ID: 1133046610

View in Genome Browser
Species Human (GRCh38)
Location 16:3091804-3091826
Sequence GGCCATGGTGAGGGGCCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 587
Summary {0: 1, 1: 0, 2: 9, 3: 95, 4: 482}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133046596_1133046610 18 Left 1133046596 16:3091763-3091785 CCAGCACAGCCGCCAGCTCCTGA 0: 1
1: 0
2: 2
3: 28
4: 343
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482
1133046594_1133046610 27 Left 1133046594 16:3091754-3091776 CCCAGCTCACCAGCACAGCCGCC 0: 1
1: 0
2: 2
3: 30
4: 299
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482
1133046599_1133046610 9 Left 1133046599 16:3091772-3091794 CCGCCAGCTCCTGATCTCGGGAA 0: 1
1: 0
2: 1
3: 35
4: 309
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482
1133046595_1133046610 26 Left 1133046595 16:3091755-3091777 CCAGCTCACCAGCACAGCCGCCA 0: 1
1: 0
2: 0
3: 32
4: 279
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482
1133046600_1133046610 6 Left 1133046600 16:3091775-3091797 CCAGCTCCTGATCTCGGGAACTC 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482
1133046601_1133046610 0 Left 1133046601 16:3091781-3091803 CCTGATCTCGGGAACTCTCCTCT 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG 0: 1
1: 0
2: 9
3: 95
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133046610 Original CRISPR GGCCATGGTGAGGGGCCCTG GGG Exonic
900000982 1:14787-14809 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900020697 1:185308-185330 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
900077809 1:832330-832352 CGCCATGGAGAGGGGCTGTGAGG + Intergenic
900118490 1:1038695-1038717 GGCCATGGGGTTGGGACCTGGGG + Intronic
900132351 1:1092453-1092475 GGCCATGGTAACAGGTCCTGTGG - Intronic
900342639 1:2195958-2195980 GGGCAGGGGGAGGGGGCCTGGGG + Intronic
900345737 1:2209527-2209549 GGCCAGGGGGCTGGGCCCTGAGG - Intronic
900368197 1:2320037-2320059 CTCCACGGTGGGGGGCCCTGAGG - Intergenic
900522492 1:3112519-3112541 GGCCACTGAGCGGGGCCCTGGGG - Intronic
900644991 1:3704971-3704993 GGCTATTGTGAGGGGGTCTGGGG - Intronic
900747667 1:4372328-4372350 GGCCATGGTTAAGGGCAATGAGG + Intergenic
900793167 1:4692563-4692585 CGCCATGGTCAGGAGGCCTGCGG - Intronic
901815064 1:11789150-11789172 GGGCAGAGGGAGGGGCCCTGGGG + Exonic
902289522 1:15427278-15427300 GGCCAAGGTGAGGAGCCCAAGGG + Exonic
902537741 1:17131012-17131034 GGCAATGGTGAGGGGAAATGTGG + Intergenic
902612968 1:17607971-17607993 GCCCAAGGTGAGGGGACCGGGGG + Exonic
902919080 1:19655978-19656000 GGGCCTGGAAAGGGGCCCTGAGG - Intronic
903190691 1:21653975-21653997 GGCCCTTGAGAGGGGCCATGGGG + Intronic
905091354 1:35433624-35433646 GGCCAGGGTGAGGGGGACTCAGG + Exonic
905569174 1:38990939-38990961 GGGCCTGGTGAGGGGCCATGGGG - Intergenic
905652239 1:39664291-39664313 GGGCATGGTGGTGGGGCCTGTGG - Intronic
905773789 1:40655044-40655066 GGCCCTGCTCATGGGCCCTGAGG + Intronic
905858654 1:41331370-41331392 TGCCATGGTGAGGAACACTGGGG + Intergenic
905960766 1:42040593-42040615 GTCCATGCTGCTGGGCCCTGAGG + Intergenic
907159796 1:52361600-52361622 GGCCATGGGCAGGGGGGCTGGGG + Exonic
907238714 1:53068937-53068959 GGCCCTGGTGAGGGCAGCTGAGG + Intronic
907542053 1:55224653-55224675 GGCCATGTGGAGAGGCCCTCGGG - Intergenic
908820905 1:68085628-68085650 GTGCATGGTGAGTGGCCCTGGGG + Intergenic
909914006 1:81295287-81295309 GGACATGGTGATGGGCCATGAGG - Intergenic
910176657 1:84438001-84438023 GGGCAGTGTGGGGGGCCCTGAGG + Intergenic
910731794 1:90405939-90405961 AGTCATGATGAAGGGCCCTGAGG + Intergenic
912376248 1:109212246-109212268 TGCAGTGGTGAGGGGCCCTGGGG + Intergenic
912550254 1:110480759-110480781 GTCCAGGATGAGGGGCCTTGTGG + Intergenic
914489993 1:148146113-148146135 AGCCATGGAGCGCGGCCCTGGGG + Intronic
915284183 1:154842390-154842412 GGCCGAGGAGAGGGGCCCTGGGG + Intronic
915330854 1:155111543-155111565 GGCCAGGGGCTGGGGCCCTGAGG - Intergenic
915895511 1:159808558-159808580 GGCCAATGTGTGGGGCCCCGAGG + Intronic
915932553 1:160069417-160069439 GGTGAGGGTGAGGGGCCATGAGG + Intronic
916506044 1:165429003-165429025 GAACATGGAAAGGGGCCCTGGGG + Intronic
916743908 1:167669784-167669806 GGACATGGTGCTGGGCCCTCTGG - Intronic
918094724 1:181325331-181325353 GGCCCTGGGGAAGGGCCGTGAGG - Intergenic
918542925 1:185650746-185650768 GGACATAGTGAAGGGCCATGAGG + Intergenic
919700851 1:200629743-200629765 GGACATGGTATGGGGCACTGGGG + Intronic
919753962 1:201054975-201054997 GGCCAGGGTCCGGGCCCCTGTGG + Intronic
921390544 1:214609101-214609123 CGCCATGGAGTGCGGCCCTGGGG - Intronic
921760463 1:218907945-218907967 GGCTAGAGTGAGGGGCGCTGGGG - Intergenic
921780245 1:219154715-219154737 GGCCATGAAGTGGGGCTCTGGGG - Intergenic
922917220 1:229268774-229268796 GCCCAACGTGAGGAGCCCTGGGG - Intergenic
922932783 1:229403328-229403350 GGCCATGCTGAGGGCACGTGGGG - Intergenic
922978872 1:229807882-229807904 GGCCCGGGTGTGGTGCCCTGAGG - Intergenic
1062803386 10:396583-396605 GTCCATGGTTAGGGGCTCTCTGG - Intronic
1064061388 10:12140538-12140560 CGCCATGGTTAGGCGCTCTGTGG - Intronic
1064564135 10:16622831-16622853 GGTCCTGTTCAGGGGCCCTGAGG - Intronic
1067068063 10:43114730-43114752 GATCCTGGTGAGGGTCCCTGCGG + Exonic
1067109263 10:43387866-43387888 GTCCATGATGCTGGGCCCTGAGG - Exonic
1067419533 10:46134131-46134153 AGGAATGGTGAGGGGCACTGGGG + Intergenic
1067426485 10:46215280-46215302 AGGAATGGTGAGGGGCACTGGGG - Intergenic
