ID: 1133051483

View in Genome Browser
Species Human (GRCh38)
Location 16:3119664-3119686
Sequence CCCGCAGTCAGTGCAGGCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133051483_1133051490 29 Left 1133051483 16:3119664-3119686 CCTACGCCTGCACTGACTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1133051490 16:3119716-3119738 CCAGCACCAGATCATCCACACGG 0: 2
1: 0
2: 2
3: 21
4: 181
1133051483_1133051491 30 Left 1133051483 16:3119664-3119686 CCTACGCCTGCACTGACTGCGGG 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1133051491 16:3119717-3119739 CAGCACCAGATCATCCACACGGG 0: 2
1: 2
2: 21
3: 95
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133051483 Original CRISPR CCCGCAGTCAGTGCAGGCGT AGG (reversed) Exonic
900242079 1:1621920-1621942 CCCTGAGTCAGAGCAGGAGTCGG + Intronic
900580329 1:3405556-3405578 CCCGCAGTCGGGGCAGGCGTGGG - Exonic
901789940 1:11648802-11648824 CCCGTAGTCGGTGAAGGTGTGGG + Exonic
906777933 1:48546950-48546972 CCTGCAGATAATGCAGGCGTGGG + Intronic
908850715 1:68373332-68373354 CCCGCAGGCGGTGCGGGCGGGGG - Intergenic
922054456 1:222027249-222027271 CCCTCAGTGAGTCCAGGAGTTGG + Intergenic
924946570 1:248850665-248850687 CCTGCAGTGAGTGCTGGGGTGGG - Exonic
1063435183 10:6023711-6023733 CCAGCAGTCTGTGCATGAGTGGG - Intronic
1064232506 10:13541647-13541669 CCCGCAGTCAGTCCAGACTAAGG - Intergenic
1067205219 10:44207043-44207065 CCCGCAGTCTGCCCAGGCCTGGG + Intergenic
1072470268 10:95706977-95706999 CCCTCAGTCCCTGCAGGCTTAGG - Intergenic
1072925062 10:99609948-99609970 CTCACAGTCAGTGCAGAAGTGGG - Intergenic
1073030177 10:100519642-100519664 CCCGCGGGCAGGGCAGGCGCGGG + Intronic
1077240351 11:1507500-1507522 CCCGCAGTCAGTGGTGGCTGGGG - Intergenic
1078053487 11:7987437-7987459 GCCGCAGCCGGTGCTGGCGTTGG - Exonic
1083302217 11:61745211-61745233 CCAGCAGGCAGGGCAGGCCTGGG - Exonic
1083899628 11:65637280-65637302 CCTGCAGGCAGTGCAGGCCCAGG - Exonic
1104488301 12:129171332-129171354 CAGGAAGTCAGTGCAGGTGTGGG - Intronic
1107235883 13:38169706-38169728 CCCTAAGTCAGTGAAGGAGTGGG + Intergenic
1108934703 13:55870131-55870153 CCAACAGTCTGTACAGGCGTTGG - Intergenic
1113944084 13:114033889-114033911 CCCGCCCACAGTGCTGGCGTGGG - Intronic
1116251049 14:42482668-42482690 CCCGCACTCAGAGCAGCCGGCGG - Intergenic
1118514316 14:66508894-66508916 CGCGCTGTCGGTGCAGGCGGCGG + Intronic
1129272208 15:74424934-74424956 CCCACAGCCAGGGCAGGGGTCGG + Intronic
1133051483 16:3119664-3119686 CCCGCAGTCAGTGCAGGCGTAGG - Exonic
1133295995 16:4752574-4752596 CCCGCACTGGGTGCAGGCATAGG + Exonic
1136153007 16:28364604-28364626 CCCGCAGCCAGAGGAGGCGAGGG - Intergenic
1136210076 16:28750669-28750691 CCCGCAGCCAGAGGAGGCGAGGG + Intergenic
1136462047 16:30417598-30417620 GCCGCAGTCGGGGCACGCGTGGG - Exonic
1136462116 16:30418018-30418040 GCCGCAGTCGGCGCAAGCGTAGG - Exonic
