ID: 1133046694

View in Genome Browser
Species Human (GRCh38)
Location 16:3092130-3092152
Sequence GGCTGCCCAGCCTGCTGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133046694_1133046701 -6 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046701 16:3092147-3092169 GCAGCCCTTGGCTGGGGTCGGGG 0: 1
1: 0
2: 2
3: 46
4: 359
1133046694_1133046699 -8 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046699 16:3092145-3092167 GGGCAGCCCTTGGCTGGGGTCGG 0: 1
1: 1
2: 3
3: 54
4: 632
1133046694_1133046700 -7 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046700 16:3092146-3092168 GGCAGCCCTTGGCTGGGGTCGGG 0: 1
1: 0
2: 3
3: 58
4: 504
1133046694_1133046702 -3 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046702 16:3092150-3092172 GCCCTTGGCTGGGGTCGGGGAGG 0: 1
1: 0
2: 1
3: 52
4: 607
1133046694_1133046706 10 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046706 16:3092163-3092185 GTCGGGGAGGCTCATCCGATGGG 0: 1
1: 0
2: 0
3: 2
4: 29
1133046694_1133046705 9 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046705 16:3092162-3092184 GGTCGGGGAGGCTCATCCGATGG 0: 1
1: 0
2: 1
3: 2
4: 64
1133046694_1133046707 24 Left 1133046694 16:3092130-3092152 CCGGCTCAGCAGGCTGGGCAGCC 0: 1
1: 0
2: 4
3: 42
4: 366
Right 1133046707 16:3092177-3092199 TCCGATGGGCCCAGCACTGAAGG 0: 1
1: 0
2: 1
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133046694 Original CRISPR GGCTGCCCAGCCTGCTGAGC CGG (reversed) Exonic
900099063 1:953314-953336 GGCCCCCCAGCCTCCTCAGCAGG + Intronic
900370124 1:2328559-2328581 GGCTCCCCTGCCTGCTGTGCAGG + Intronic
900617199 1:3570817-3570839 GGATGACTAGCCTCCTGAGCAGG - Intronic
900619104 1:3578840-3578862 GTCTCCCCAGCGTTCTGAGCTGG - Intronic
900706239 1:4082116-4082138 GGCTGCCCAGCCTGTTGGGCTGG + Intergenic
900990368 1:6095817-6095839 GGCTGCCCAGCCTGTGGCACAGG + Intronic
901529379 1:9843721-9843743 GCCTGCAGAGCCTGCAGAGCTGG - Intergenic
902861786 1:19251909-19251931 GGCTACCCAGCCTGCGGTGAGGG + Intronic
903281830 1:22254639-22254661 GGCTCCCCAGGCTGGTGGGCTGG - Intergenic
903839033 1:26225324-26225346 GGCTACCCAGCCTGCCCGGCAGG - Intergenic
904188576 1:28725326-28725348 GGAGGCTCAGCCTGCTGAGATGG - Intergenic
904599392 1:31665373-31665395 GTCTGCCTGGCCTGCTGGGCTGG + Intronic
905549201 1:38822678-38822700 GGCTTCCCAGCCTGGTGGGAGGG + Intergenic
905626132 1:39491593-39491615 GGCGGCACAGACGGCTGAGCCGG + Intergenic
905811779 1:40918421-40918443 GGCAGCCCATCTTGCTGAGCAGG + Intergenic
906684120 1:47752055-47752077 AGCTGCCCAGCCTGCTGCTCTGG - Intergenic
907335765 1:53698475-53698497 GGCTGCCCTGCCTAGTCAGCAGG + Intronic
907939864 1:59077201-59077223 AGCTGCTCAGCCTGGTCAGCTGG + Intergenic
909957765 1:81800983-81801005 GGCCGCCCCGCCGGCGGAGCCGG + Intronic
911073172 1:93847855-93847877 GACTGCCCAGTCGGCTGAGCTGG - Intergenic
912436593 1:109666500-109666522 GGCTGCCCAGCCTGTCCACCTGG + Intronic
914784150 1:150813185-150813207 GGCTGGCCAGGTTGCTGTGCTGG + Exonic
915034581 1:152911154-152911176 GGCTGCCCCACCTGCTGCTCTGG - Exonic
915699167 1:157774339-157774361 GACTGCCCAGCCTACATAGCAGG + Intronic
916595038 1:166235356-166235378 GGTTGCCCACCCTGCTGTCCAGG + Intergenic
916667514 1:166979789-166979811 GGCTGCCCCCACTGTTGAGCAGG - Intronic
917969381 1:180197247-180197269 GGCTGCCCTCCCTGCACAGCAGG - Exonic
919182660 1:194104843-194104865 AGCTGGGCAGCCTGCTGGGCTGG - Intergenic
919753652 1:201053507-201053529 GGCTGATCAAGCTGCTGAGCCGG - Exonic
919971191 1:202580384-202580406 GCCAGGCCAGCCTGGTGAGCAGG - Intronic
920850262 1:209623669-209623691 GTCAGCCCAGGCTGCTCAGCAGG - Exonic
922415499 1:225418821-225418843 GGCTGCCCTACCTGCTAGGCGGG - Intronic
922860445 1:228811694-228811716 GGCTTCCCAGCCAACTGAGTGGG - Intergenic