1067504885 10:46840728-46840750 AGGAATGGTGAGGGGCACTGGGG + Intergenic
1068053655 10:51983333-51983355 GGCCATGGGGAGGGAACCGGTGG + Intronic
1070398381 10:76032272-76032294 GGCCATGGGTAGGGGGCCAGGGG - Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1071328916 10:84541603-84541625 GGCCATGGTGAGGGTGAGTGTGG - Intergenic
1071397570 10:85238564-85238586 GGAGGAGGTGAGGGGCCCTGTGG + Intergenic
1073065933 10:100759219-100759241 GGCCCTGAGGAGGGGCCCAGAGG + Intronic
1073190874 10:101649909-101649931 GGCCATGGTTGGGGGCCTGGAGG + Intronic
1074460950 10:113636284-113636306 GGCCAAGGTGTGGGCCCTTGGGG - Intronic
1074769451 10:116723880-116723902 GGGTATGGTCAGGGGCCCTCAGG - Intronic
1074823913 10:117201300-117201322 GGCCACCGTGAGGGGGACTGTGG - Intronic
1075864565 10:125706532-125706554 GGTGATGGTGACGGCCCCTGGGG + Intergenic
1076402595 10:130193669-130193691 CGCCATGGTGAGGAGTCCTGCGG - Intergenic
1076690736 10:132222824-132222846 GGCTCAGGTGGGGGGCCCTGGGG - Intronic
1076739934 10:132478091-132478113 GGCTGAGGAGAGGGGCCCTGGGG + Intergenic
1076760530 10:132603831-132603853 GGACATGGTGTGGGTCACTGTGG + Intronic
1076979126 11:195919-195941 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979154 11:195994-196016 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979185 11:196071-196093 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979222 11:196161-196183 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979237 11:196200-196222 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979251 11:196238-196260 GGACCTGGTGAGGGGACATGAGG + Intronic
1076979282 11:196315-196337 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979297 11:196354-196376 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979313 11:196392-196414 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979329 11:196430-196452 GGACCTGGTGAGGGGACATGGGG + Intronic
1076979345 11:196468-196490 GGACCTGGTGAGGGGACATGGGG + Intronic
1077131378 11:974446-974468 GGCCAAGGTGGGCGGGCCTGAGG + Intronic
1077187848 11:1243443-1243465 GGCCATGGTGTTCGGCACTGGGG - Exonic
1077216271 11:1396433-1396455 GGCCATGATGAGAGGGCCCGGGG - Intronic
1077321948 11:1946702-1946724 GGGCGAGGTGAGGGGCCCTGGGG + Intergenic
1077352444 11:2099190-2099212 GGCCATGTTCAGACGCCCTGCGG - Intergenic
1077371920 11:2186292-2186314 GGAGAAGGTGAGAGGCCCTGGGG - Intergenic
1077469503 11:2750388-2750410 GGCCTTCCTTAGGGGCCCTGGGG + Intronic
1077488013 11:2847983-2848005 GGCCCCGATGAGGGGTCCTGAGG + Exonic
1077579325 11:3406737-3406759 GGCCACGAGGAGGAGCCCTGCGG + Intergenic
1077707718 11:4503926-4503948 GGCCATGGCTTGGGACCCTGGGG + Intergenic
1078325302 11:10375742-10375764 GGCCAGCGTTAGGAGCCCTGGGG - Intronic
1081343492 11:41955796-41955818 GGAAATGGTGAGAGTCCCTGGGG + Intergenic
1081850214 11:46270543-46270565 GGTCAGGGTGAGGGGCCCCAAGG - Intergenic
1081932094 11:46878725-46878747 GGGCCTGGGGAGAGGCCCTGGGG - Intronic
1083664480 11:64267145-64267167 GGCTCAGCTGAGGGGCCCTGAGG - Intronic
1084009276 11:66338664-66338686 TGCCAGGGTGGGGGGCCCTGAGG + Intronic
1084181430 11:67448484-67448506 TGCCATGGTGGGGAGGCCTGGGG + Intergenic
1084185076 11:67467296-67467318 GGGCTGGGTGAGTGGCCCTGAGG - Exonic
1084196378 11:67525234-67525256 GGCAATGCAGAGGGACCCTGGGG - Intergenic
1084236354 11:67790280-67790302 GGCCATGAGGAGGAGCCCTGCGG + Intergenic
1084302692 11:68261810-68261832 GGCCTGGGTGAGGGGCTCAGTGG + Exonic
1084836058 11:71802712-71802734 GGCCATGAGGAGGAGCCCTGCGG - Intergenic
1085310508 11:75513914-75513936 GGAAGTGGTGAGGGTCCCTGCGG - Intronic
1085409864 11:76284519-76284541 GGCACTGAGGAGGGGCCCTGTGG + Intergenic
1085417499 11:76329112-76329134 GGCCCTGGAGCGGGGTCCTGGGG - Intergenic
1085463100 11:76706979-76707001 GGAAAATGTGAGGGGCCCTGGGG - Intergenic
1087038162 11:93774123-93774145 GGCCATGCTTTGGGGGCCTGGGG - Intronic
1087349156 11:97008965-97008987 GGTCATCTTGAGGGGCCATGTGG + Intergenic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089730778 11:120517455-120517477 GGCCATGGGCAGGCCCCCTGAGG + Intronic
1089776530 11:120840885-120840907 GGCCATGGGGAGGGGGAATGGGG - Intronic
1090775313 11:129959525-129959547 AGCCAAGGTCAGGGTCCCTGTGG - Intronic
1090965291 11:131592807-131592829 GGCCAGGGAGAGGGGACCTGGGG - Intronic
1091150619 11:133325103-133325125 GGCAGTGGTGAAGGGCCCCGTGG + Intronic
1202804964 11_KI270721v1_random:2015-2037 GGGCGAGGTGAGGGGCCCTGGGG + Intergenic
1091374071 12:14902-14924 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1091779722 12:3206073-3206095 GGCCAGGGTGGAGGGCCCAGCGG - Intronic
1091886086 12:4018131-4018153 GGAAATAGTGAGTGGCCCTGGGG - Intergenic
1092056167 12:5510110-5510132 GGCCATGCTGGGGGGCCCAGTGG - Intronic
1092229178 12:6767202-6767224 GGCCGCGGGGAGGGGCCCGGAGG - Intronic
1092407260 12:8229687-8229709 GGCCACGAGGAGGAGCCCTGCGG + Intergenic
1092423721 12:8356248-8356270 TGCTATAGTGAGGGTCCCTGGGG - Intergenic
1097225041 12:57471970-57471992 AGCCATGTTGGGGGGCCCAGAGG - Exonic
1099064712 12:77960067-77960089 GGCCATGGTGTGAGGTCCTGGGG + Intronic
1101998004 12:109538881-109538903 GGGCACAGTGAGGTGCCCTGAGG - Intergenic
1102043821 12:109817348-109817370 TGCCATGGTGAGGGGTGCAGTGG - Intronic
1102162596 12:110781750-110781772 AGGCATGGTGACGGGACCTGCGG + Intergenic
1102425309 12:112839413-112839435 GGGCTTGGTGAGTGGCTCTGTGG + Intronic
1103329618 12:120145010-120145032 GGCCATGGTGAAGGGCATGGGGG - Exonic