1136483187 16:30555458-30555480 CCCGCAGTCCGGGCACGGGTAGG + Exonic
1136483262 16:30555794-30555816 GCCGCAGTCAGTGCAGTGGAAGG + Exonic
1136487500 16:30582824-30582846 GCCGCAGTCAGGACAGGGGTAGG + Exonic
1136487555 16:30583076-30583098 CCCGCAGTCGGGGCAGGGGTAGG + Exonic
1136490462 16:30604630-30604652 CCCACAGTCTGGGCAGGGGTAGG + Exonic
1144105488 17:11981207-11981229 CAGGAAGTCAGTGCAGGAGTCGG - Intronic
1152319974 17:79603313-79603335 CCCGCTGGCAGTGGAGGCATGGG + Intergenic
1158610294 18:58934515-58934537 CCCACACTCAGGGCAGGTGTAGG - Exonic
1158860284 18:61584808-61584830 CCCAGAGTCAGTGCAGGCTTTGG - Intergenic
1158960529 18:62584301-62584323 CCCGCATTCTCTGCAGGCGGAGG - Intronic
1160419667 18:78735372-78735394 CGCGCAGTCATTGCAGTCATCGG + Intergenic
1160584625 18:79905433-79905455 CCAGCAGTCAGCCCAGGCTTCGG + Intronic
1161896228 19:7083155-7083177 CCCACAGTCACTGCATTCGTAGG - Exonic
1165154411 19:33778360-33778382 CCCGCAGACAGTGGAGGGGCGGG - Intergenic
1165435097 19:35791021-35791043 GCCGCAGCCAGCGCTGGCGTAGG + Intergenic
1166331619 19:42081068-42081090 GCCACAGTCAGGGCAGGAGTAGG - Exonic
1166540052 19:43599170-43599192 ACCGCACTCTGTGCAGGCGAAGG - Exonic
1167536832 19:50059025-50059047 CCCACATTCCTTGCAGGCGTAGG + Intergenic
1167816976 19:51891584-51891606 CCCACAGTCAGTGCATTCATGGG + Exonic
1168315433 19:55482887-55482909 GCCGCAGACACCGCAGGCGTGGG - Exonic
1168401633 19:56088704-56088726 GCCGCAGTCGGGGCAGGTGTAGG + Exonic
1168401658 19:56088872-56088894 GCCGCAGTCGGCGCAGGCGTTGG + Exonic
1168687267 19:58356460-58356482 GCCGCAGTCGGCGCAGGCGAAGG + Exonic
925317562 2:2937567-2937589 CCCACAGCCTGTGCAGTCGTGGG + Intergenic
926140546 2:10365432-10365454 CCCGGAGTCTGTGCAGGAGTTGG + Intronic
931036644 2:58251536-58251558 GCCGCAGCCGGTGCTGGCGTTGG - Intergenic
932739250 2:74279283-74279305 CCCGCAGTCTGAGGAGGGGTAGG - Intronic
933698598 2:85238277-85238299 CCCGAAGTCAGGGCAGGCAGCGG + Intronic
937642519 2:124229723-124229745 TCCGCAGGAAGTGCAGGGGTTGG + Intronic
938263471 2:129910915-129910937 CCCAGCGTCAGTGCAGGGGTGGG - Intergenic
948423645 2:237875206-237875228 CCCCCAGTCAGGGCAGCCTTGGG - Intronic
1170658760 20:18315993-18316015 CCCACACTCCTTGCAGGCGTAGG - Exonic
1170972164 20:21126178-21126200 CCCGCAGCCCGTGCTGGAGTTGG - Exonic
1171217932 20:23365684-23365706 GCCGCACTCGGTGCAGCCGTAGG - Exonic
1173250645 20:41362632-41362654 CCCAGAGTCGGTGCAGCCGTCGG + Exonic
1174265479 20:49328670-49328692 CCAGCAGTCATTGCATGAGTGGG + Intergenic
1175550171 20:59812425-59812447 CCTGCAGACAGAGCAGGAGTGGG - Intronic
1179940681 21:44637446-44637468 CCAAGAGTCAGTGCAGGCGCTGG - Exonic
1180582976 22:16859054-16859076 CCTGCACTCAGGGCAGGTGTAGG + Intergenic
1181000662 22:19986580-19986602 CCGGGAGTCAGAGCCGGCGTAGG + Intronic
1181464327 22:23102606-23102628 CCTGCAGGCAGAGCAGGTGTGGG - Intronic
