ID: 1133046329

View in Genome Browser
Species Human (GRCh38)
Location 16:3090301-3090323
Sequence CACAGGAAGGAGCGCCCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133046323_1133046329 1 Left 1133046323 16:3090277-3090299 CCGAAGCTCTTCCCGCAGCAAAG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG 0: 1
1: 0
2: 0
3: 24
4: 200
1133046326_1133046329 -10 Left 1133046326 16:3090288-3090310 CCCGCAGCAAAGGCACAGGAAGG 0: 1
1: 0
2: 6
3: 36
4: 357
Right 1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG 0: 1
1: 0
2: 0
3: 24
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133046329 Original CRISPR CACAGGAAGGAGCGCCCAGC CGG Exonic
900474468 1:2869683-2869705 CCCAGGAGGGAGCTACCAGCCGG + Intergenic
900495865 1:2975736-2975758 CACAGGATGGACAGGCCAGCTGG + Intergenic
901060128 1:6468055-6468077 CTCAGGAAGCTGGGCCCAGCTGG - Exonic
901690405 1:10969555-10969577 CCCTGGAAGAAGCGCCCATCTGG - Intronic
902233370 1:15042507-15042529 CACAGGACTGGGCTCCCAGCAGG - Intronic
902242090 1:15096031-15096053 CTCAGGAAGGAAAGCCCAGCAGG - Intronic
903587202 1:24425071-24425093 CCCAGGAAGCAGCTCCCAGCAGG + Intronic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
907509492 1:54947608-54947630 CACTGGTAGGATTGCCCAGCTGG + Intergenic
911114828 1:94236826-94236848 CTCAGGAATGAGAGCCCAACTGG + Intronic
914912584 1:151799731-151799753 AACAGGGAGGAGGGCACAGCAGG - Intergenic
915513693 1:156400803-156400825 CCCAGGAAGGATAGCCCAGCCGG + Intergenic
916122592 1:161542142-161542164 CACAGGAAGGAAAGCGCAGGAGG - Exonic
916132491 1:161623579-161623601 CACAGGAAGGAAAGCGCAGGAGG - Intronic
916172784 1:162013268-162013290 CACAGGAAGGAGAGGTCAGCTGG + Intronic
918982319 1:191579034-191579056 TACAGAAAGGAGAGCACAGCAGG + Intergenic
922027028 1:221759891-221759913 CACAGGAAGCAGCCCCAAGCAGG - Intergenic
922875869 1:228939498-228939520 CACAGGAGGCTGGGCCCAGCAGG + Intergenic
924004043 1:239587290-239587312 CACAGGAAGGAGGGCTGAGTTGG - Intronic
924467969 1:244315246-244315268 CACAGGGTGGAGCGCAGAGCTGG - Intergenic
924574624 1:245268650-245268672 CACAGGAAGCAGAGCCCGGGAGG + Intronic
1063171318 10:3512451-3512473 CACAGGAAGGCGCCCCCCACAGG + Intergenic
1066430779 10:35349210-35349232 CTCTGGAAGGAGAGCTCAGCAGG + Intronic
1066469095 10:35680673-35680695 GACAGGAAGGAGTGCACAGGTGG + Intergenic
1067683301 10:48453511-48453533 CACAGGCAGCAGGGCTCAGCAGG - Intronic
1071095693 10:81971701-81971723 CACAGGGAGGAGAACCCAGGTGG + Intronic
1074264596 10:111888950-111888972 CTCAGGAAGGAGCAGCCAACTGG + Intergenic
1074854413 10:117462608-117462630 CAGAGGAAGAAGCAACCAGCAGG - Intergenic
1075046003 10:119147164-119147186 GACAGGGAGGCGCGCCCAGCAGG + Intronic
1076755814 10:132571095-132571117 CACGGTGAGGAGGGCCCAGCAGG - Intronic