1103705968 12:122872599-122872621 GCCCATGGAGAGCCGCCCTGTGG - Intronic
1103772058 12:123335049-123335071 GGGCATGGTGGTGGGACCTGTGG + Intronic
1104810961 12:131620210-131620232 GATCATGGTGAGGTGCCGTGGGG + Intergenic
1104826086 12:131710698-131710720 GGACATGGTGAGGGGCGCGGAGG + Intergenic
1104980913 12:132572774-132572796 TGCCAGGATGGGGGGCCCTGCGG + Intronic
1105016026 12:132787400-132787422 GGCCTTGGGGAGGGTTCCTGGGG - Intronic
1105313493 13:19235322-19235344 GGCCATGGAGATGTGCACTGAGG - Intergenic
1106026429 13:25960076-25960098 GGCTATGGGAAGGGGCCCAGAGG + Intronic
1106201047 13:27537640-27537662 TGCCATTGTGATGGGCTCTGGGG - Intergenic
1109715428 13:66215714-66215736 AGCCATGAAGAGGGTCCCTGTGG - Intergenic
1113556477 13:111239645-111239667 GTTAATGATGAGGGGCCCTGAGG + Intronic
1113669497 13:112166000-112166022 GGTGGTGGTGAGGGGCCCCGAGG + Intergenic
1113764809 13:112874616-112874638 CGCCCAGGTCAGGGGCCCTGAGG - Intronic
1114566851 14:23639350-23639372 GGCCAAGGTGAGGGGGCAGGCGG + Exonic
1114644861 14:24249694-24249716 GGCTATGCAGAGGCGCCCTGGGG - Intronic
1114672764 14:24420622-24420644 GCCCATGGTGCAGGGGCCTGGGG + Intergenic
1115306618 14:31940192-31940214 GGACATGGAGCAGGGCCCTGTGG + Intergenic
1115471338 14:33771669-33771691 GGGCATGGTGGCGGGGCCTGTGG + Intronic
1117313043 14:54547626-54547648 GGACATGGTGGAGGGGCCTGTGG - Intergenic
1119378580 14:74214436-74214458 GGCCCAGCTGAGAGGCCCTGGGG + Intergenic
1119747709 14:77056167-77056189 GGCCATGCAGAGGAGCGCTGAGG - Intergenic
1119793672 14:77376873-77376895 CGCCGTGGTGCGGGGCCCTGAGG + Intronic
1119824388 14:77645042-77645064 GGGCATGGTGATGTGCACTGCGG + Intergenic
1122088342 14:99322250-99322272 GGCTTTGGTGAGGGGCATTGGGG - Intergenic
1122208286 14:100159323-100159345 GGCCAGGGTGGGGGACCCTCGGG + Intronic
1122488236 14:102095815-102095837 GGAAATGGTGTGGGGCCCTGAGG - Intronic
1122771659 14:104100411-104100433 TGTCCTGCTGAGGGGCCCTGGGG - Intronic
1122821660 14:104349533-104349555 AGCCATGCAGAGAGGCCCTGGGG - Intergenic
1122985272 14:105208917-105208939 GGCCAGGGTGGGCGGGCCTGGGG - Intergenic
1123122954 14:105926584-105926606 GGCCATCCTGTGGGGCCCCGAGG + Intronic
1124578478 15:30930280-30930302 GGCCATGCTGGGGAGCGCTGAGG - Intronic
1124648433 15:31456980-31457002 GGCCGAGGTCAGAGGCCCTGTGG + Intergenic
1125404114 15:39335223-39335245 GGGAGTGGTGAGGGGCCATGAGG - Intergenic
1125522494 15:40356130-40356152 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1125522526 15:40356196-40356218 GGCCATGGCCCAGGGCCCTGCGG + Exonic
1127392067 15:58513815-58513837 GTGCATGGTGAGGAGTCCTGGGG - Intronic
1127867265 15:63042804-63042826 GGCGGCGGCGAGGGGCCCTGGGG - Exonic
1128794583 15:70456000-70456022 GGACATGGTGGTGGGCCCTGTGG - Intergenic
1128954021 15:71920366-71920388 GGCGAAGGGGAGGGGCCCTTGGG + Intronic
1129198569 15:73985302-73985324 GGGCCAGGTGAGGAGCCCTGGGG - Exonic
1129206532 15:74040467-74040489 GGCCAAGGTGTGGGGCCTGGGGG + Intronic
1129246543 15:74282409-74282431 GGCCATTGTGAGGGGGCATGTGG - Intronic
1129320272 15:74770881-74770903 GCCCACGGTAGGGGGCCCTGTGG + Intergenic
1129847100 15:78772998-78773020 GGCCAAGGACAGGGGCCCAGGGG + Intronic
1129959968 15:79675309-79675331 GGCCATGCAGAGGAGCACTGGGG + Intergenic
1130254802 15:82320892-82320914 GGCCAAGGACAGGGGCCCGGGGG - Intergenic
1130600171 15:85269114-85269136 GGCCAAGGACAGGGGCCCGGGGG + Intergenic
1131341702 15:91608607-91608629 GACCATGGTGGGGGGCCTTAGGG - Intergenic
1132452527 15:101976153-101976175 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1132465886 16:77345-77367 GGCCTAGGGGACGGGCCCTGAGG - Intronic
1132659561 16:1055314-1055336 GGCCCTGATGCGGGGTCCTGGGG + Intergenic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1133231822 16:4370620-4370642 AGCCCTGGAAAGGGGCCCTGTGG + Intronic
1133300245 16:4778036-4778058 GGGGCTGGCGAGGGGCCCTGGGG - Intronic
1133308956 16:4830434-4830456 GGCCATGGTCAGGGAGTCTGGGG - Intronic
1133347932 16:5082797-5082819 GGCCATGAGGAGGAGCCCTGCGG + Intronic
1133526609 16:6611812-6611834 GGCCTTGGAGGAGGGCCCTGAGG - Intronic
1133602365 16:7351928-7351950 GTCCCTGGTGAGGGTCACTGTGG - Intronic
1134330662 16:13248306-13248328 AGCCATGGTGCCGGGCCTTGAGG + Intergenic
1135112293 16:19699642-19699664 GACCATGGTGAGGCGCTCGGAGG + Exonic
1136228112 16:28872395-28872417 GGCCAAGGTGAGCCACCCTGTGG + Exonic
1136233807 16:28902845-28902867 GGCCATGGTCATGGGCTCGGGGG - Exonic
1136544958 16:30949511-30949533 CGCCATGGTGAGGGGCCGGGAGG + Exonic
1137928708 16:52566079-52566101 GGCCATGGAGAGAGGCCATGGGG + Intergenic
1139280113 16:65763504-65763526 GGAGCTGGTGAGGAGCCCTGTGG + Intergenic
1139649349 16:68354673-68354695 GGCCATGAGCAGGGGCCCAGAGG - Intronic
1140475638 16:75238166-75238188 GGTGCTGGTGAGGGGTCCTGTGG - Intronic
1140831501 16:78755668-78755690 GGCCCTGGTGCAGGGTCCTGAGG - Intronic
1141614483 16:85202682-85202704 GCCCCTTGGGAGGGGCCCTGGGG + Intergenic
1142174701 16:88639729-88639751 GTACACGGAGAGGGGCCCTGAGG + Intronic
1142314983 16:89338083-89338105 GGCCATAGTGGGGGCCCCTGGGG - Intronic
1142403480 16:89873368-89873390 GGGCATGGAGAGGTGCCCCGCGG - Intergenic
1142466616 17:140737-140759 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466703 17:140954-140976 GGCCTTGGTGAGGGGACATGGGG + Intergenic
