCGCCCAGGGCCAGTGGG - Intergenic
1061653104 9:132066935-132066957 CAGGAGCACTGAGAGGCAGGAGG - Intronic
1062047410 9:134430931-134430953 CAGGAGCACACAGCTGCAGAGGG - Intronic
1062165330 9:135104756-135104778 CAGGGCCCCCCAGCAGCCGGAGG + Intronic
1062230742 9:135480141-135480163 CGGGGGCTCCCCGAGGCAGGCGG + Intronic
1062473900 9:136718332-136718354 CAGGGGTCCCCTGAGGCAGGTGG + Intronic
1062560651 9:137140176-137140198 CAGGCGGACCCATCGGTAGGGGG - Intronic
1186563624 X:10638774-10638796 GAGGGGCACCCAGCTGTATGAGG - Intronic
1190209626 X:48434202-48434224 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1190622306 X:52299458-52299480 GAGGGGCACCCAACTGCATGAGG - Intergenic
1190797272 X:53757479-53757501 CAGGGACACACAGCAGCAGCTGG - Intergenic
1190913070 X:54789617-54789639 CAGGGACACACAGCAGCAGCTGG - Intronic
1190917874 X:54823692-54823714 CAGGGACACACAGCAGCAGCGGG + Intergenic
1190979572 X:55443963-55443985 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1191882364 X:65856046-65856068 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1193035935 X:76951132-76951154 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1193315997 X:80065945-80065967 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1193419845 X:81270609-81270631 CAGGGGCACCCACCTGTATGAGG + Intronic
1193733787 X:85133038-85133060 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1196853628 X:119962222-119962244 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1197702234 X:129608089-129608111 CTGGGGCACACAGTGTCAGGAGG - Intergenic
1198168434 X:134080216-134080238 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1198858583 X:141045048-141045070 GAGGGGCACCCAGCCGTATGAGG - Intergenic
1198904114 X:141542340-141542362 GAGGGGCACCCAGCCGTATGAGG + Intergenic
1200061339 X:153485114-153485136 CGGGGGCTCCCAGCTGAAGGTGG + Intronic
1200086574 X:153610150-153610172 CTGGGGCTCCCAGCAGCAGGGGG - Intergenic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic
1200805462 Y:7428734-7428756 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1201393053 Y:13519678-13519700 AAGGGGCACCCAGCTGTATGAGG + Intergenic
1201776109 Y:17667963-17667985 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1201825447 Y:18238029-18238051 GAGGGGCACCCAGCTGTATGAGG - Intergenic
1201992387 Y:20042231-20042253 GAGGGGCACCCAGCTGTATGAGG + Intergenic
1202384556 Y:24313285-24313307 CAGTGGCCCCCAACAGCAGGTGG + Intergenic
1202486228 Y:25356837-25356859 CAGTGGCCCCCAACAGCAGGTGG - Intergenic