1077038414 11:506651-506673 CCCGGGAAGGAGCGCCCTGGCGG - Intronic
1077065932 11:640929-640951 GAGAGGAAGCAGCACCCAGCAGG + Intergenic
1077119654 11:901007-901029 CACAGGCACGTGCGCCCAACTGG + Intronic
1077144150 11:1037242-1037264 AACAGGAAAGATCACCCAGCGGG + Intergenic
1077248364 11:1549849-1549871 CAGAGGTAGGAGCGCCCTGCGGG - Intergenic
1081810935 11:45913832-45913854 CATAGAAAGGAGAGCGCAGCAGG + Exonic
1082013160 11:47464548-47464570 CACAGGCAGCAGCGCCCTGCAGG + Intergenic
1088579514 11:111300892-111300914 CAGGGGGAGGAGCGGCCAGCAGG + Intronic
1090837021 11:130461334-130461356 CCTAGGAAGAAGAGCCCAGCTGG + Intronic
1096766544 12:53895481-53895503 CACAGGAAGGTGCTCCCTGAGGG - Intergenic
1099573987 12:84358717-84358739 AACAGGAAGGAGGTCTCAGCAGG - Intergenic
1102521077 12:113477713-113477735 CCGGGGAAGGAGCACCCAGCAGG - Intergenic
1103231754 12:119337012-119337034 CCCAGGAAGGAGGGCCTGGCAGG + Intronic
1103577405 12:121888667-121888689 CACCGGAAGCCGCGCCCTGCCGG - Intergenic
1103614070 12:122141226-122141248 CTCAGTCAGGAGCGCCCAGTGGG + Intronic
1103698988 12:122838209-122838231 CACAGGCACCAGCTCCCAGCAGG - Intronic
1103902828 12:124312060-124312082 CCCAGGAAGCAGCACCCAGAGGG - Intronic
1104668731 12:130666539-130666561 CACAGGATTGAGCTCACAGCAGG - Intronic
1104981907 12:132576983-132577005 CACAGGAAGGCAGGCTCAGCTGG - Intronic
1105303340 13:19153654-19153676 AACAGGAAGGAGCAGCCAGGGGG + Intergenic
1107274041 13:38656826-38656848 AACAAGAAGGAGCTCCCTGCAGG + Intergenic
1109527314 13:63593443-63593465 CAGCGGAAGGAGACCCCAGCGGG - Intergenic
1110849836 13:80232481-80232503 CACAGCAAGGAGCCCCCTGAGGG - Intergenic
1113604652 13:111596611-111596633 CCCAGGAAGGAGCGCAGAGCAGG - Intronic
1113641534 13:111961141-111961163 CACAGCAGGGAGCTCCCAGAGGG - Intergenic
1113733238 13:112657505-112657527 AACAGGAAGGAGGCCCCATCAGG - Intronic
1113733278 13:112657624-112657646 AACAGGAAGGAGGCCCCACCAGG - Intronic
1113733289 13:112657658-112657680 AACAGGAAGGAGGCCCCATCAGG - Intronic
1117434519 14:55703352-55703374 CTGAGGATGGAGGGCCCAGCGGG + Intergenic
1119621459 14:76134983-76135005 CAAAGTAAGGTGCTCCCAGCTGG - Intergenic
1119623769 14:76152532-76152554 CACAGGAAGGAACGGGTAGCTGG - Intronic
1121315592 14:92959291-92959313 CCCAGGAAGGAGCCACCAGACGG + Intronic
1121484842 14:94306576-94306598 GACTGGAGGGAGTGCCCAGCTGG + Intronic
1122719343 14:103713444-103713466 CACAGGGAGCAGCCCACAGCAGG + Intronic
1122901776 14:104785033-104785055 CACAGCAAAGTGAGCCCAGCAGG + Intronic
1122913355 14:104844409-104844431 CAGAGGAAGCAGGGCCCGGCTGG - Intergenic
1123948680 15:25251126-25251148 CTCAGGAAGGAGCCACCAACCGG - Intergenic
1124257187 15:28153814-28153836 CAAGGGAAGGAGCACCCAGTAGG + Intronic