1142466719 17:140992-141014 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466735 17:141030-141052 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466751 17:141068-141090 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466813 17:141223-141245 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466839 17:141285-141307 GGCCTTGGTGAGGGGACATGGGG + Intergenic
1142466855 17:141323-141345 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466871 17:141361-141383 GGACCTGGTGAGGGGACATGGGG + Intergenic
1142466922 17:141493-141515 GGACATGGTGAGGGGACATGGGG + Intergenic
1142760411 17:2038838-2038860 GGCCGTGGTGAGGCCACCTGGGG - Intronic
1142832554 17:2559884-2559906 GGCCATGGTGGGAGGATCTGGGG + Intergenic
1142979745 17:3664663-3664685 GGACAAGGTGAGGGGGTCTGGGG - Exonic
1143350613 17:6285521-6285543 GGCCATGCTGAGAGGCCCTGGGG - Intergenic
1143378078 17:6478963-6478985 GGCCATGGGTGTGGGCCCTGGGG + Intronic
1143423279 17:6812815-6812837 GGCCAAGGTGAGGTCCCTTGAGG - Exonic
1143620170 17:8076040-8076062 GGCCTTGGGGAAGGGGCCTGGGG - Intronic
1143882879 17:10043219-10043241 AGTCTTGGAGAGGGGCCCTGGGG - Intronic
1144422781 17:15113183-15113205 GGCCACAGTGAGGGCCCCAGGGG + Intergenic
1144441507 17:15286827-15286849 GGCCAGGGAGAGAGGCCCAGAGG - Intergenic
1144633417 17:16887874-16887896 GCCCATGGTGGGTGGCCCTGAGG + Intergenic
1144757319 17:17687484-17687506 GCCCATGGTCAGGGGGCTTGAGG + Intronic
1144850434 17:18241382-18241404 CACGAGGGTGAGGGGCCCTGGGG + Intronic
1145014581 17:19387862-19387884 GGCCAGAGTGAGGGGGGCTGGGG - Intergenic
1145190599 17:20840764-20840786 AGCCATGGAGCGCGGCCCTGGGG + Intronic
1145247569 17:21279742-21279764 AGCCATGGTGAGAGGGGCTGGGG + Intergenic
1147156431 17:38546577-38546599 GCCCATCCTGAGGGGCCCAGTGG - Intronic
1147717856 17:42520188-42520210 GGCCAAGGAGAGCTGCCCTGAGG - Intronic
1147981187 17:44275203-44275225 GAGCATGATGAGGGGCCCGGCGG - Intergenic
1148390079 17:47265645-47265667 GGTCATGGTCATGGGCACTGGGG + Intronic
1148936634 17:51168337-51168359 GGCCATGGTGAGTGCTCGTGGGG + Exonic
1151084536 17:71365256-71365278 GGCCATGTAAAGGGGCCATGTGG - Intergenic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1151930878 17:77230597-77230619 GGCCATGGATGGGGGCCTTGGGG + Intergenic
1151988434 17:77558580-77558602 GGCCATGGTGGGCCGTCCTGAGG - Intergenic
1152740792 17:82017497-82017519 GACCATGGTGTGGGCCCCTGAGG + Intergenic
1152762249 17:82114936-82114958 TGCCATGGAGGGCGGCCCTGGGG + Intronic
1152813367 17:82392716-82392738 AGCAATGCTCAGGGGCCCTGTGG + Intronic
1153822446 18:8843962-8843984 GGCCTTGGTGGGGGTACCTGGGG - Intergenic
1155474814 18:26226989-26227011 GGCCATGGTCACGGTCCCCGAGG - Exonic
1156461975 18:37326326-37326348 GGCCATGGCCAGGGTCCCAGGGG - Intronic
1158350883 18:56563536-56563558 TGCCATGGGAAGGGGGCCTGCGG + Intergenic
1159877962 18:73831929-73831951 GGCCAAGGTGATGGGCACAGAGG - Intergenic
1160726466 19:619871-619893 GGCCAAGGTGAGGGCACCTGGGG + Intronic
1160906766 19:1455341-1455363 GGCCACGGTGAGGGGCGCCCGGG - Intronic
1160974666 19:1786979-1787001 GGCCATGGGGTGGGGCTCAGGGG - Intronic
1160996716 19:1885374-1885396 AGCCATGGAGCGCGGCCCTGGGG - Exonic
1161028286 19:2046588-2046610 CGCCCTGGTGAGGGGCCCGAGGG - Exonic
1161374768 19:3933710-3933732 GGACCTGGTGGGCGGCCCTGCGG + Intronic
1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG + Exonic
1163664722 19:18597960-18597982 GGCCTTGGTGAGGGGCCTAAAGG + Intronic
1163810609 19:19429237-19429259 GTCCATGGTGAGGGGCTGGGGGG + Intronic
1165443526 19:35844285-35844307 GGTCATGGGGAGGGGTCCCGGGG - Intronic
1166659233 19:44635092-44635114 AGCCATGGAGAGGGGCACTATGG - Intronic
1167266952 19:48487970-48487992 GACCATGGTGTGGGGGCCTGAGG - Intronic
1168094744 19:54108102-54108124 GCCCCCGGTGAGGGGCCCAGTGG - Exonic
1168098358 19:54128194-54128216 GCCGCAGGTGAGGGGCCCTGGGG + Exonic
1168232615 19:55042826-55042848 TGCCATGGTGAGCGGCCCTGTGG - Intronic
1168645439 19:58056332-58056354 GGCCAGGGTGAGAGGCAGTGTGG - Intergenic
1168720177 19:58550533-58550555 GGCCCTGGTGATGGCCCCTGAGG + Exonic
925348758 2:3187560-3187582 GGCCATGGGGAGGGGCACGCTGG - Intergenic
926580842 2:14632305-14632327 GGCCATACTGGGGTGCCCTGGGG + Intergenic
927238716 2:20901418-20901440 GGACATGGTGAGGGGCATGGTGG - Intergenic
927412067 2:22837935-22837957 GGGCATGGGGAGGGAGCCTGGGG + Intergenic
927554013 2:24020079-24020101 TGTCCTGGTGAGGGGGCCTGGGG + Intronic
927554482 2:24022510-24022532 TGTCCTGGTGAGGGGGCCTGGGG + Exonic
927854392 2:26518821-26518843 GGCCATGGCTGGAGGCCCTGTGG - Intronic
928186567 2:29115724-29115746 GGCCGGGGTGGGCGGCCCTGGGG + Intronic
928876063 2:36041532-36041554 GGCCATGGAGAGGGGACCTTGGG - Intergenic
930090613 2:47528787-47528809 GGCCCTGGTGATGGGGCCTTCGG + Intronic
930199149 2:48535945-48535967 GGGCATGGTGGTGTGCCCTGTGG + Intronic
930200405 2:48547479-48547501 GGCCAGGATGAGAAGCCCTGAGG + Intronic
930541377 2:52711268-52711290 GGCCAGTGTGAGGGGCCCTGAGG - Intergenic
930872666 2:56184340-56184362 GTCCATGGTGAGGGGCACTGGGG - Exonic
931603349 2:64026627-64026649 AGCCACAGTCAGGGGCCCTGCGG - Intergenic
932108380 2:68970137-68970159 AGCCATGGTGTGGTGGCCTGGGG + Intergenic
932284000 2:70517709-70517731 GGCCATGGTGAGAAGGACTGTGG - Intronic
932589888 2:73059011-73059033 GACCTTGGGGAGGGACCCTGTGG - Intronic
933798938 2:85944398-85944420 GGCTATGGAGAGGGAACCTGAGG + Intergenic
933990690 2:87632162-87632184 GGCCACTGTCAGGGACCCTGGGG + Intergenic
934647841 2:96069436-96069458 TGCCATGGTGTGGGGACTTGTGG - Intergenic