1062973036 10:1662779-1662801 GGGTGCCCAGGGTGCTGGGCAGG + Intronic
1064230086 10:13522007-13522029 GGCAGCCATGCCAGCTGAGCAGG - Intronic
1064470329 10:15629004-15629026 TGCGGCCCAGGCTGCAGAGCTGG + Intronic
1065117152 10:22494118-22494140 GGGAGCCCAGCCTGCTAGGCGGG + Intergenic
1065204327 10:23343424-23343446 GGCTTCCCAGCCTCCAGAACTGG + Intronic
1067319506 10:45204993-45205015 TGTTGCCCAGCCTGCCAAGCTGG - Intergenic
1069890989 10:71652391-71652413 GCCTGCGCAGCCTGCAGTGCTGG + Intronic
1070140022 10:73732142-73732164 AGCTGTCCAGCTTGCTCAGCAGG - Intergenic
1070328654 10:75403326-75403348 GGCTCCCCAGCCTGCGGGGATGG - Intergenic
1071794621 10:88991153-88991175 AGCTGCCCCGCCTGCCCAGCGGG - Exonic
1073476168 10:103755553-103755575 GCATGCCGAGCCTGCTGAGTTGG + Intronic
1073486158 10:103820395-103820417 GGCTGCCCTGGCCGCTGCGCAGG - Intronic
1074203295 10:111258643-111258665 GGCTGGTCTGCCTGCTCAGCTGG + Intergenic
1074225883 10:111483886-111483908 GGCTGCCCCCGCTGCTGTGCAGG + Intergenic
1075469270 10:122675922-122675944 GTCTGACCAGCCTGCTGGGCAGG + Intergenic
1075614699 10:123882818-123882840 GGCTGCCCAGGCTGTGGAGTTGG - Intronic
1075790019 10:125077515-125077537 GGCTGCCAGGCCTGGTGAGGGGG - Intronic
1075811202 10:125226427-125226449 GGCTGCACAGCCTCCTTGGCCGG + Intergenic
1075997951 10:126893387-126893409 GGCTGCCAAGCCTGCAGGGTTGG - Intergenic
1076624412 10:131812751-131812773 GACTTCCCAGGCTGCTTAGCAGG + Intergenic
1076732788 10:132446781-132446803 GGATGCCCACCCTGCTGGGAAGG + Intronic
1076826782 10:132973370-132973392 CCCTGCCCAGCCTGCCCAGCTGG - Intergenic
1077078632 11:712785-712807 AGCTGCCCAGGCTGCTGGGAGGG - Intronic
1077178129 11:1199767-1199789 GAGTACCCAGCCTGCTGGGCGGG + Intronic
1077350408 11:2090578-2090600 GGCTGCATAGCCAGATGAGCAGG - Intergenic
1077906502 11:6538749-6538771 GGCTGCCCAGCTTAGTGAGCAGG - Exonic
1078144956 11:8716233-8716255 TACTGGCCAGCCTGCTGGGCTGG + Intronic
1078611483 11:12823472-12823494 GGCTTCCCAGGCTGCTGTACAGG + Intronic
1078619511 11:12893990-12894012 GGCTGCCCAGCCTGCCCTGGGGG + Intronic
1079158127 11:17967832-17967854 GGCTGACCAGCATTGTGAGCTGG - Intronic
1079340634 11:19608895-19608917 GGCTGCCCACACTGCTTGGCTGG + Intronic
1080637881 11:34139482-34139504 GCCAGCCCAGCCTGGTGAGCCGG + Exonic
1083223507 11:61268921-61268943 TGCTGCCCAGACTGTTCAGCAGG - Exonic
1083503981 11:63138127-63138149 AACTGACCAGCCTGCTGAGCTGG - Intronic
1083583236 11:63838780-63838802 AGCTGCTCCGCGTGCTGAGCCGG - Intergenic
1083756525 11:64794682-64794704 GGCGGAGCAGCCTGGTGAGCTGG - Intronic
1083955281 11:65979399-65979421 GACTGCCCAGCCTGGTGGGCTGG + Exonic
1084656469 11:70522645-70522667 GGCCGGCCAGCCCGCGGAGCTGG - Intronic
1084859811 11:72011009-72011031 TGCTGCCCAGGCTGCTTGGCAGG + Intronic
1085115052 11:73924121-73924143 GGCTGCCTAGAATGCTGAGCTGG - Intronic
1087562065 11:99802915-99802937 GGCTGCCAATCCTGGTGAGCCGG + Intronic
1088007724 11:104962547-104962569 AATTGGCCAGCCTGCTGAGCTGG - Intronic
1090743978 11:129692234-129692256 GCCTGCCCCGCCTCCTCAGCAGG + Intergenic
1091784098 12:3231835-3231857 GCATGCCCAGCCAGCAGAGCTGG + Intronic
1092104064 12:5908460-5908482 GACTGCCCAGGGTGCTGGGCTGG + Intronic
1093101582 12:15035765-15035787 AACTGACCAGCCTGCTAAGCTGG + Intergenic
1093214142 12:16343359-16343381 GACTTCCCAGCCTGCTGAACTGG + Intergenic
1096189840 12:49609330-49609352 GGCAGCTCAGGCTGCTGATCTGG - Intronic
1096998452 12:55855546-55855568 TCCTGCCCAGCCTCCTGAGCAGG + Intergenic
1098308263 12:69123015-69123037 GGCTGAGCAGCCTGCTGCGCTGG + Intergenic
1100196024 12:92245982-92246004 AGCTACTCAGCCTGCTCAGCAGG - Intergenic
1102515041 12:113440677-113440699 AGGTGCCCAGGCTGCTAAGCAGG - Intergenic
1102552247 12:113699985-113700007 AGCTGCCCGGCCTGCTGATATGG + Intergenic
