ID: 1133054849

View in Genome Browser
Species Human (GRCh38)
Location 16:3140779-3140801
Sequence CTCAGCCTCCTCGGGGCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 452}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133054849_1133054865 23 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054865 16:3140825-3140847 GAGGGCGGCCCTGGGCCCAGTGG 0: 1
1: 0
2: 2
3: 57
4: 528
1133054849_1133054866 26 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054866 16:3140828-3140850 GGCGGCCCTGGGCCCAGTGGTGG 0: 1
1: 0
2: 3
3: 44
4: 389
1133054849_1133054862 15 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054862 16:3140817-3140839 AACCGGCCGAGGGCGGCCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 110
1133054849_1133054856 -2 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054856 16:3140800-3140822 AGGCCTGGGAGAGCGAGAACCGG 0: 1
1: 0
2: 5
3: 37
4: 343
1133054849_1133054867 27 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054867 16:3140829-3140851 GCGGCCCTGGGCCCAGTGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 252
1133054849_1133054860 8 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054860 16:3140810-3140832 GAGCGAGAACCGGCCGAGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 62
1133054849_1133054858 4 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054858 16:3140806-3140828 GGGAGAGCGAGAACCGGCCGAGG 0: 1
1: 0
2: 0
3: 17
4: 99
1133054849_1133054861 14 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054861 16:3140816-3140838 GAACCGGCCGAGGGCGGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 154
1133054849_1133054859 5 Left 1133054849 16:3140779-3140801 CCTGGAGCCCCGAGGAGGCTGAG 0: 1
1: 0
2: 7
3: 60
4: 452
Right 1133054859 16:3140807-3140829 GGAGAGCGAGAACCGGCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133054849 Original CRISPR CTCAGCCTCCTCGGGGCTCC AGG (reversed) Exonic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900193579 1:1362138-1362160 CCCTGCCTCCTCGGGGCTGCAGG - Intergenic
900378841 1:2373742-2373764 CTCAGCCTCCACGAGGAGCCCGG + Intronic
900435537 1:2629019-2629041 CTCCGCCTCCGCCGGACTCCCGG - Intronic
900438823 1:2643443-2643465 AGCCGCCTCCTCTGGGCTCCGGG + Intronic
900513675 1:3071518-3071540 CTCAGCCACCTTGGGGGGCCTGG - Intronic
900548966 1:3244170-3244192 CCCAGCGTCCTCGGAGCTCCTGG + Intronic
900594441 1:3474369-3474391 CTCAAACTCCTGGGGGCCCCAGG + Intronic
900719197 1:4164363-4164385 TTCAGCCTCCTGGTGGCCCCCGG + Intergenic
901045322 1:6392837-6392859 CTTAGCCTCCTCGAGGATTCGGG - Intronic
901425648 1:9181163-9181185 CCCAGCCACCTCTGGGCTCCAGG + Intergenic
901941647 1:12666743-12666765 CCCTTCCTCCTCGGGGCCCCAGG - Exonic
902187876 1:14739060-14739082 CTCAGCCTCCTGAGGACTCCTGG - Intronic
902373998 1:16021757-16021779 CTCAGGCTCCTGGGTGCTGCTGG - Intronic
902378925 1:16043592-16043614 CTCAGGCTCCTGGGTGCTGCTGG - Intergenic
902405980 1:16183837-16183859 CTCAGCCAGCCCGGGGCTCCAGG - Intergenic
902546628 1:17194355-17194377 CTCTGGGGCCTCGGGGCTCCTGG + Intergenic
902627221 1:17683587-17683609 CTCAGCTACCTCTGGGCTCCTGG - Intronic
902975189 1:20083333-20083355 TTCAGACTCCCCTGGGCTCCTGG - Intronic
903179115 1:21596629-21596651 CTCAGCCCACCTGGGGCTCCAGG + Intronic
903528846 1:24013978-24014000 CTCCGCCCCCTCGAGACTCCAGG - Intergenic
903779845 1:25814208-25814230 CCCAGGCACCTCGGGGCCCCGGG + Intronic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904216958 1:28928763-28928785 CTCAGCCTGCTCTAGGCACCAGG - Intronic
904296488 1:29522549-29522571 CTGAGCCTCCTTGTGGCTCTGGG + Intergenic
904369062 1:30037174-30037196 CTCTCCCTTCTCTGGGCTCCAGG + Intergenic
905043645 1:34979363-34979385 GCCAGGATCCTCGGGGCTCCAGG + Intergenic
905107736 1:35574177-35574199 CGCAGCCTCCTCAGGCCGCCTGG + Exonic
907050399 1:51326227-51326249 CCCAGCCTCCTCAGTGCCCCAGG - Intronic
907082978 1:51641763-51641785 CTCAGCTTCCTGGGAGCACCGGG + Intronic
907186846 1:52616100-52616122 CTCAGCCTCCTTGGGATTACAGG + Intergenic