934781264 2:96971209-96971231 GGCAATGGGGAGGGGCACAGTGG - Intronic
934841213 2:97625257-97625279 TGCCATGGTGTGGGGACTTGTGG - Intergenic
934898807 2:98140951-98140973 GCCATTGGTGAGGGGGCCTGGGG - Intronic
935147509 2:100405892-100405914 GAGCATGGTGAGGTGCTCTGTGG - Intronic
936303154 2:111318661-111318683 GGCCACTGTCAGGGACCCTGGGG - Intergenic
936568739 2:113598627-113598649 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
938135253 2:128751303-128751325 GGCTGAGGTGAGGGCCCCTGGGG - Intergenic
938338664 2:130520990-130521012 GGAGATGGTGAGGGGCCCTGTGG - Intergenic
938351176 2:130599760-130599782 GGAGATGGTGAGGGGCCCTGTGG + Intergenic
938369551 2:130760717-130760739 GGACATGGTGAGGGGAACAGAGG + Intronic
940057528 2:149528643-149528665 GCCCATGGGGAAGGGCCCAGCGG - Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
945705962 2:213232092-213232114 GGACATGGTGATGGGCCCTCAGG - Intergenic
946252787 2:218423762-218423784 GGTCATGGTGAGTGAGCCTGGGG - Exonic
948571011 2:238917070-238917092 GGCCCTGGTGGGGAGGCCTGGGG - Intergenic
948619240 2:239223629-239223651 GGCCTTGGTAAGGGGACCTGTGG + Intronic
948815341 2:240507515-240507537 GGCCCTGGTGAGGGGGTTTGAGG - Intronic
1168859621 20:1036743-1036765 GGCCATGGTGATGGGCCGGCTGG - Intergenic
1168927860 20:1597942-1597964 GGCCATGGGATGGGGCTCTGGGG - Intronic
1168939112 20:1694297-1694319 GGCCATGGGATGGGGCTCTGGGG - Intergenic
1168957781 20:1846586-1846608 GGCCACAGTGAGGTGCCATGGGG + Intergenic
1169189478 20:3648831-3648853 GGCCTTGCTGGGGGGGCCTGTGG - Exonic
1169773230 20:9224187-9224209 GGCAATGGAGAGGGTCCCTGAGG - Intronic
1170463002 20:16596769-16596791 GGCCCTGGTGATGGCCCCTGAGG + Intergenic
1170572621 20:17641058-17641080 GGGCAGGGTGAGGGGCCCCCTGG - Intronic
1170582728 20:17711256-17711278 GGCCCTGGAGGGGGGCCCCGGGG - Intronic
1170808441 20:19654495-19654517 GGCCACGGTAATGGGCTCTGTGG - Intronic
1171026962 20:21639553-21639575 TGCCATGGGAAGAGGCCCTGGGG + Intergenic
1173318900 20:41969984-41970006 GCCCATGGAGAGGGGCCCCAGGG + Intergenic
1173407114 20:42776034-42776056 CTGCCTGGTGAGGGGCCCTGTGG - Intronic
1173803821 20:45911447-45911469 GGCCATGGCGAGCGGGCCTGGGG + Exonic
1174516222 20:51094402-51094424 GGCCTTGGTCCTGGGCCCTGCGG + Intergenic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175160156 20:57002442-57002464 AGGAATGGTCAGGGGCCCTGCGG - Intergenic
1175296261 20:57910742-57910764 GGCCATGGTGAGATGGCCTAGGG + Intergenic
1175375185 20:58519298-58519320 GGCCATGGTGAGTGGCTAAGTGG - Intergenic
1175417415 20:58811008-58811030 GGCCCTGGGGAGAGGACCTGGGG - Intergenic
1175541895 20:59753200-59753222 GGCCATTGTGACGGGCTCTGTGG - Intronic
1175824688 20:61930554-61930576 GGACGTGGTGGGGGACCCTGTGG - Intronic
1176048489 20:63104616-63104638 GCACATGGTGAGGGCTCCTGGGG - Intergenic
1178125581 21:29512282-29512304 GGCCCTCGTGGGGGGCTCTGGGG + Intronic
1178774816 21:35539844-35539866 GGTCATGGGGAAGGGCCCAGAGG - Intronic
1179247766 21:39648617-39648639 GGTCATGGGGAGTGGCCATGGGG - Intronic
1179447248 21:41440969-41440991 GGCCATGCTGAGAGCCTCTGTGG - Exonic
1179504334 21:41830934-41830956 GGGCAGGGCGAGGGGACCTGGGG - Intronic
1180169237 21:46049293-46049315 GGGCTTAGTGAGAGGCCCTGGGG - Intergenic
1181121684 22:20671226-20671248 AGCCATGGAGCGCGGCCCTGGGG - Intergenic
1181334652 22:22118266-22118288 AGCCATGGAGCGCGGCCCTGGGG - Intergenic
1181697494 22:24601289-24601311 GGCCATGGTGAGGGCCATGGCGG - Intronic
1181773807 22:25145405-25145427 GGCCATGCTGTGTGGCCTTGGGG - Intronic
1182142381 22:27972231-27972253 GGCCATGGAGAGGGGCCCAGAGG + Intergenic
1183979274 22:41530251-41530273 GGGCATGGTGGCGTGCCCTGTGG - Intronic
1184331784 22:43832358-43832380 AGCCATGGTGAGGACCCATGTGG + Intronic
1184360343 22:44013480-44013502 CGGCGTGGTGAGGGGCACTGAGG - Intronic
1184793590 22:46717674-46717696 GGGCACGGTGGGGGACCCTGGGG + Intronic
1185014849 22:48336802-48336824 AGCCATGCGGAGAGGCCCTGGGG - Intergenic
1185150618 22:49161724-49161746 GCCCATTGTGCTGGGCCCTGCGG + Intergenic
1185259866 22:49855605-49855627 ATCCTTGGTGAGGAGCCCTGGGG + Intronic
1185282027 22:49976203-49976225 GGCCATGGTGGGAGGCCGTGGGG + Intergenic
1185409608 22:50674832-50674854 GGCGATGGGGAGGGTCCCGGCGG - Intergenic
949441178 3:4082327-4082349 GGGCATGGTGATGCACCCTGTGG + Intronic
950098952 3:10345755-10345777 GGCCAGGGTGAGGCTTCCTGAGG - Intronic
950168823 3:10822247-10822269 GGCCATGGTGCGGGGTGCAGGGG + Intronic
950429521 3:12942896-12942918 GGCCAAGGAGAGGGGCCATGGGG + Intronic
950569657 3:13792165-13792187 GGAAATGGTGAGGCGCCCTGGGG - Intergenic
950641939 3:14354061-14354083 TGCCCTGGAGAGGGGCCCTCTGG + Intergenic
951405783 3:22295845-22295867 TGCCATTGGGAGGGGCCGTGAGG - Intronic
953179977 3:40585947-40585969 GACCATGCTGAGGGGCCCAAGGG - Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
954215852 3:49124174-49124196 TGCCATGGTGAGGGAGCCAGCGG - Exonic
954578379 3:51689534-51689556 GGCTGTGCTGAGGTGCCCTGTGG + Intronic
954848792 3:53582798-53582820 GGACTTGGTGAGGGGATCTGTGG + Intronic
957052303 3:75420063-75420085 GGCCATGAGGAGGAGCCCTGCGG + Intergenic
958413261 3:93844614-93844636 GGGCGTGGTGGCGGGCCCTGTGG - Intergenic
960052198 3:113249671-113249693 GGCCATGATGAGGATGCCTGGGG - Intronic
961167532 3:124773891-124773913 GGCCATGGCGAGTGTCACTGCGG - Exonic
961302549 3:125931492-125931514 GGCCACGAGGAGGAGCCCTGCGG - Intronic
961326491 3:126112301-126112323 GGCCAGGCTGTGGGCCCCTGTGG - Intronic