1102570822 12:113825962-113825984 GGCTGCCAGGGCTACTGAGCAGG + Intronic
1102965339 12:117121096-117121118 GCCTCCCCTGCCTTCTGAGCAGG - Intergenic
1104156289 12:126136247-126136269 GGATGCCCAGTCTGCTGCCCAGG + Intergenic
1104532769 12:129588027-129588049 GGCTGCCCAGACTCCTTGGCTGG + Intronic
1105255079 13:18739049-18739071 GGCAGCCCAGCCAGCTGGTCTGG - Intergenic
1109341064 13:61059715-61059737 GACTGCCCATCCTGGTGAGGAGG + Intergenic
1113484893 13:110646495-110646517 GGCTGCCTACCCTGCTGAAGTGG + Intronic
1113485952 13:110652522-110652544 GGCTCCCTGGACTGCTGAGCTGG + Intronic
1113654298 13:112058339-112058361 GGCTGCCCAGGCGGCTGGGAGGG + Intergenic
1114623075 14:24110227-24110249 GGCTACCCAGGATGCTGAGGTGG - Intronic
1114690362 14:24574856-24574878 GTCTGCCTACCCTGCAGAGCTGG - Intronic
1117776538 14:59189435-59189457 GGCTGCGCCGCCTGCGGACCCGG + Intronic
1117842068 14:59870491-59870513 GGCTCCCCAGCCTGCGGCGCCGG + Exonic
1119692783 14:76690298-76690320 AGCTGCCCAGGGTGCTGGGCAGG - Intergenic
1119861682 14:77940570-77940592 GTCTCCCCAGGCTGCTGAACTGG + Intergenic
1121693894 14:95896909-95896931 TGCTGCCTTGCCTGCTTAGCAGG + Intergenic
1122069252 14:99195044-99195066 GGCTGCCCAGCATGCAGAAAGGG + Intronic
1122265570 14:100545127-100545149 GGCCGCACAGCCTGCTGAGCAGG + Intronic
1122281662 14:100626605-100626627 GGCTGCCTAACCTGCTGAGATGG + Intergenic
1122878443 14:104679338-104679360 GGATGCCCAGCCTTCCCAGCGGG - Intergenic
1122900631 14:104780896-104780918 GGTGGCCCAGCCAGCTGGGCAGG + Intronic
1122946277 14:105011662-105011684 GGCACCCCAGGCTGCAGAGCGGG - Exonic
1122969473 14:105146628-105146650 AGCTGCCCACCCGGCCGAGCCGG - Exonic
1123019891 14:105392757-105392779 TGCTGGGCAGCCTGCTGACCTGG - Exonic
1123662029 15:22572919-22572941 GTCTGCCCAGACTGCTGCACTGG + Intergenic
1124262183 15:28202602-28202624 GTCTGCCCAGGCTGCTGCACTGG - Exonic
1124315831 15:28667186-28667208 GTCTGCCCAGGCTGCTGCACTGG + Intergenic
1124626720 15:31311989-31312011 GGCAGCCCACTCTGCTGACCAGG + Intergenic
1125102621 15:35932536-35932558 GCCTGGCCAGGGTGCTGAGCTGG + Intergenic
1128318858 15:66678815-66678837 GGCTGCTCAGTCTGGTGACCTGG - Intronic
1128730737 15:70019187-70019209 ACCTGCCCAGCCTCCTGAACAGG + Intergenic
1129197927 15:73982169-73982191 GGCTGCCCTCCCTGCTGGACTGG - Exonic
1129256694 15:74337852-74337874 TTCTGCCCAGCCTGCTCAGCAGG - Exonic
1129472077 15:75761617-75761639 GGCTGCCCAGCCCCCTGAAGTGG + Intergenic
1130342462 15:83011298-83011320 GGCAGCGCAGCCTACTGAGGCGG + Intronic
1130850127 15:87784680-87784702 TGCACCGCAGCCTGCTGAGCTGG + Intergenic
1131076607 15:89499258-89499280 AGCAGGCCAGCCTGGTGAGCAGG - Intergenic
1132288875 15:100685573-100685595 TGCTGCCCAGGCTGCTGTGAGGG - Intergenic
1132392277 15:101447712-101447734 GGACGTCCAGGCTGCTGAGCAGG - Intronic
1132496594 16:266325-266347 GGGTGCCCAGCTTGGTGGGCAGG - Intronic
1132667695 16:1089654-1089676 GGCTCCCCAGAGTGCTGACCAGG + Intergenic
1132714595 16:1284435-1284457 GGCTGCTGAGCCGGCAGAGCAGG - Intergenic
1133046694 16:3092130-3092152 GGCTGCCCAGCCTGCTGAGCCGG - Exonic
1133232658 16:4373804-4373826 GGCTGTCTGGCCTGCTGAGGTGG - Intronic
1133605016 16:7378456-7378478 GTCTTCCAAGCCTTCTGAGCCGG + Intronic
1134688938 16:16178363-16178385 GCTTGGCCAGCCTCCTGAGCTGG + Intronic
1136044077 16:27601856-27601878 GACAGCCCTGCCTGCTGGGCTGG + Intronic
1136349363 16:29696983-29697005 GGCTGCCCAGCAGGCGGTGCGGG + Exonic
1137426707 16:48385902-48385924 GGCTGCCCTGCCCGCCGACCGGG + Intronic
1137508092 16:49074039-49074061 TGTTGCCCAACCTGCTGAGCTGG - Intergenic
1138093992 16:54197948-54197970 GGGCGCCCAGCCTGCTCTGCAGG + Intergenic
1138204416 16:55114472-55114494 GGCTGCACAGCCTGGTGGGTTGG - Intergenic
1138251499 16:55505425-55505447 GACTGGCTAGGCTGCTGAGCTGG + Exonic