1127599246 15:60518722-60518744 CACAGGAAGGAAGGTGCAGCAGG - Intronic
1127837208 15:62799574-62799596 AACAGGGATGAGCACCCAGCAGG - Intronic
1129888265 15:79053724-79053746 CACAGGATGGAGGGCACAGAGGG + Intronic
1132060108 15:98685526-98685548 CAGAGGAAGAGGTGCCCAGCTGG - Intronic
1133046329 16:3090301-3090323 CACAGGAAGGAGCGCCCAGCCGG + Exonic
1134062213 16:11206062-11206084 CACCGGATGGAGTGCCCAGATGG + Intergenic
1136029647 16:27493405-27493427 GGCAGGAAGGAGAGCCCAGTGGG - Intronic
1137530926 16:49278354-49278376 CGCAGGAAGGAGCGCAAGGCCGG + Exonic
1138339044 16:56276564-56276586 TACAGGAAGGAGAGCCCTGTAGG - Intronic
1138510984 16:57508289-57508311 CACAGGCTGGAGTGCCCAGACGG - Intergenic
1140987468 16:80172055-80172077 CATAGTCAGGAGTGCCCAGCTGG - Intergenic
1141948911 16:87328265-87328287 CTCAGAATGGAGCGGCCAGCAGG + Exonic
1142221989 16:88859969-88859991 CACAGAAAGTAGGGCCCACCTGG - Exonic
1143100227 17:4500480-4500502 CATAGGAAGGGGCTCCCTGCAGG + Intronic
1145063537 17:19747264-19747286 CACAGGGAGGAGGGACCTGCTGG + Intronic
1145359533 17:22200861-22200883 GACTGGAAGGAGCGCCCACAAGG - Intergenic
1147951674 17:44111135-44111157 GACAGGAAGGGGAGCTCAGCGGG + Intronic
1148148139 17:45378953-45378975 CGGAGGATGGAGTGCCCAGCAGG - Intergenic
1148561745 17:48610427-48610449 CGCGGAAAGGGGCGCCCAGCCGG + Intronic
1149868034 17:60161483-60161505 CACAGGAAGGCGTGCCCACCAGG + Intronic
1150583893 17:66500148-66500170 TCCAGGAAGCAGAGCCCAGCTGG + Intronic
1151950385 17:77350250-77350272 CACAGGAAGGAGGGCTCAACAGG - Intronic
1152132460 17:78485398-78485420 CTCAGGAAGGAAAGGCCAGCGGG + Intronic
1152479727 17:80542533-80542555 CACAGAAAGAGCCGCCCAGCTGG + Intergenic
1153056594 18:951637-951659 CAGAGGCAGAAGCCCCCAGCTGG - Intergenic
1155910396 18:31498400-31498422 AGCAGGAAGGAGCGCCGGGCAGG - Intronic
1156664023 18:39383495-39383517 CAGAGGAGGGAGAGCCCAGCGGG - Intergenic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157405739 18:47421373-47421395 GTCAGGAAGGACAGCCCAGCAGG + Intergenic
1158453483 18:57586825-57586847 CGCAGGGAGCGGCGCCCAGCTGG - Intergenic
1160404740 18:78637865-78637887 CAAGGGAAGGAGCGCCTCGCAGG - Intergenic
1161092041 19:2365752-2365774 CACAGGAAGTTGAGACCAGCTGG + Intergenic
1161449807 19:4338771-4338793 CACTGGAAGGAGAGGCCAGGCGG - Exonic
1161575565 19:5052603-5052625 CCCAGGCAGGAGCTGCCAGCAGG - Intronic
1161736289 19:5994257-5994279 CACAGGGCGCTGCGCCCAGCTGG + Exonic
1162122630 19:8481097-8481119 CACAGGAAGGGGCACCGAGTAGG - Intronic
1163124403 19:15237039-15237061 CATGGGCAGGAGCGGCCAGCTGG + Exonic
1164501993 19:28827936-28827958 TCCAGAAAGGAGCACCCAGCTGG - Intergenic
1166982339 19:46638789-46638811 CACAGGGAGGAGGGCCAGGCGGG + Intergenic
