ID: 1133046290

View in Genome Browser
Species Human (GRCh38)
Location 16:3090062-3090084
Sequence GGTCCTGGGCGTGCGCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133046285_1133046290 7 Left 1133046285 16:3090032-3090054 CCTTACTCTCAGGAGCGCAGGGC 0: 1
1: 0
2: 3
3: 9
4: 140
Right 1133046290 16:3090062-3090084 GGTCCTGGGCGTGCGCCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133046290 Original CRISPR GGTCCTGGGCGTGCGCCAGC AGG Exonic
902404571 1:16175660-16175682 GGCCCTGGGCCTGGGGCAGCAGG + Intergenic
903137364 1:21318253-21318275 GTTCCTGCACATGCGCCAGCAGG - Intronic
903375803 1:22865100-22865122 TGTACTGGGTGTGGGCCAGCAGG - Exonic
903839514 1:26228309-26228331 GTTCCTGGGCCTTGGCCAGCTGG + Intergenic
907554054 1:55329265-55329287 GGTCCTGGCCCTCCCCCAGCTGG - Intergenic
911219847 1:95234577-95234599 GGGCCTGGGGGTGCGCACGCAGG - Intronic
914854731 1:151342826-151342848 GGGCCTGGGCGAGCTCCACCTGG - Exonic
915891939 1:159781196-159781218 GGACCTGGGCGTGCGGCACCTGG + Exonic
919920920 1:202165961-202165983 TCTCCTGGGCCTGCCCCAGCAGG - Intergenic
922287584 1:224183411-224183433 GATCCTGGGTGAGGGCCAGCGGG + Exonic
1062932852 10:1363943-1363965 GAGCCTGGGCGGGCGCCGGCAGG + Intronic
1063759451 10:9056785-9056807 GCTCCTGGGCTGGCGCCTGCTGG + Intergenic
1068121401 10:52785278-52785300 GGTCCTGGGACTGCTCAAGCTGG - Intergenic
1072283817 10:93894252-93894274 GGTCCCGAGCGGGCGCCGGCGGG + Intronic
1074536253 10:114330320-114330342 GGTCTTGGGTCAGCGCCAGCAGG - Intronic
1075954642 10:126512083-126512105 GTCCCTGGGCGTGCGCTAGAAGG - Intronic
1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG + Intergenic
1077133830 11:988560-988582 GGACGTGAGCGTGCGGCAGCGGG + Exonic
1077217476 11:1400954-1400976 GGAGCTGGGCATGCACCAGCAGG - Intronic
1077391139 11:2301143-2301165 GTTCCTGAGCGGGCGGCAGCTGG + Intronic
1083246278 11:61430205-61430227 CGTCCGGGGCGGGCGGCAGCGGG + Intronic
1089496487 11:118910765-118910787 GGGGCTGGGCGCGCGCCAGCCGG + Exonic
1105443752 13:20435699-20435721 GGGCCTGGGCCTGCGCAGGCCGG + Intronic
1105779620 13:23695371-23695393 GGCCCTGGGCGCCCGCCGGCTGG - Intergenic
1105996610 13:25678511-25678533 GGCCCTGAGAGTGTGCCAGCAGG + Intronic
1106568374 13:30906195-30906217 GGTCGTGGCCGTGGGCCGGCAGG + Exonic
1107387317 13:39926122-39926144 GGTCCTGGGAGTGTGCCTGCTGG + Intergenic
1111951782 13:94713540-94713562 GGTCCTGGGGGTGTGGGAGCGGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113681502 13:112248018-112248040 GCTCCTGAGCCTGGGCCAGCAGG - Intergenic
1113872218 13:113566252-113566274 GGGCCGGGGCGGGCGACAGCGGG + Intergenic
1114043173 14:18698635-18698657 GATCCTGGGCATGCGCTAGCCGG - Intergenic
1114047463 14:18889081-18889103 GATCCTGGGCATGCGCTAGCTGG - Intergenic
1114116750 14:19630327-19630349 GATCCTGGGCATGCGCTAGCCGG + Intergenic
1122930735 14:104932060-104932082 GGGCGTGCGCGTGCGCCTGCTGG + Exonic
1123434465 15:20244952-20244974 GGTGCTGGGCGTACGTGAGCCGG + Intergenic
1125722907 15:41853646-41853668 GCTCCTGGGCCTTCGCCTGCAGG + Exonic
1125748277 15:42012056-42012078 TGTCCAGAGCCTGCGCCAGCAGG - Intronic
1126113353 15:45187908-45187930 GGCCCCGGGCGGGAGCCAGCCGG + Intronic
1129263930 15:74383861-74383883 GGTCCCGGGCCTGCACCACCTGG + Intergenic