1138658957 16:58506791-58506813 GTCTCCCCTGCCTGCTGAGTGGG + Intronic
1140189987 16:72807228-72807250 GGCTGCCCAGCCAGTTGTGGAGG + Intronic
1140928108 16:79601389-79601411 GGATGCCCAGCCTTCTGGGCAGG - Intergenic
1141442216 16:84036864-84036886 GGATGACCAGCCCGCTGATCAGG + Exonic
1141862843 16:86729677-86729699 GCCTCCCCAGGCTGCAGAGCTGG - Intergenic
1142129942 16:88427899-88427921 GGCTGCCCAGCTCCCTGAGGTGG + Exonic
1142437961 16:90075113-90075135 TGCTGCTCAGTCTGATGAGCTGG + Intronic
1143973375 17:10812256-10812278 GGATGCCCAGCCTCATGAGGGGG - Intergenic
1144673643 17:17147067-17147089 GGCAGCACAGACAGCTGAGCAGG - Intronic
1144813667 17:18018463-18018485 GGCTCCCCAGCCTGTGGGGCTGG - Exonic
1144853813 17:18257483-18257505 GGCTCCCCACCCTGCAGGGCAGG + Intronic
1145770017 17:27486312-27486334 GGCATCCAAGGCTGCTGAGCTGG + Intronic
1145878217 17:28335696-28335718 GGCTCCCCAGCCGGCTGGGCTGG + Exonic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1146950194 17:36900231-36900253 GGGGTCCCAGCCTGCTGGGCTGG + Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147610939 17:41801489-41801511 GGCTCCTCTGCCTGCTAAGCTGG + Intergenic
1147725830 17:42565714-42565736 GGCTGCAGAGCCAGATGAGCGGG + Exonic
1148143114 17:45342323-45342345 GGCTGAGCAGCTTGCTGAGATGG - Intergenic
1148334731 17:46833573-46833595 GGCTGCCCACCACACTGAGCAGG - Intronic
1148860130 17:50600408-50600430 GCCTGTCCTCCCTGCTGAGCTGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150221244 17:63497024-63497046 GGCTGCCCAGCCTGGGGAGGGGG - Intronic
1150415914 17:64988756-64988778 GGCTGCCCAGTCAGCCAAGCAGG + Intergenic
1150653097 17:67022650-67022672 CCCTCCCCAGCCAGCTGAGCGGG - Intronic
1150795790 17:68235614-68235636 GGCTGCCCAGTCAGCCAAGCAGG - Intergenic
1151183679 17:72348521-72348543 GGGTGTCCAGCCTGCAGAACCGG + Intergenic
1151352968 17:73542566-73542588 GGAGGCCCAGCCTGCCCAGCAGG - Intronic
1151398553 17:73841040-73841062 AGCTGCCCTGCCTGCTGACCTGG - Intergenic
1152196375 17:78920801-78920823 TGCTGCCCGGCGTGGTGAGCAGG - Intronic
1152410006 17:80118369-80118391 GGCTGCTCAGGCTGGTGGGCAGG + Intergenic
1153545829 18:6204033-6204055 TGCTGCCCAGCCTGCTCCTCGGG + Intronic
1155017611 18:21860785-21860807 AGCTGCTCAGCATGCTGAGCTGG + Intronic
1155036725 18:22030730-22030752 GGGTGCCTGGCCTGCTGAGGGGG - Intergenic
1157513176 18:48293184-48293206 GGCTTCCCAGCCTTCAGAACTGG - Intronic
1158590002 18:58771336-58771358 GGCCGCCCTGCCTGCTGCTCAGG + Intergenic
1159646179 18:70921104-70921126 GGAGGCCCAGCCTGGTGAGGAGG - Intergenic
1160014508 18:75129791-75129813 GACTGCCCTGCATGCTGAGGCGG + Intergenic
1160751675 19:737321-737343 AGCTGCCCACACTGTTGAGCAGG - Intronic
1160848052 19:1175206-1175228 GGCTGCCCTGCGTGGGGAGCTGG + Intergenic
1160856095 19:1218663-1218685 GGCTGCGCAGCTTGCTGAAAGGG + Intronic
1160857946 19:1225862-1225884 GGCTGCCCACCCTGCCCAGGTGG - Intronic
1161335108 19:3708770-3708792 GCCTGCCCAGGACGCTGAGCTGG + Intronic
1161847084 19:6718296-6718318 TGCTGGTCAGCCTGCAGAGCGGG - Exonic
1163063573 19:14776817-14776839 AGCTGCCCAGCCTGCGGAGACGG - Exonic
1163655179 19:18541765-18541787 GGCTGCTCAGCCTCCTCCGCCGG + Exonic
1164513204 19:28913850-28913872 GGCTGCCCAGAAGGGTGAGCTGG - Intergenic
1164722904 19:30445086-30445108 GGCTGCCAAGGCTGCGGAGATGG + Exonic
1164756128 19:30691163-30691185 CGCTGACCAGCTGGCTGAGCCGG + Intronic
1165259414 19:34599187-34599209 AGCTGGTGAGCCTGCTGAGCAGG + Intronic
1165417603 19:35704415-35704437 GGCTGCCCAGCGTGCTCAGCTGG + Intergenic
1165452159 19:35890003-35890025 GGCTGCCCTGCCCCCTGGGCCGG - Exonic
1165725782 19:38111628-38111650 GGCATCCCAGCCTGCAGCGCTGG + Intronic
1165923829 19:39314922-39314944 GGTTGCCCAGGCCGCGGAGCTGG + Exonic
1165929937 19:39350940-39350962 TGTTGCCCAGGCTGCTGATCTGG + Intronic