1168046570 19:53798379-53798401 CACAGGCGGCAGAGCCCAGCCGG + Exonic
1168455317 19:56503003-56503025 CACAGGAAGCAGAGCTCAGGCGG - Intergenic
924968544 2:101170-101192 CACAGGGAGGGCAGCCCAGCAGG + Intergenic
925266737 2:2571273-2571295 CTCAGGAAGGAAGGCCCTGCTGG + Intergenic
925821916 2:7807210-7807232 GACAGGAAGGAGAGCTCAGGTGG + Intergenic
925906878 2:8544985-8545007 CACAGGGAGCAGGGCACAGCTGG + Intergenic
925961231 2:9018799-9018821 CACAAGAAGCAGCACCCAGATGG - Intergenic
926415960 2:12649997-12650019 CTCAGGATGGAACGGCCAGCTGG + Intergenic
929142534 2:38678738-38678760 GCCAGGAAGGAGAACCCAGCAGG - Intronic
929849330 2:45569328-45569350 CACAGGAACGGGAGACCAGCAGG - Intronic
930847733 2:55923693-55923715 CACAGGTAGGAGCCCCCAACGGG - Exonic
932440736 2:71733106-71733128 GACGGGAAGGAGCAGCCAGCGGG - Intergenic
933354203 2:81194406-81194428 CACAGGGACTAGTGCCCAGCGGG + Intergenic
934561641 2:95316597-95316619 AACAGGAAGGAGAACCCAGGTGG + Intronic
938291654 2:130153838-130153860 GAGAGGAAGGAGTGGCCAGCCGG + Exonic
938408612 2:131046211-131046233 CACTGGCAGGAAGGCCCAGCAGG - Exonic
938464897 2:131519125-131519147 GAGAGGAAGGAGTGGCCAGCCGG - Intergenic
939096420 2:137837977-137837999 CACAGGCAGGAGGTCACAGCAGG - Intergenic
942318047 2:174712297-174712319 CTCAGGCAGCAGAGCCCAGCAGG - Intergenic
944153218 2:196584210-196584232 CACAGGAAGCAACTCCCACCTGG - Intronic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946225657 2:218262869-218262891 CTCAGGAAGAAGCAGCCAGCAGG - Exonic
947188259 2:227473061-227473083 CCCCAGCAGGAGCGCCCAGCAGG - Intronic
948024674 2:234767503-234767525 CTCAGGGAGGAAAGCCCAGCTGG - Intergenic
949073423 2:242040330-242040352 CACAGGAGGGAGAGCTCAGCGGG + Intergenic
1168842265 20:917017-917039 GACAGGAAGCAACTCCCAGCTGG - Intergenic
1172949046 20:38710572-38710594 CAAAGGAAGGAGCCAGCAGCTGG + Intergenic
1173207363 20:41005599-41005621 CCCAGGAAGGAGCCGCCAGGAGG + Intergenic
1175194899 20:57236316-57236338 CACAGGAGAGAGCGCTCAGGAGG + Intronic
1176216159 20:63948898-63948920 CACGGGGAGGAGTGCCCAGGTGG - Intronic
1180261717 21:46674816-46674838 CACAGGGAGGGCAGCCCAGCAGG - Intergenic
1181111293 22:20604451-20604473 AACAGGAAGGAGTGGCCAGCTGG + Intergenic
1182098573 22:27642189-27642211 CAGAGGAAGGAGCCGCCTGCTGG - Intergenic
1182194944 22:28506339-28506361 CACAGGCAGGACCTCCCTGCAGG + Intronic
1183251018 22:36730411-36730433 CACAGGCAGCAGCTGCCAGCTGG - Intergenic
1183741992 22:39673985-39674007 CACAGGAATGCGGGCCCTGCTGG + Exonic
1184452546 22:44591609-44591631 CACAGGCAGGACAGCCCGGCAGG - Intergenic
1184923831 22:47623943-47623965 CACTGCCAGGAGCGCCCAGCAGG - Intergenic
949874766 3:8618869-8618891 CACAGGCAGGAGCTCCCACCTGG - Intergenic
950487403 3:13281717-13281739 CCCTGGAAGGGCCGCCCAGCAGG + Intergenic
