ID: 1133053837

View in Genome Browser
Species Human (GRCh38)
Location 16:3135024-3135046
Sequence CCCGCGAGGACTTCCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133053837 Original CRISPR CCCGCGAGGACTTCCGGCGC CGG Exonic
900109392 1:999201-999223 CCCGCGTAGACCTCGGGCGCTGG + Exonic
900349142 1:2226902-2226924 CCAGCGAGGCCTGCGGGCGCAGG - Intergenic
902627530 1:17685153-17685175 CACGCGAGGTCTTCGGGGGCTGG + Intronic
910760477 1:90727079-90727101 CGCGCCAGGACCTCCGGCGTGGG - Intergenic
915973627 1:160370916-160370938 GCCGCGAGGAGCGCCGGCGCCGG + Exonic
917647598 1:177044482-177044504 CCCGCCAGGACCTCGGGCGCAGG + Intronic
924722332 1:246635661-246635683 CACGCGAGCATTTCCAGCGCTGG + Intronic
924795543 1:247289815-247289837 CACGCGAGCATTTCCAGCGCTGG - Intergenic
924861299 1:247925199-247925221 CCCGGGAGGACTTCAGGGTCAGG + Intergenic
1070328587 10:75403044-75403066 CCCGCGAGGACTCGCGGCGGCGG - Intergenic
1076915955 10:133423299-133423321 CGGGCGTGGACTTCGGGCGCTGG - Exonic
1077149174 11:1061187-1061209 CCAGCGAGGACATCCGGCACAGG + Intergenic
1113379362 13:109787535-109787557 CCCGCGCGGTCTCCCGGCTCAGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1122837197 14:104436132-104436154 CCCGCCAGGACTACCGGGCCAGG - Intergenic
1122945781 14:105008205-105008227 CCCCCGAGGAAATCCTGCGCAGG + Intronic
1133053837 16:3135024-3135046 CCCGCGAGGACTTCCGGCGCCGG + Exonic
1133287771 16:4698483-4698505 CCCGCGAGGACCTCCAGGCCCGG - Exonic
1133292840 16:4734258-4734280 CCCGCAACTACTTCCGGGGCGGG - Exonic
1133311240 16:4847913-4847935 CCCAGGAGAACTTGCGGCGCGGG - Intronic
1141904045 16:87011217-87011239 CCTGCGAGGAATTCCTGCACTGG - Intergenic
1143551229 17:7631612-7631634 CCAGCCAGGAATCCCGGCGCAGG - Exonic
1147932070 17:43987942-43987964 GCTGTGAGGACTTCCGGCGTGGG - Intronic
926358227 2:12060837-12060859 CCCACGAGGACTTGCTGAGCAGG + Intergenic
938319913 2:130355889-130355911 CCCGCGAGGACCTAGGGCTCCGG + Intergenic
1172587026 20:36092410-36092432 CCCGCGAACCCTCCCGGCGCTGG - Intronic
1176242987 20:64083660-64083682 CGCGCGCGGACTTCTGCCGCTGG + Exonic
1176368734 21:6049737-6049759 CCCGGGAGGACTGCCTGCGGGGG + Intergenic
1178103949 21:29298673-29298695 CCCGCGTGGGCTTCCGGCCGCGG + Intronic
1179754785 21:43488805-43488827 CCCGGGAGGACTGCCTGCGGGGG - Intergenic
952652139 3:35739352-35739374 CCCCCGAGGACTGCCGGCTCAGG - Exonic
953405876 3:42659497-42659519 CCCGGGAGAACGCCCGGCGCCGG + Exonic
961389683 3:126544921-126544943 CCCTCGAGGACTGAGGGCGCTGG + Intronic
1006719235 6:36139333-36139355 CCCGGAAGGACTCACGGCGCCGG + Exonic
1007591162 6:43021695-43021717 CCCGCGGGGACGTCGGGCCCCGG - Exonic
1011643113 6:89433345-89433367 GCGGCGCGGACGTCCGGCGCGGG + Intronic
1015149218 6:130019840-130019862 CCCGCGCGGACGGCCGCCGCGGG - Intronic
1022923441 7:35037759-35037781 CACGCGCGGACTTCCGGCGCAGG + Intronic
1023638424 7:42236496-42236518 CGCGCGGGGACCTCCGCCGCGGG - Intronic
1029238691 7:99143660-99143682 CCTGCGGGGAATTCCGGGGCGGG + Intronic
1029363138 7:100101226-100101248 CCCGGGAGGGCGTCCTGCGCGGG - Intronic
1038266190 8:26041414-26041436 CCCGCGAGGACTGCGCACGCAGG + Intronic
1039947321 8:42140873-42140895 CCGGCGAGGAGTTCTTGCGCCGG - Intergenic
1045211638 8:100105935-100105957 CCCGCGCGGGCTCCAGGCGCGGG - Exonic
1049621056 8:143598522-143598544 CCCGCGCTGCCCTCCGGCGCCGG + Exonic
1049798881 8:144508771-144508793 CCCGCGCGACCTTCCGGCCCTGG + Intergenic
1055757732 9:79573103-79573125 CCCTCGAGGAGTCGCGGCGCGGG - Intronic
1060700935 9:125748001-125748023 CCGGCGGGGAGTCCCGGCGCCGG + Intronic
1188443575 X:30234559-30234581 CCAGGGAAGACTTCCGGGGCAGG - Intronic