1166566061 19:43766400-43766422 GACTGCCCAGCCTACAGAGTTGG + Intergenic
1167409976 19:49338849-49338871 GGTGTCCAAGCCTGCTGAGCTGG - Exonic
1167469976 19:49670233-49670255 GGCGGACCAGCTTGCTGCGCAGG - Exonic
1167807685 19:51799913-51799935 AGCTGGCCAGGATGCTGAGCTGG + Intronic
1167976498 19:53231090-53231112 GACTTCCCAGCCTCCAGAGCTGG - Intergenic
1168314262 19:55477198-55477220 GGAGGTCCAGCCTGCTGAACGGG + Intronic
1168689777 19:58369301-58369323 CCCTGCCCAGCCTTCTGGGCTGG + Exonic
1202686912 1_KI270712v1_random:56771-56793 GGCTGCCCAGGTGGCTGGGCTGG + Intergenic
925042124 2:740277-740299 GGCGGCCCAGCCAGGAGAGCTGG + Intergenic
925638919 2:5968875-5968897 GTTTGCCAAGCCTGCTGAGAAGG + Intergenic
925808321 2:7674064-7674086 TGATGCCCAGCCTTCTGAGTAGG - Intergenic
927852211 2:26506484-26506506 GGCTGCCCGGCCTGCTGGGATGG + Intronic
928576717 2:32663049-32663071 GGTTGACCAGACTGCTGTGCTGG + Intronic
929605702 2:43232764-43232786 GACTGCCCATCCTGCTGGGATGG - Exonic
931201844 2:60105288-60105310 GGTTTCACAGCCTGCTGAGAAGG + Intergenic
931795093 2:65700882-65700904 GGCTGTCTGGCTTGCTGAGCTGG + Intergenic
932804163 2:74768698-74768720 GGCTGCCCAGTCAGCTGGCCTGG + Intergenic
934265126 2:91505775-91505797 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934265370 2:91506867-91506889 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934265608 2:91507919-91507941 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934265766 2:91508605-91508627 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934265860 2:91509029-91509051 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934266120 2:91510191-91510213 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934266299 2:91511031-91511053 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934266548 2:91512141-91512163 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934266793 2:91513233-91513255 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934267031 2:91514284-91514306 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934267190 2:91514965-91514987 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934267382 2:91515844-91515866 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934267799 2:91517743-91517765 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934268369 2:91520256-91520278 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934268571 2:91521139-91521161 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934269012 2:91523130-91523152 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934269267 2:91524257-91524279 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934269767 2:91526464-91526486 GGCTGGCCAGCTGGCTTAGCCGG + Intergenic
934653583 2:96105775-96105797 GGCTGCCCACCCTGGTGTGAGGG - Intergenic
938079135 2:128360010-128360032 GGCCGCCAGGCATGCTGAGCAGG - Intergenic
938809872 2:134843285-134843307 GCCTGCCCAGCCTGCAAAACCGG + Intronic
939247536 2:139645144-139645166 GGCAGCTCAGGCTGCTGATCTGG + Intergenic
941136393 2:161722891-161722913 GGATGCCCTGCCTGGTGAGGAGG + Intronic
941251874 2:163175425-163175447 GGCTCCCCAACCTGCTGCACAGG - Intergenic
941442164 2:165552065-165552087 GGGAACCCAGGCTGCTGAGCAGG + Intronic
941544976 2:166837773-166837795 TGCTGCCCAGCCTGCCAGGCAGG - Intergenic
941603261 2:167564366-167564388 GGCTGCCCAGTCTGGAGAGTGGG - Intergenic
943499456 2:188668936-188668958 GGCTGCCCAGTGTGCTGACCTGG + Intergenic
943890190 2:193276890-193276912 GACTGCCAAGGCTGCGGAGCTGG - Intergenic
945324742 2:208469887-208469909 GGATGCTCAGCCTGAAGAGCAGG + Intronic
946185623 2:217978969-217978991 GGCTGCCGGGCCTGCGGGGCGGG + Intronic
948388739 2:237597568-237597590 GGCTGGCCACCCTCTTGAGCAGG + Intronic