1129291963 15:74575148-74575170 GCTCCTGGGTTTGCACCAGCTGG - Intronic
1129921363 15:79322043-79322065 GGTCCTGGGCCTCCCGCAGCCGG - Exonic
1130168124 15:81484116-81484138 GCTCCTGAGCATGCGGCAGCAGG + Intergenic
1132748564 16:1447029-1447051 GGCCCTGGGCCTGCGGCACCTGG - Exonic
1132809318 16:1789995-1790017 GGCCCTGGGCGTGGCCAAGCCGG + Intronic
1133046290 16:3090062-3090084 GGTCCTGGGCGTGCGCCAGCAGG + Exonic
1133055735 16:3144638-3144660 GGTCCTGGGTGTGAGTGAGCTGG + Exonic
1136373175 16:29848693-29848715 GGTGCTGTGGGTGCTCCAGCAGG - Intergenic
1138542984 16:57699648-57699670 GGTTCTGGGCTGGGGCCAGCTGG - Intronic
1138549744 16:57740845-57740867 GGGCCTGGGCGGGCACCAGAGGG - Intronic
1139775093 16:69311744-69311766 GGCCCTGGGGCTGGGCCAGCCGG - Intronic
1142088003 16:88194584-88194606 GGTCCTGGGCGTGGGGCGGGAGG + Intergenic
1143480068 17:7223049-7223071 GGGGCTGGGCTTGCGCCAGAGGG - Intronic
1144891434 17:18496471-18496493 GGTCCTGGGCCTGGCCCAGGAGG + Intergenic
1145140787 17:20447846-20447868 GGTCCTGGGCCTGGCCCAGGAGG - Intergenic
1150069252 17:62138172-62138194 GGCCCTGGGCGAACTCCAGCAGG + Intergenic
1152784320 17:82240117-82240139 GCCCCTGGCCTTGCGCCAGCTGG + Intronic
1153779327 18:8480040-8480062 GGTCCTGGGGGTGGGCGAGGGGG - Intergenic
1154046060 18:10905948-10905970 GCTCCTGGGAGTGGGCCATCAGG + Intronic
1154218580 18:12433219-12433241 GGTCCGGGACTTTCGCCAGCAGG + Intergenic
1154266470 18:12883528-12883550 GGTCCTGCGCGGGCGCCAGCTGG + Intronic
1154501626 18:15000389-15000411 GGTCCTGGGGCTGCGCCCTCTGG + Intergenic
1155053451 18:22166748-22166770 CTTCCTGGGCGCGCCCCAGCTGG - Intergenic
1155819963 18:30362430-30362452 GGTCCTGGGCCTGCTGCAGGAGG - Intergenic
1160565931 18:79786579-79786601 CGTCCTGGCCCTGCCCCAGCAGG - Intergenic
1160726862 19:621207-621229 GGCCCTGGGCGAACTCCAGCAGG + Exonic
1161290598 19:3491710-3491732 GGGCCAGGGCGGCCGCCAGCTGG + Exonic
1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG + Exonic
1162870355 19:13581632-13581654 GGTCCTGCGGGTGGGCCTGCGGG - Intronic
1165030694 19:32996074-32996096 GGTGCTGGGCGTACGTGAGCCGG + Exonic
1165668465 19:37654967-37654989 GGTCCCGGGCGTGGGCAACCGGG - Intronic
1166097385 19:40549383-40549405 CGTCCAGGTCGTGCGCCACCTGG - Exonic
1166126193 19:40716819-40716841 GGTCCTGGTGGCGCGCCAGTGGG - Exonic
1167461200 19:49625568-49625590 GGGCCTGTGCTTGGGCCAGCAGG - Exonic
1168337105 19:55602962-55602984 GGTGCTGGGCCTGAGCCAGGGGG + Exonic
1168465118 19:56595455-56595477 GGTCCAGGGCGTGCGGGCGCAGG + Intronic
1168722758 19:58563257-58563279 GCCCCTGGGGGAGCGCCAGCGGG + Exonic
925375397 2:3380178-3380200 ACGCCTGGGCGCGCGCCAGCGGG - Intronic
927495620 2:23549820-23549842 GGCTCTGGGGGTGAGCCAGCAGG + Intronic
929608435 2:43251641-43251663 GGTGCTAGGCATGCCCCAGCTGG - Intronic
932329452 2:70889368-70889390 GGTCCTGGGGGTGCGAGCGCGGG - Intergenic
934993503 2:98937055-98937077 GGCCCTGGGCGTGCACCGCCGGG - Intergenic
937241754 2:120466397-120466419 GGACCTGGGCCTGGGCCAGGAGG + Intergenic
938424840 2:131177609-131177631 GATCCTGGGCATGCGCTAGCCGG - Intronic
943639590 2:190343827-190343849 GGCGCTGGGCGTGCGGCCGCAGG - Exonic
946861203 2:224001699-224001721 GGTCCTGGGGATGCTTCAGCTGG - Exonic
947723563 2:232383048-232383070 GGCCCTGGGGCAGCGCCAGCAGG + Intergenic