952460995 3:33525909-33525931 CCTAAGAAGGAGCTCCCAGCGGG + Intronic
953336505 3:42098729-42098751 GAAAAGAAGGAGCGCCTAGCAGG + Intronic
954786363 3:53095773-53095795 CACCTGAAGAAGCCCCCAGCAGG + Intronic
957482053 3:80810890-80810912 GACAGGAGGGAGATCCCAGCTGG - Intergenic
963938491 3:151078047-151078069 AACAGGAAGCAGGGGCCAGCTGG - Intergenic
964368057 3:155970550-155970572 CACAGGAAGGAGTGCACACTGGG + Intergenic
969211600 4:5692041-5692063 CACAGCAAGGAGAGCCAAGGAGG - Intronic
972407596 4:38761673-38761695 CACAGGAAGAGGCGCTCTGCCGG + Intergenic
976492990 4:85693535-85693557 CACAGGATGGAGCCACCAGCAGG - Intronic
978213618 4:106169945-106169967 GACAGGAAGCAGCGCTCAGGTGG + Intronic
980924983 4:139127601-139127623 CTCTGGAAACAGCGCCCAGCCGG + Intronic
984951509 4:185011222-185011244 AGCACGAAGGAGCGCCCAGTAGG - Intergenic
985475664 5:77626-77648 CACAGGAAAGAGCCACCTGCAGG - Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
990327627 5:54694028-54694050 GGCAGGAAGAAGCCCCCAGCAGG + Intergenic
992371946 5:76152661-76152683 CAAAGGAAGGAGTGATCAGCTGG - Intronic
994353843 5:98773893-98773915 CGCAGCAAGCAGCGCGCAGCCGG - Intronic
997286345 5:132681428-132681450 GGCAGGAAGGAAAGCCCAGCTGG + Intronic
998044343 5:138974246-138974268 CACAGGCAGGAGAGCCCAAGAGG - Intronic
1002908562 6:1470770-1470792 CACAGGAATGAGAGTCCAGCAGG + Intergenic
1004886188 6:20053698-20053720 CCCAGGAAGGTGCCACCAGCGGG - Intergenic
1006026470 6:31150332-31150354 CACAGGAAGGAGATCTAAGCAGG + Intronic
1006844867 6:37055240-37055262 GACAGGAAGGAACTCACAGCAGG + Intergenic
1007714584 6:43848337-43848359 GCCAGGAAGGACCTCCCAGCTGG - Intergenic
1008069306 6:47083695-47083717 ATCAGGAAGTAGAGCCCAGCTGG + Intergenic
1010020977 6:71159524-71159546 CTCATGAAGGTGCTCCCAGCAGG + Intergenic
1011719041 6:90136096-90136118 CACAGGAAGGAGAACCCTGGTGG - Intronic
1013364893 6:109429594-109429616 CCCAGGCAGGAGCACCTAGCTGG - Intronic
1014013207 6:116500527-116500549 CACAGAGAAGATCGCCCAGCAGG + Exonic
1017788374 6:157774590-157774612 CAGAGGAAGGAGACCCCGGCAGG - Intronic
1018031565 6:159845503-159845525 CCCAGGCAGGGGCACCCAGCGGG - Intergenic
1018393201 6:163356536-163356558 CACAGGCAGGAGTTCCCCGCGGG + Intergenic
1018434888 6:163750921-163750943 CACAGCAAGGAAGGCGCAGCCGG - Intergenic
1019544111 7:1564998-1565020 CACAGGAGCGAGGCCCCAGCGGG - Intergenic
1021986935 7:26106317-26106339 CAAAGGAGGCAGCTCCCAGCAGG + Intergenic
1022101692 7:27173061-27173083 CACAGGAAAGAGCGCACAGGAGG + Intronic
1023841070 7:44097739-44097761 GAGAGGAAGGGGCTCCCAGCAGG - Intergenic
1027251547 7:76401735-76401757 CAGAGGAAGGGGCTCCAAGCTGG - Intronic
1029105019 7:98167861-98167883 CCGAGGAAGGAGCGGCCAGTGGG + Intronic