948394482 2:237634066-237634088 GACTGCCCAGCCTACTGTGTGGG - Intronic
948611406 2:239169496-239169518 GGCTCCACGGCCTGCTGGGCGGG - Intronic
948797560 2:240412617-240412639 GGCTGTCCACCCTGGTGGGCCGG + Intergenic
949024623 2:241760805-241760827 GGATCTCCAGCCTGCTGACCTGG + Intronic
1168971955 20:1937371-1937393 GGCTCCGCAGCCTGGGGAGCAGG - Exonic
1169009343 20:2237389-2237411 AGCTGCCCTGCCTGCTCATCCGG + Intergenic
1169376690 20:5072161-5072183 GGCTACTCAGCCGGCTGAGGTGG - Intronic
1170693087 20:18632977-18632999 TGCTGCCCAGCCTGTGCAGCCGG + Intronic
1173955847 20:47031981-47032003 GGCAGCCCAGCCTTCTGTTCAGG + Intronic
1174383580 20:50172793-50172815 GGCTGGGCGGCCTGCTGGGCTGG - Intergenic
1175252247 20:57616683-57616705 GGCTGCGCAGCCTGGTGGCCAGG + Intronic
1175421248 20:58835282-58835304 TTCTGCCCTGCCTGGTGAGCGGG - Intergenic
1175761121 20:61562605-61562627 GGCTGCCAGGCCTGCAGAGCAGG + Intronic
1175805585 20:61826769-61826791 GGCTGCCCACCTTGCTCACCTGG + Intronic
1175904357 20:62372272-62372294 GGCGCCCCAGCATGCTGGGCAGG + Intergenic
1176125594 20:63473197-63473219 CGGTGCCCAGCCGCCTGAGCAGG + Intergenic
1176297250 21:5080677-5080699 GGCTGCCCAGACAGCTGGGCTGG + Intergenic
1178973312 21:37200487-37200509 AGCTGCCCTTCCTGCAGAGCTGG - Intronic
1179026725 21:37684764-37684786 GGCTGCCCAGCCGAGTCAGCGGG + Intronic
1179353128 21:40632127-40632149 GGCTTCCAAGGCTGCTGACCAGG + Intronic
1179859779 21:44181271-44181293 GGCTGCCCAGACAGCTGGGCTGG - Intergenic
1179880459 21:44291405-44291427 TGCTGCCCAGCCTGGACAGCTGG + Intronic
1180228331 21:46411725-46411747 GGCGGCCCACTCTGCCGAGCTGG + Exonic
1180965026 22:19783738-19783760 GGCTGGCCAGCCTCATGGGCTGG + Exonic
1181319571 22:21994202-21994224 GGTGGCCCAGCATGGTGAGCTGG + Intergenic
1181493224 22:23273800-23273822 GTCCACCCATCCTGCTGAGCTGG + Intronic
1182361095 22:29746981-29747003 GGGTGGCCAGGCTGCTCAGCAGG - Intronic
1182491842 22:30677790-30677812 GGCAGCACTGCCTGCTGAGGCGG + Intergenic
1183192618 22:36331479-36331501 CTGGGCCCAGCCTGCTGAGCTGG - Intronic
1183653580 22:39172419-39172441 GGCTGCACAGCATGCTGTGGTGG - Intergenic
1184233950 22:43173242-43173264 GGCTGCCCAGCAGGGTGAGGTGG - Intronic
1184276599 22:43412327-43412349 AGCTGCCCCGCCTGCCTAGCGGG + Intronic
1184751698 22:46489970-46489992 CGCTGCCCAGCCTGGTTAGTGGG + Intronic
1185047792 22:48537661-48537683 GGCTGCAGTGCCTGCTGGGCTGG - Intronic
1185245403 22:49770486-49770508 AGCTGCCCACCCAGCTGTGCAGG - Intergenic
950473436 3:13200662-13200684 AGCAGCCCAGCCTGGAGAGCAGG - Intergenic
950714912 3:14841206-14841228 GCCTGGCCATCCTGCTCAGCCGG + Intronic
951091351 3:18577173-18577195 GACTGCCCAGCCTTCAGAACTGG + Intergenic
951194003 3:19803973-19803995 GGCTGCCAATCCTGGTGAGCAGG - Intergenic
953696749 3:45165844-45165866 GGCAGCCCAGCCTTTTGAGTGGG + Intergenic
953852687 3:46478225-46478247 GGCTGCCCAGGCTGCTGAGAGGG - Intronic
953906205 3:46869399-46869421 GGCTGCCCTGGGTGCTGGGCTGG + Intronic
954367528 3:50154586-50154608 GACTGCCCGGGCTGCTCAGCAGG - Intergenic
954370091 3:50165783-50165805 GGCTGCCCAGCAGGCTGGGTGGG - Intronic
954406770 3:50349548-50349570 GGCTGCCCTGAGTCCTGAGCTGG + Intronic
954798811 3:53175248-53175270 GTCTTCCCAGGCTGCTGGGCAGG + Intronic
955073008 3:55587721-55587743 TTCTGCCTTGCCTGCTGAGCTGG + Intronic
959499097 3:107085092-107085114 GGCTGCCCATCCTGCTGGCTGGG + Intergenic
961034707 3:123634419-123634441 AGCTGCCCAGTCAGCTGAGGAGG - Intronic
961085554 3:124064418-124064440 GGCTGCCCTGCCTGCTCTTCAGG - Intergenic
961210440 3:125120998-125121020 TCCTGCGCTGCCTGCTGAGCTGG + Intronic
961790053 3:129369122-129369144 AGCAGCCCAGCCTGGAGAGCAGG + Intergenic
962399197 3:135042578-135042600 GGCTGCCCCTCCTGCAGTGCTGG + Intronic