961327978 3:126121558-126121580 GGCCAGCTTGAGGAGCCCTGCGG + Intronic
961479482 3:127170874-127170896 GGCTTGGGTGAGGGGCACTGAGG + Intergenic
961631460 3:128301923-128301945 GGCCATGCAGAAGGGACCTGGGG + Intronic
961822199 3:129580831-129580853 GGCAATTGTGGGGGTCCCTGGGG - Intronic
961827622 3:129606972-129606994 GGCTACGGGGAGGGACCCTGGGG - Intergenic
961885922 3:130096288-130096310 GGCCACGAGGAGGAGCCCTGCGG + Intronic
962746245 3:138399098-138399120 GGCCCTGGTAAGGGGTGCTGAGG - Intronic
965760814 3:172074203-172074225 GGCCATTGTGAGTGCCACTGAGG + Intronic
966786972 3:183630966-183630988 GGCATTGGTGGAGGGCCCTGGGG - Intergenic
966930198 3:184671175-184671197 GGGCATGGTGTGGGGAGCTGAGG + Intronic
968225661 3:196970415-196970437 GGGCATGGTGGCGGGGCCTGTGG - Intergenic
968488558 4:877074-877096 GGCCAAGGTGAGAGAGCCTGTGG - Exonic
968545769 4:1197068-1197090 GGACATGATGAGGGGACTTGAGG + Intronic
968626806 4:1629493-1629515 GGCCATGGCCAGTGGCCCTCAGG - Intronic
968741681 4:2334548-2334570 GGCCATGCTGAGGAGCCCCAGGG - Intronic
968902384 4:3437791-3437813 GGCCAGGATGAGGGCCTCTGGGG + Intronic
968956567 4:3722542-3722564 GCCCATGGTGAGGGGCCCGTGGG + Intergenic
968995108 4:3940435-3940457 GGCCATGAGGAGGAGCCCTGTGG + Intergenic
969134218 4:5016974-5016996 GGCAATGGGGAGGGGGCTTGTGG + Intronic
969422914 4:7107680-7107702 TGCCATGGAGAGGGCACCTGTGG + Intergenic
969465895 4:7356161-7356183 GTCCTGGGTGAGTGGCCCTGAGG - Intronic
969606617 4:8205233-8205255 CCCCATGGGGAGGGGTCCTGTGG + Exonic
969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG + Intronic
970123586 4:12784363-12784385 GGCCATGAGGGGGGCCCCTGGGG + Intergenic
974997674 4:69181794-69181816 GATCATAGTGAGGGGCCATGAGG + Intronic
975007353 4:69307017-69307039 GATCATAGTGAGGGGCCATGAGG - Intronic
975010648 4:69346744-69346766 GATCATAGTGAGGGGCCATGAGG + Intronic
975629290 4:76383357-76383379 GGGCATGGTGAGGGGGTCTGTGG - Intronic
978148749 4:105409415-105409437 GGCCTTGCAGAGGGGCACTGAGG - Intronic
978559891 4:110021999-110022021 GGCCCTGGGGTGGGGCACTGAGG - Intergenic
981637473 4:146897493-146897515 GACCAAGGAGAGAGGCCCTGTGG - Intronic
983532146 4:168822007-168822029 GGCCATGGTGGGCTGGCCTGAGG + Intronic
983557535 4:169071743-169071765 GGCCATGAAGAAGGGCCATGGGG - Intergenic
984275662 4:177607046-177607068 GGCCCTGGTGCGGGACCCAGTGG - Intergenic
986313712 5:6572548-6572570 GGCCCTGGGGAGGGGCGCCGAGG - Intergenic
987049102 5:14134808-14134830 GACCCTGGGGAGGGTCCCTGAGG - Intergenic
988032243 5:25777917-25777939 GGGCATGGTGACGGGCGCTGTGG + Intergenic
988645415 5:33090124-33090146 GGCCCTGGTGATGGCCCCTGAGG - Intergenic
989454396 5:41625802-41625824 AGCCATTGTGTGAGGCCCTGGGG + Intergenic
997640687 5:135446922-135446944 GGCCCTGGAGAGGGGCACTCAGG + Exonic
998253393 5:140567398-140567420 CGCCAGGGTGGGGGCCCCTGGGG - Exonic
998393440 5:141802932-141802954 GGCCTTGCTGAGGGGCCCAAGGG - Intergenic
998524999 5:142834607-142834629 CTACATGGGGAGGGGCCCTGTGG - Intronic
1000125769 5:158242381-158242403 TGGCATCGTGATGGGCCCTGGGG + Intergenic
1000154033 5:158533260-158533282 GTCCAGGGTGATGGGACCTGAGG - Intergenic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1001913479 5:175540504-175540526 GGCCGTGGGGAGGAGCACTGAGG - Intergenic
1002095978 5:176831331-176831353 GGACAGGGAGAGGGGCCCTGGGG - Intronic
1002650105 5:180684922-180684944 GGCCATGAGCAGGGGCCCTGAGG + Intergenic
1003633600 6:7811027-7811049 GGCCATGGTGGGGGCCCTGGGGG - Intronic
1004541384 6:16553708-16553730 GGCCATGGTGAGGGCCCATGCGG - Intronic
1006091969 6:31633578-31633600 GGCCTAGGAGAGGGGCCCTGAGG - Exonic
1006429407 6:33985768-33985790 GGCCCTGGTGTGAGGGCCTGGGG + Intergenic
1008920987 6:56843864-56843886 GGGCCTGGGGAGGGGGCCTGGGG - Intronic
1010534854 6:77013831-77013853 GGCCTTGGTGAGAGGTCCAGGGG + Intergenic
1010540013 6:77081606-77081628 GGCAATGGTGAGGGACAATGAGG + Intergenic
1011857328 6:91710538-91710560 TGGCATGGGGAGGGGCCATGTGG - Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1018085789 6:160300270-160300292 GGGCATGGTGCTGGGCCCCGGGG + Intergenic
1018089010 6:160329497-160329519 CGCCATGGTGGGGAGGCCTGTGG + Intergenic
1018633575 6:165841344-165841366 GCCCATGGAGATCGGCCCTGTGG + Intronic
1018902094 6:168056791-168056813 AGCCATGGTGTTGGCCCCTGAGG - Exonic
1019124725 6:169830651-169830673 GGTGATGGTGAGTGGCCCTCTGG - Intergenic
1019130237 6:169867975-169867997 GGCCATGCTGAGGGGCCTTTAGG + Intergenic
1019136029 6:169908124-169908146 GGCCATCGCCAGGGGCCCTGGGG + Intergenic
1019284703 7:217654-217676 GGCCAGGCAGAGGTGCCCTGAGG + Intronic
1019492756 7:1322775-1322797 GGCCGTGGGCAGGGGCGCTGGGG + Intergenic
1019509613 7:1411242-1411264 GGCTGTGGGGAGGGGCGCTGGGG - Intergenic
1019716423 7:2541462-2541484 GGCCACGGTGAAGGGCGCTGGGG + Exonic
1019754273 7:2757273-2757295 GGGCATGGTGGCGGGCGCTGCGG - Intronic
1020218282 7:6212842-6212864 GCCCATTGTGAAGGGCACTGGGG + Intronic
1020319371 7:6928758-6928780 GGCCACGAGGAGGAGCCCTGCGG + Intergenic
1020792236 7:12641361-12641383 GGCCATGGTGAGTGGGTCTTGGG - Intronic
1021514955 7:21474119-21474141 GGACATGGTCAGGGGACCAGAGG + Intronic
1022443294 7:30451107-30451129 GGCCATGGTCATGAGTCCTGGGG + Intronic