947748905 2:232522861-232522883 GGTACTGGGCGTGGGTGAGCCGG + Exonic
947903686 2:233743877-233743899 GGTGCTGGACGTGCCCCGGCAGG - Intronic
948017143 2:234700016-234700038 GGGCCTGGGAGTGCACCAGGTGG - Intergenic
1170890223 20:20369422-20369444 GCGCCTGGTGGTGCGCCAGCAGG - Exonic
1171439144 20:25147257-25147279 GGTCCTGGGGGGTCCCCAGCAGG + Intergenic
1175399594 20:58692875-58692897 GGGCCGGGGCGTGGGCCGGCAGG + Exonic
1175894679 20:62330835-62330857 GATCCTGCGCGTGGGTCAGCGGG + Exonic
1178882673 21:36461467-36461489 GGTCTTGGGGCAGCGCCAGCAGG + Exonic
1179913300 21:44461255-44461277 GGTGCGGGGCGTGGGCCTGCCGG + Exonic
1180465997 22:15611752-15611774 GATCCTGGGCATGCGCTAGCCGG - Intergenic
1180999467 22:19981370-19981392 GGTCCTGAGCCTGGGCCACCAGG - Exonic
1181014793 22:20062603-20062625 GGTCCTCGGCCTGCCCCAGATGG - Intronic
1181173478 22:21023124-21023146 AGTTCTGGGCCTGGGCCAGCAGG - Exonic
1182462472 22:30492244-30492266 TGTCCTGGGCGTGCTCCCCCGGG + Intronic
1182731438 22:32498411-32498433 GGTCCTGGAAGTGGGCCAACTGG - Exonic
951981777 3:28575179-28575201 TGCCCGGGGCGGGCGCCAGCTGG - Intergenic
952919564 3:38275497-38275519 GGGCCTGGGCCTGGGCCTGCTGG - Intronic
960699862 3:120429105-120429127 GAGCCTGGGCGTGGGCAAGCTGG - Intronic
961568490 3:127781792-127781814 GGTCGTGGGCGAACACCAGCAGG + Exonic
961754855 3:129121669-129121691 GGGCCGGGGCGGGAGCCAGCCGG - Exonic
968786594 4:2626509-2626531 GGTCCTGGTCATCTGCCAGCGGG - Exonic
973624018 4:52752934-52752956 GGTGCTGGGGGTGCTCCAGCCGG - Intergenic
985084098 4:186295304-186295326 GATTCTGGGCGTGCGCATGCAGG - Intergenic
985525314 5:398598-398620 GGTCCTGGGCCTGCCCCTGGTGG + Intronic
998349675 5:141492465-141492487 GGTCCTGGGCGGCCGCGATCTGG - Intronic
1002131941 5:177087171-177087193 GGACCTGGGCGTCCGCCGGGCGG + Intronic
1002259505 5:177983953-177983975 GGTCCAGGGCATGTGCCACCCGG + Intergenic
1002300183 5:178253360-178253382 GGTCCTGGGCCTGGGCCTGGGGG - Intronic
1002716743 5:181232835-181232857 GCTCCTGGGCCTCTGCCAGCAGG - Exonic
1006648528 6:35532338-35532360 GCTTATGGGCGTGGGCCAGCTGG - Intergenic
1007652498 6:43432248-43432270 GGTCCTGGGCCTGCCCCTGGTGG - Exonic
1026523075 7:71132772-71132794 GGTCCGGGGCGAGGGCCGGCCGG + Exonic
1026601485 7:71781271-71781293 GCTCCTGGGCTTTCTCCAGCTGG + Exonic
1034347622 7:150397108-150397130 GGTCCCGGGCGTGCGCGCGCTGG - Exonic
1035352248 7:158255032-158255054 GGTCCTGGACGTGGGTGAGCAGG - Intronic
1037826866 8:22165027-22165049 GGGCCGGGCCGCGCGCCAGCCGG - Exonic
1049774496 8:144398195-144398217 GGCCCTGGGCATCCGCCTGCTGG - Intronic
1061061078 9:128250801-128250823 GCTCCTGGGCCTCCGCCTGCTGG + Exonic
1061130523 9:128705522-128705544 GGCCCTGGGCCTGGCCCAGCTGG + Exonic
1062397909 9:136359925-136359947 GGTGCTGGGTGGGCGGCAGCAGG - Intronic
1062498868 9:136843957-136843979 GGTCCTGGGGCTGCGCCCTCTGG - Intronic
1186612229 X:11148752-11148774 GGTGCTGGGCGGGCCCCATCCGG - Intronic
1188752695 X:33923431-33923453 TGTCCTGGCCATGTGCCAGCAGG + Intergenic
1196746286 X:119073789-119073811 GGGCCTGGGCCTGCTCCAGGAGG + Intergenic
1200003633 X:153074158-153074180 GGTCCTGGTCGGGAGCCAGAGGG + Exonic
1200004090 X:153075851-153075873 GGTCCTGGTCGGGAGCCAGAGGG - Intergenic
1200161945 X:154014092-154014114 GGGCCTGGGCCTGGGCCAGCTGG - Exonic