963811561 3:149781856-149781878 GGCAGCTCAGCTTGCTGATCTGG - Intronic
966818803 3:183909247-183909269 GGCTGCCCCTCCTGCTGGGGAGG - Intergenic
966942424 3:184755437-184755459 GGCTGCCCTGCCTCCTGAGATGG + Intergenic
967890482 3:194360988-194361010 GGCTGCCAAGCCTGGGGTGCAGG - Exonic
968445375 4:649768-649790 GGCTGCCCAGCCAGTGGAGTAGG - Intronic
968472583 4:788817-788839 GGCAGCACAGCCTCCTGGGCTGG - Intronic
968850098 4:3073302-3073324 AGCTGTCCAGCCTGCCCAGCAGG - Intergenic
969448596 4:7259908-7259930 GGCCACCCAGCCTGTTGGGCAGG + Intronic
969584765 4:8085261-8085283 GCCTGGCCAGCTTGCTGGGCCGG - Intronic
971170309 4:24226780-24226802 GGATGCCCAGCCAGATGATCTGG + Intergenic
975616968 4:76256419-76256441 GCCTTCCGAGCCTGCTGGGCTGG - Exonic
976006742 4:80439536-80439558 GTTTTCCCAGCCTGCAGAGCAGG + Intronic
978735337 4:112077889-112077911 GGCTGCCCCGGCTGGTCAGCAGG - Intergenic
979671002 4:123360130-123360152 GCCGGACCAGCCTGCTAAGCAGG + Intergenic
985575943 5:673568-673590 CGGTGCCCAGCCTGCCGACCAGG + Intronic
985670989 5:1206630-1206652 GGGTGCCCAGCCTGGGGGGCGGG + Intronic
985896126 5:2751002-2751024 GGCCGCCCCGCAGGCTGAGCCGG - Intronic
986325086 5:6666783-6666805 TGCTGCCCAGCCTGGTGGGGGGG + Intronic
986365203 5:7022241-7022263 GCCTGCCCAGGCACCTGAGCTGG + Intergenic
987863134 5:23509809-23509831 TGCTGCTCAGTCTGATGAGCTGG - Intronic
987923356 5:24311205-24311227 GGCAGCACTGCCTGCTGAGGAGG + Intergenic
989170450 5:38467277-38467299 GGCTGCCCAGGCAGCTGCCCCGG + Intergenic
990509665 5:56479222-56479244 GACTTCCCAGCCTGCAGAACTGG - Intronic
994824798 5:104699073-104699095 GGCTGCAGAGCCAGTTGAGCAGG - Intergenic
997291192 5:132737097-132737119 CGCAGCCCTTCCTGCTGAGCGGG - Intronic
997418598 5:133748646-133748668 GTCTGCCCAGCTCCCTGAGCAGG - Intergenic
997645871 5:135481611-135481633 GGCCTCCCAGGCTGCTGGGCTGG + Intergenic
998134118 5:139665772-139665794 GGCTGCCCAGCCAGGTCACCGGG - Intronic
998399045 5:141838422-141838444 GGCTGCTCAGCCTGCCAGGCGGG + Intergenic
998485934 5:142502180-142502202 GGCTTCCCAGCCTCCAGAACTGG + Intergenic
998536244 5:142933711-142933733 GGTTTCCCAGCCTGCTTTGCAGG - Intronic
999461068 5:151758169-151758191 GGCTGCCCTGCCCGCGGAGCTGG - Intronic
1001572712 5:172741031-172741053 AGCTGCCTGGCCTGCTCAGCTGG + Intergenic
1002603389 5:180368103-180368125 ATCTGCCCAGGCTGCTGAGTTGG + Intergenic
1002632422 5:180590692-180590714 GGATGCCCAGGCTGCTCAGCAGG + Exonic
1006874022 6:37279798-37279820 GGCTGCCCAGTCTGGTGACCTGG + Intronic
1007229518 6:40338546-40338568 ACCTGGCCAGCCTCCTGAGCAGG - Intergenic
1007339834 6:41184272-41184294 GGCTGCCCAGGCTGTTGCTCTGG + Intergenic
1015350292 6:132210197-132210219 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1018013482 6:159692907-159692929 GGCAGCCCAGCCTGCGTAGACGG - Intronic
1019446698 7:1074951-1074973 GGCTGCCCCGTGTGGTGAGCGGG + Intronic
1020381703 7:7554932-7554954 GGCAGCACAGCCTGAGGAGCTGG + Intergenic
1022440363 7:30427979-30428001 TGCTTCCCAGGCTGCTGGGCAGG + Intronic
1022535639 7:31096595-31096617 GGGTGCCCAGACTTCTCAGCTGG + Intronic
1023800307 7:43828019-43828041 AACTGACCAGCCTGCTGAGCTGG - Intergenic
1026900942 7:74037164-74037186 CCCTGCCAAGCCGGCTGAGCAGG + Intronic
1032947837 7:136871840-136871862 AGCTGCCAAGCCTGCAAAGCTGG - Intronic
1033085869 7:138341315-138341337 GGCAGCACTGCCTGCTGAGGTGG - Intergenic
1033473013 7:141665814-141665836 GTCTGCCCACCCTGCCTAGCTGG - Intronic
1034260346 7:149751508-149751530 CCCTCCCCAGCCCGCTGAGCAGG + Intergenic
1034491553 7:151395736-151395758 GGCTCCCCTGGCTGCTGGGCGGG + Intronic
1034880002 7:154756235-154756257 CGCTGCCGAGCCTTCTGACCTGG - Intronic
1034970131 7:155413543-155413565 GGCTTCTCTGCCTGCTGAGCTGG - Intergenic
1035794062 8:2337180-2337202 GGTTGACCAGACTGCTGTGCTGG - Intergenic