1022924278 7:35044340-35044362 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924293 7:35044400-35044422 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924306 7:35044440-35044462 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924315 7:35044480-35044502 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924334 7:35044560-35044582 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924347 7:35044600-35044622 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924382 7:35044740-35044762 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924389 7:35044760-35044782 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924402 7:35044800-35044822 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924409 7:35044820-35044842 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924416 7:35044840-35044862 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924427 7:35044880-35044902 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924440 7:35044920-35044942 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924471 7:35045060-35045082 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924488 7:35045120-35045142 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924499 7:35045160-35045182 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1022924504 7:35045180-35045202 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924511 7:35045200-35045222 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924522 7:35045240-35045262 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924550 7:35045360-35045382 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924557 7:35045380-35045402 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924564 7:35045400-35045422 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924571 7:35045420-35045442 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924578 7:35045440-35045462 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924585 7:35045460-35045482 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924592 7:35045480-35045502 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924599 7:35045500-35045522 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924606 7:35045520-35045542 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924613 7:35045540-35045562 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924620 7:35045560-35045582 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924627 7:35045580-35045602 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924634 7:35045600-35045622 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924655 7:35045680-35045702 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924662 7:35045700-35045722 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924679 7:35045760-35045782 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1022924690 7:35045800-35045822 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1022924777 7:35046160-35046182 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1022924784 7:35046180-35046202 GGGAATGGTGAGGGGCACTGGGG - Intergenic
1023839875 7:44090684-44090706 GGCAATGGTGAAGGGTCCAGGGG + Intergenic
1023879184 7:44308871-44308893 GGCCATGGACAGAGGCCCCGGGG - Intronic
1024022866 7:45387340-45387362 TCCCATGGTCAGGGGCTCTGGGG - Intergenic
1024157240 7:46638193-46638215 GGCCCTGGAGAGGGGCTATGAGG - Intergenic
1024238567 7:47416040-47416062 GGCCATGGTGAGGGACCTCAGGG - Intronic
1024927999 7:54638173-54638195 GGCAATGGTGAGAGGGCATGAGG + Intergenic
1026739010 7:72966848-72966870 GGCCATAGTGGGAGGCCCAGTGG - Intronic
1027104723 7:75398225-75398247 GGCCATAGTGGGAGGCCCAGTGG + Intronic
1029822585 7:103160106-103160128 GGAAATGGTGAAGGGCACTGGGG - Intergenic
1029822595 7:103160146-103160168 GGGAATGGTGAAGGGCACTGGGG - Intergenic
1029822601 7:103160166-103160188 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1029822624 7:103160246-103160268 GGAAATGGTGAAGGGCACTGGGG - Intergenic
1029822660 7:103160386-103160408 GGAAATGGTGAGGGACACTGGGG - Intergenic
1029822670 7:103160426-103160448 GGGAATGGTGAAGGGCACTGGGG - Intergenic
1029822676 7:103160446-103160468 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1029822681 7:103160466-103160488 GGAAATGGTGAAGGGCACTGGGG - Intergenic
1029822699 7:103160526-103160548 GGAAATGGTGAGGGACACTGGGG - Intergenic
1029822724 7:103160626-103160648 GGAAATGGTGAGGGACACTGGGG - Intergenic
1029822735 7:103160666-103160688 GGAAATGGTGAAGGGCACTGGGG - Intergenic
1029822746 7:103160706-103160728 GGAAATGGTGAGGGACACTGGGG - Intergenic
1029822756 7:103160746-103160768 GGGAATGGTGAAGGGCACTGGGG - Intergenic
1029822762 7:103160766-103160788 GGAAATGGTGAGAGGCACTGGGG - Intergenic
1029822791 7:103160886-103160908 GGGAATGGTGAAGGGCACTGGGG - Intergenic
1029822797 7:103160906-103160928 GGAAATGGTGAGGGGCACTGGGG - Intergenic
1030886918 7:114949952-114949974 GGCCATTTTGAGGGGAGCTGGGG + Intronic
1032899763 7:136294012-136294034 GTTCATGATGAGGGTCCCTGGGG - Intergenic
1033208053 7:139439364-139439386 GGTCATGGGGAAGGGCCTTGAGG + Intergenic
1033252114 7:139769267-139769289 GGCCATGCTGGGAGGCCTTGTGG - Intronic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1034937496 7:155209495-155209517 GGCCAGGATGGGGGGTCCTGGGG - Intergenic
1035323901 7:158052631-158052653 GGCCATGGAGGGGTGCCCTTCGG + Intronic
1036606444 8:10309663-10309685 GGCCAGGATGTGTGGCCCTGGGG - Intronic
1036652646 8:10655051-10655073 GGCCAAGGAGAGTGGCCCCGAGG - Exonic
1036683631 8:10893937-10893959 GGCCATGATGAGGGGTGCTAGGG - Intergenic