1034546006 7:151789839-151789861 CACAGTCAGGAGCTCCCAGCCGG + Intronic
1035410637 7:158637715-158637737 CCAAGGAAGGAGCCCCCACCCGG - Intronic
1035599805 8:890891-890913 CACAGCGAGGATCTCCCAGCTGG - Intergenic
1038396518 8:27249674-27249696 CACAGAAGGGAGACCCCAGCAGG + Intronic
1039248179 8:35632544-35632566 CACAGGGATGAGGCCCCAGCTGG - Intronic
1039517584 8:38146452-38146474 CAGAGAAAGGAGCCCCCAGAAGG + Intronic
1042484911 8:69338297-69338319 CACAGGAGGGAGAGCTCAGTGGG + Intergenic
1048872612 8:138811920-138811942 CACTGGAAGGAAAGCCCAGGAGG + Exonic
1049001812 8:139831079-139831101 GACAGGAAGGAGCTCCCTGTGGG + Intronic
1049280402 8:141741270-141741292 CACAGGGAGGGCAGCCCAGCCGG - Intergenic
1049521627 8:143094406-143094428 CGCAGGAAGCACCGCACAGCTGG - Intergenic
1049838532 8:144755367-144755389 ACCAGGAAGGAGCGCCAAGCGGG - Intronic
1053527004 9:38840470-38840492 CCCCAGAAGGAGCTCCCAGCTGG - Intergenic
1054199230 9:62064901-62064923 CCCCAGAAGGAGCTCCCAGCTGG - Intergenic
1054639126 9:67523456-67523478 CCCCAGAAGGAGCTCCCAGCTGG + Intergenic
1057791783 9:98129536-98129558 AAGAGGAAGCAGAGCCCAGCAGG - Intronic
1060284195 9:122234434-122234456 CACAGGAAGCAGCATCCTGCAGG + Intergenic
1061218345 9:129234958-129234980 CAGAGGCACGAGCTCCCAGCAGG - Intergenic
1061221221 9:129253366-129253388 CGCAGGAGTCAGCGCCCAGCGGG - Intergenic
1061295545 9:129674999-129675021 CTCTGGAAGGAGCCCGCAGCAGG - Intronic
1061941409 9:133886141-133886163 GACAGGAAGGAGCACCCATGTGG + Intronic
1062151740 9:135022829-135022851 CACAGGCAGGTGAGCGCAGCTGG - Intergenic
1062272979 9:135718229-135718251 CACAGGAAGGGGGTCCCACCAGG - Intronic
1062619078 9:137411438-137411460 CACAGGAAGGCGGGACCGGCGGG + Intronic
1185462323 X:339149-339171 CGCAGGGAGGCGCGGCCAGCAGG + Intronic
1186301175 X:8201410-8201432 AACAGGAAGGAGCCCCAGGCTGG + Intergenic
1186825952 X:13340267-13340289 CACTGGAAGGAGCGCGCAGTGGG - Intergenic
1186964760 X:14775226-14775248 CAAAGGAAGGATCCCCCAGAAGG - Intergenic
1190908625 X:54751519-54751541 CTCAGGAAGGAGCAGCCAGGTGG - Intronic
1191253656 X:58270726-58270748 CACAGGAGGGGGCGCCCAAAAGG - Intergenic
1193703338 X:84790758-84790780 CAGAGGAAGCAGAGCCCAGGGGG + Intergenic
1195280818 X:103330824-103330846 GACAGGAAGGAGGGGCCAGGAGG + Intronic
1197549623 X:127873884-127873906 CACAGGAGGCAGCGCTCAGGCGG + Intergenic
1200089163 X:153626340-153626362 CACAGCAAGGAGCCCTCAGCAGG + Intergenic
1200304109 X:155007614-155007636 CACAGGAGGCAGAGCCCAGGCGG - Intronic
1201592612 Y:15631926-15631948 CACAGGACAGAGCACCCAGAGGG + Intergenic
1202377350 Y:24249780-24249802 CAAAGCAGGGAGAGCCCAGCCGG + Intergenic
1202493430 Y:25420341-25420363 CAAAGCAGGGAGAGCCCAGCCGG - Intergenic
1202605601 Y:26637264-26637286 CACAGCCAGGAGCTCGCAGCAGG - Intergenic