1035798743 8:2384528-2384550 GGTTGACCAGACTGCTGTGCTGG + Intergenic
1036740320 8:11355238-11355260 AGCTGCCCAGCTTGCTTTGCTGG - Intergenic
1036813755 8:11886072-11886094 GCCTGCCCACCCTGCTGTCCTGG + Intergenic
1037210097 8:16375860-16375882 TCCTCCCCAGCCTGCTGACCTGG + Intronic
1037817627 8:22120375-22120397 TGCTGCCCAGGCTGCTGGGCTGG + Exonic
1037882620 8:22580321-22580343 GGCTGCCCAGGCTGCCAGGCAGG - Intronic
1039981952 8:42415516-42415538 TGCTGTCCTGCCTGCTGGGCCGG + Intergenic
1041830024 8:62143579-62143601 GGCTGCCCTACCTGCGGACCTGG - Intergenic
1047285875 8:123486846-123486868 GGCTGCTGAGGCTGCTGAACTGG + Intergenic
1048950790 8:139495334-139495356 GGCTGTGCACCTTGCTGAGCAGG - Intergenic
1049050686 8:140192557-140192579 GGCTGCCCTGACTGCACAGCTGG - Intronic
1049229069 8:141472793-141472815 GGAGGCCCAGCCGGCAGAGCGGG + Intergenic
1049255747 8:141612764-141612786 GGCAGCCCAGCCTACTCAGCAGG + Intergenic
1049274510 8:141713077-141713099 AGCTGCCCAGCCCAGTGAGCTGG + Intergenic
1049425323 8:142535546-142535568 GGCTGCAGAGCATGCTGAGGAGG + Intronic
1049428925 8:142550283-142550305 GGCTGCCCAGGCCTCTGATCCGG - Intergenic
1049442303 8:142614940-142614962 AGCTGCACATCCTGCAGAGCTGG - Intergenic
1049502336 8:142974169-142974191 GGCTGCCCTGCCTGGTGTCCAGG - Intergenic
1049559808 8:143304327-143304349 GGACTCCCAGCCTGCAGAGCTGG - Intergenic
1049637599 8:143697428-143697450 GGCTTTCCACCCTGCTTAGCAGG + Intronic
1049769827 8:144374657-144374679 CCCTGCCCAGCCTGCTGCCCCGG + Intronic
1049779967 8:144424426-144424448 GGCTGCCCAGACAGCTGTGTGGG + Intronic
1051805696 9:20990391-20990413 GGCTGCCTGCCCTGCTAAGCAGG - Intronic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1052881660 9:33604332-33604354 GGCAGCCCAGCCAGCTGGTCTGG + Intergenic
1053494659 9:38541505-38541527 GGCAGCCCAGCCAGCTGGTCTGG - Exonic
1056784593 9:89581140-89581162 GGCTGTCCAGGCTGCAGTGCTGG + Intergenic
1057110730 9:92468298-92468320 GCCTGCCCTGCATGGTGAGCTGG + Intronic
1058578331 9:106426914-106426936 GGCTGCCTACTCTGCTGATCAGG + Intergenic
1059263509 9:113003337-113003359 GCCTTCCCAGCTTGCTGAACTGG + Intergenic
1060114333 9:120928770-120928792 GGGGGCTCAGCCTGCAGAGCCGG - Intronic
1060492067 9:124092402-124092424 GACTTCCCAGCCTGCGGAACAGG + Intergenic
1061838447 9:133344051-133344073 GGCAGCCCTGCCTGCTGGCCAGG + Intronic
1062037806 9:134390441-134390463 GGCTGCCGTGCCTGCTGTGTAGG - Intronic
1062092792 9:134687318-134687340 AGCTCCCCAGACTGCAGAGCAGG + Intronic
1062166112 9:135108078-135108100 GGCTGGCCAGACTGCAGAGCCGG + Intronic
1062170242 9:135130904-135130926 GGGCGCGCAGCCAGCTGAGCTGG + Intergenic
1062323022 9:135999567-135999589 GGCTGCTCAGATTGCTGAGCAGG - Intergenic
1062582828 9:137236019-137236041 GGCTGCCCATCCCGCTGGCCAGG + Exonic
1062618955 9:137411035-137411057 GGCTGCCCTGTGCGCTGAGCAGG + Intronic
1187899544 X:24014709-24014731 GGGCACCCAGCCTGCTGAGAGGG + Intronic
1188872004 X:35383440-35383462 AGCTGTACAGCCAGCTGAGCTGG - Intergenic
1191768826 X:64733044-64733066 GGAGGCCCTGCCTGCTGAGGAGG + Intergenic
1191916638 X:66208233-66208255 GGCTGCTGAGCCTGGTGAGTGGG + Exonic
1194447469 X:94006323-94006345 AACTGACCAGCCTGCTGAGCTGG + Intergenic
1198300809 X:135332555-135332577 GACTGCCCAGCCTCCAGAACTGG + Intronic
1198968240 X:142250484-142250506 GGCAGCTCAGGCTGCTGATCCGG + Intergenic
1199114974 X:143981200-143981222 GCCTGCCTAGTCTGCTGAGTTGG + Intergenic
1199948897 X:152689747-152689769 GGCTTCCCAGCCTCCAGAACTGG + Intergenic
1199960779 X:152778702-152778724 GGCTTCCCAGCCTCCAGAACTGG - Intergenic
1200001203 X:153060659-153060681 GACTATCCAGCCTGCTCAGCTGG - Intergenic
1200206655 X:154321284-154321306 GGCTGCACAGCCTGCTCAGGTGG + Intronic
1201317511 Y:12662285-12662307 GACCGCCCAGCCAGCTGCGCAGG - Intergenic