1182489968 22:30665022-30665044 GCCGCAGACCGTGCAGTCGTCGG + Intronic
1183269780 22:36853849-36853871 CCCCCAGTCTGTGCAGACCTGGG + Intergenic
1184362104 22:44024722-44024744 CCGGCAGGCAGAGCAGGCGCGGG - Intronic
1184754669 22:46509110-46509132 CCCTCACTCAGTGCAGGCCCTGG - Intronic
955239122 3:57164593-57164615 CCCGGAGTCAGAGGAGGGGTAGG + Intronic
960735299 3:120772865-120772887 CCCCCACTCACTGCAGGCCTTGG + Intronic
961466882 3:127087586-127087608 ACCGCAGTCAGGGCAGGTGAGGG - Intergenic
968505294 4:968509-968531 GCGGCAGTCACTGCAGGCGAAGG + Exonic
972784638 4:42315338-42315360 CCCGCAGTCGGTGCGGCCGGTGG - Intergenic
974484807 4:62492174-62492196 CCCGCACTCAGAGCAGCCGGCGG - Intergenic
985875707 5:2592249-2592271 CCCACAGTCAGTGCTGATGTGGG - Intergenic
988376211 5:30439262-30439284 GCAGCACTCAGTGCAGGCCTTGG + Intergenic
991951810 5:71953828-71953850 CCCTCGATCAGTGCAGGCTTTGG + Intergenic
999422863 5:151459843-151459865 CCAGCAGACAGTGCAGGCAGAGG - Intronic
1006191480 6:32212447-32212469 TCTCCAGTCAGTGCCGGCGTTGG + Intronic
1011625609 6:89281113-89281135 CACTCAGTCAGTGCAGGCACAGG - Intronic
1018862481 6:167721013-167721035 CCCGCTGTGAGTTCAGGGGTGGG + Intergenic
1019640943 7:2103321-2103343 CCTGCACTCAGTGAAGGCCTGGG + Intronic
1020281936 7:6654337-6654359 GCCGCAGTTGGCGCAGGCGTAGG - Exonic
1029358595 7:100071530-100071552 CCCACATTCATTGCAGGCGTAGG + Exonic
1030988332 7:116268813-116268835 CTGGCAGTCAGTGCTGGCATTGG - Intergenic
1034262560 7:149765920-149765942 GCCGCAGTCCGGGCAGGCGCAGG + Exonic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034343630 7:150372698-150372720 GCCGCAGTCGGGGCAGACGTAGG - Exonic
1035099543 7:156384864-156384886 GCCGCAGTCAGCCCAGGCGTGGG - Intergenic
1037756716 8:21714992-21715014 CCCTCTGGCAGTGCAGGCCTTGG + Intronic
1039790047 8:40868439-40868461 CCCTCAGACAGTGCAGACATAGG - Intronic
1042849368 8:73200959-73200981 CCTGCAGGCACTACAGGCGTGGG + Intergenic
1049192410 8:141295663-141295685 GCCTCAGTCAGTGCTGCCGTGGG - Intronic
1049298338 8:141855687-141855709 CCTGGAGCCAGTGCAGGGGTCGG + Intergenic
1049558595 8:143296298-143296320 GCCGCAGTCGGCGCACGCGTAGG - Exonic
1049578918 8:143402038-143402060 CCCGGTGTCAGTGCAGACTTCGG - Intergenic
1049804990 8:144534641-144534663 CCCGCAGCCAGTGCTGGGGGAGG + Intronic
1053268325 9:36732331-36732353 CCTGCAGGCAGTGCTGGCTTTGG - Intergenic
1057800159 9:98186033-98186055 CCCACAGGCAGTGCAGGGGCAGG - Intronic
1060281214 9:122216930-122216952 CCCGCAGGCAGCGTAGGGGTGGG - Intronic
1061892227 9:133628949-133628971 CCCCGAGTCAGTGCAGGCAGAGG - Intergenic
1061924254 9:133798218-133798240 CCCTGAGCCAGTGCAGGCCTCGG - Intronic
1062264093 9:135678890-135678912 CCCGCAGTCAGGCCAGGCCCAGG + Intergenic
1193671244 X:84389378-84389400 CCCTGAGTCAGGGCAGGAGTAGG - Intronic
1200159665 X:153999793-153999815 CCCGAAGTCCGAGCCGGCGTGGG - Intergenic