1036847628 8:12180604-12180626 GGCCACGAGGAGGAGCCCTGCGG + Intergenic
1036868996 8:12422919-12422941 GGCCATGAGGAGGAGCCCTGCGG + Intergenic
1037144300 8:15554740-15554762 GGGCGTGGTGAGGGCGCCTGTGG - Intronic
1037804781 8:22053244-22053266 GGAGATGGTGAGGGGCTTTGCGG + Intronic
1037993708 8:23338427-23338449 GCCCAAGGTGGGGGGCCCTCGGG + Intronic
1038192672 8:25338179-25338201 GGGCATGGTGACGTGCCCTTTGG - Intronic
1038984705 8:32795814-32795836 GGCCTTACTGAGAGGCCCTGAGG + Intergenic
1040387707 8:46924552-46924574 GGCCAGGCTGGGGGGCCATGGGG + Intergenic
1041770477 8:61467469-61467491 GGCCATGGTGATGGGTTCAGAGG - Intronic
1042167544 8:65960182-65960204 GGCCATGCAGAGAGGCCCTGGGG + Intergenic
1042249536 8:66741942-66741964 GCCCTTGCTAAGGGGCCCTGGGG - Intronic
1043729258 8:83653566-83653588 GGGCATGGTGATGGCACCTGTGG + Intergenic
1043846744 8:85172209-85172231 GGACATGGTGAGAGGCTTTGAGG + Intergenic
1044071198 8:87762440-87762462 GGTGATGGTGAGGAGCCCAGTGG + Intergenic
1045838498 8:106551919-106551941 GGCCATGGTGGTGCGCACTGTGG + Intronic
1046395498 8:113633735-113633757 GGCCATGCCTAGGGGCCCTGGGG - Intergenic
1046604687 8:116358040-116358062 GGCCATGGAGAGGGGGCTGGAGG + Intergenic
1046954949 8:120053294-120053316 GGCCATGGGGAAAGGCCATGTGG - Intergenic
1047569992 8:126087213-126087235 GGCTTTGGTGGGGAGCCCTGTGG + Intergenic
1049434604 8:142580552-142580574 TGCCATGGTCAGAGGGCCTGAGG - Intergenic
1049526037 8:143127494-143127516 GGCAACAGTGAGGGGCCCAGCGG + Intergenic
1049820415 8:144629945-144629967 GGACACTGTGGGGGGCCCTGGGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1049844607 8:144793672-144793694 GGGCAGGGTGAGGGGTTCTGGGG + Intergenic
1049883788 9:14898-14920 GGGGCTGGTGAGGGGCCCGGAGG - Intergenic
1049988431 9:972177-972199 GGCCAGGCCGAGGCGCCCTGCGG - Intergenic
1050943417 9:11488271-11488293 GGCCATGGAGTGAGACCCTGGGG + Intergenic
1051235432 9:14993701-14993723 AGACATTGTGCGGGGCCCTGCGG + Intergenic
1052995968 9:34551814-34551836 GGCCAGGGTGAGGGGGTCTTTGG + Exonic
1053556711 9:39145409-39145431 TCCCATGGTGAGGGGCACTTGGG - Intronic
1053575727 9:39356320-39356342 GGCCCTGGTGGGAGGCCCTCAGG - Intronic
1053577641 9:39369069-39369091 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1053820822 9:41965687-41965709 TCCCATGGTGAGGGGCACTTGGG - Intronic
1053840247 9:42184277-42184299 GGCCCTGGTGGGAGGCCCTCGGG - Intronic
1053842146 9:42197021-42197043 GGACATGGTGGGGGCACCTGTGG + Intergenic
1054089690 9:60833826-60833848 TCCCATGGTGAGGGGCACTGGGG - Intergenic
1054097297 9:60915025-60915047 GGCCCTGGTGGGAGGCCCTCAGG - Intergenic
1054099217 9:60927786-60927808 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054111101 9:61109384-61109406 TCCCATGGTGAGGGGCACTGGGG - Intergenic
1054118703 9:61190654-61190676 GGCCCTGGTGGGAGGCCCTCAGG - Intronic
1054120614 9:61203410-61203432 GGACATGGTGGGGGCGCCTGTGG + Intergenic
1054587134 9:66979146-66979168 GGACATGGTGGGGGAGCCTGTGG - Intergenic
1054589054 9:66991910-66991932 GGCCCTGGTGGGAGGCCCTCAGG + Intergenic
1054609756 9:67221741-67221763 TCCCATGGTGAGGGGCACTGGGG + Intergenic
1055422879 9:76162382-76162404 GGCCAAGGTGAGAGGGCATGAGG - Intronic
1057905023 9:98976607-98976629 GGCCCTGGTGAGAGTCACTGAGG - Intronic
1059246837 9:112856272-112856294 GGCCGTGTGGAGGGGACCTGGGG + Intronic
1059652570 9:116328568-116328590 GGCCAGGGTGAGGGGAACTTTGG + Intronic
1060112148 9:120913976-120913998 GACCATGGAGAGGGGCATTGGGG + Intronic
1060410701 9:123398304-123398326 TGCCATCATGAGGGGCCCGGCGG + Intronic
1061609305 9:131735724-131735746 GGGAGTGGTGAGGGGCTCTGTGG + Intronic
1061618263 9:131794143-131794165 GAGCAGGGTGAGGGGCCATGTGG + Intergenic
1061782490 9:133004218-133004240 GGCCGGGCTGAGGGGCGCTGGGG - Intergenic
1061959116 9:133979076-133979098 GCACATGGGGAGGGGCACTGAGG + Intronic
1061962589 9:133995637-133995659 GTCCAAGGAGAGGGGGCCTGGGG - Intergenic
1062018368 9:134303817-134303839 TGCCATGGGGAGGGGGGCTGAGG - Intergenic
1062034490 9:134376853-134376875 GGGCATGGTGAGGGCACCTTGGG + Intronic
1062232518 9:135489875-135489897 AGCCGTGATGAGGGTCCCTGTGG + Intergenic
1062328050 9:136022207-136022229 GGAAATGGTGAGGGGCAATGTGG + Intronic
1062342547 9:136100228-136100250 GGCCCTGACAAGGGGCCCTGTGG - Intergenic
1062368394 9:136223104-136223126 GTCCACTGTGAGGGGCCTTGCGG - Intronic
1062374693 9:136256636-136256658 GGCCTTGCTGTGTGGCCCTGAGG - Intergenic
1062425290 9:136503436-136503458 GGACATGGTGAGGCAGCCTGGGG + Intronic
1062482572 9:136759365-136759387 GACAGGGGTGAGGGGCCCTGGGG - Intergenic
1062482623 9:136759466-136759488 GGCAGGGGTGAGAGGCCCTGGGG - Intergenic
1062509536 9:136897318-136897340 GGGCATGGTGCAGGGCGCTGAGG + Intronic
1062517728 9:136944578-136944600 GGCCGTGGTGAGTGCGCCTGCGG - Exonic
1062616569 9:137399281-137399303 GGACATGGTGTGGTCCCCTGGGG + Intronic
1185680726 X:1886673-1886695 GGCTATGATGAGGGGACATGAGG - Intergenic
1187267266 X:17746911-17746933 AGCAATGGAGAGGGGCCCTTGGG - Intronic
1187431603 X:19229907-19229929 GTCGATGGGGAGGGGCGCTGGGG - Intergenic
1195961686 X:110393752-110393774 GTCCATGGACAGTGGCCCTGGGG - Intronic
1197757399 X:130005397-130005419 GGGCCTGGGGAGGGACCCTGGGG + Intronic
1199713295 X:150487648-150487670 TGGCCAGGTGAGGGGCCCTGGGG - Intronic
1200402023 X:156025261-156025283 GGGGCTGGTGAGGGGCCCGGAGG + Intergenic
1200793978 Y:7323886-7323908 GCCCTTGGTGAAGGGGCCTGAGG + Intergenic