907281261 1:53348831-53348853 CTCAGCCCTCACGTGGCTCCAGG - Intergenic
907382766 1:54104915-54104937 CTCAGCCCCCTCAGGGCTGAGGG + Intronic
909584030 1:77269648-77269670 CTCTGCCTCCTCTGGTCTGCTGG + Intergenic
910064343 1:83135241-83135263 CTCAGCCTCCCCAGGACTACAGG - Intergenic
910179215 1:84463066-84463088 CTCAGACTTCTTGGAGCTCCAGG + Intergenic
912451950 1:109772835-109772857 CCCAGCCTCCTGGGTGCCCCGGG + Intronic
912625988 1:111204618-111204640 CCCACCCTCCGTGGGGCTCCCGG + Intronic
912628101 1:111222941-111222963 CTCAGTCTCCTCTTGGCCCCGGG - Intronic
914831634 1:151174789-151174811 CTCTAGCTCCTCGGGGCTCAAGG + Exonic
915558522 1:156673509-156673531 CTCAGCCTCCAGGAGGGTCCTGG + Exonic
916121895 1:161535812-161535834 CTCAGCCTCCTGGGGACTACAGG - Intergenic
916131490 1:161615761-161615783 CTCAGCCTCCTGGGGACTACAGG - Intronic
916425584 1:164676800-164676822 CTGAGCCCCCTCAGGGCTCAAGG - Intronic
916792269 1:168135725-168135747 CTCAGCGTCCTAGGGGCTGGGGG - Intronic
916793919 1:168147930-168147952 CTCAGCCTCCTGAGGACTACAGG - Intergenic
918048157 1:180953739-180953761 CTCAGTCTCCTCGGGGCTTGGGG + Intergenic
919263955 1:195237621-195237643 CTCAGCCCCCTCTGGACTTCAGG + Intergenic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
920201298 1:204261389-204261411 CTCTTGCTCCTCGGGGCTCTCGG + Exonic
920260518 1:204685190-204685212 AGCAGCCGCCTCAGGGCTCCTGG - Intronic
922387971 1:225107301-225107323 CTCAGGCTACTCGGGGATCAGGG + Intronic
922570837 1:226633998-226634020 TTCAGCCTTCTCTTGGCTCCTGG + Exonic
924570889 1:245236783-245236805 CCCAGCCCCCACGGGGCTCACGG - Intronic
1062890535 10:1056673-1056695 CCCAGACCCCTCGGGGCTGCGGG + Intronic
1062989975 10:1806134-1806156 CTCAGTCTCCCCGTGGCTGCAGG + Intergenic
1064254526 10:13732685-13732707 CTCTGCCACCTCGAGCCTCCAGG - Intronic
1064376299 10:14799599-14799621 CTCAGCCTCCCCTGGCCTGCAGG - Intergenic
1066010706 10:31191485-31191507 CTCAGCCTCCACAGGGCTAATGG + Intergenic
1067542559 10:47166383-47166405 CTCTGCCTCCACAGGGCTCAGGG - Intergenic
1067794567 10:49311389-49311411 CTTGTCTTCCTCGGGGCTCCTGG - Intronic
1069875221 10:71558830-71558852 TTCAGCCTCCTGAAGGCTCCAGG - Intronic
1070283755 10:75069216-75069238 TCCAGCCTCCTCAGGGCTTCCGG - Intergenic
1070290185 10:75108853-75108875 CTCAGCACCCCCGGGGGTCCTGG + Intronic
1070642203 10:78178087-78178109 CATGGCCTCCTCTGGGCTCCTGG - Intergenic
1072717333 10:97760575-97760597 CTCAGCCCCCTCATGGGTCCTGG - Exonic
1073099599 10:100999783-100999805 CTCCGCCTCCGCGGCGCCCCCGG - Exonic
1073234830 10:102005078-102005100 CTCAGCCTCCCTGGGACTACAGG - Intronic
1075132145 10:119748995-119749017 CTCAGCCCCCTCTGGACTTCGGG - Intronic
1076667729 10:132102591-132102613 CGCAGGCTCCTCGTGGTTCCTGG + Intergenic
1076698906 10:132260223-132260245 CTCAGCCTCCGCCTGGCCCCTGG + Intronic
1077001720 11:326745-326767 CTAAGCCTCCCCGTGTCTCCTGG + Intronic
1077268282 11:1663015-1663037 CACAGCCTCCACGTGGCTCATGG + Intergenic
1077272599 11:1688604-1688626 CACAGCCTCCACGTGGCTCATGG - Intergenic
1077415603 11:2422989-2423011 TTCAGCATCCCCGGGGCTTCCGG + Exonic
1077543211 11:3157387-3157409 CTTGGCCTCCCCGGGTCTCCTGG - Intronic
1078010798 11:7571765-7571787 CTCAGCTCCCAAGGGGCTCCTGG + Intronic
1078474759 11:11621249-11621271 CTCAGCCACGGCGGGGCTCTGGG - Intronic
1079284040 11:19113277-19113299 CTCAGCCTCCACTTGGCTGCCGG - Intergenic
1081538918 11:44016154-44016176 CTCATGTTCCTGGGGGCTCCAGG - Intergenic
1081789379 11:45772064-45772086 CCCAGCTCCCTCCGGGCTCCGGG + Exonic
1081876423 11:46411404-46411426 CACAGCCTCCTGGGACCTCCTGG - Intronic
1083163846 11:60871660-60871682 CTCAGCCTCCTCCTGGGACCTGG - Intronic
1083755077 11:64787968-64787990 CTCACCCTCCTTGGGGCTCACGG + Intergenic
1084192205 11:67504379-67504401 CTCAGCCTCGCTGCGGCTCCCGG - Intronic
1084837503 11:71813575-71813597 CTCAGCCTCTGCGGGGCTCTGGG + Intergenic
1085029862 11:73264507-73264529 CTCTGGCTCCTCTGGGTTCCAGG + Intronic
1085284621 11:75351708-75351730 CTCCGCCTCCTCCGCTCTCCCGG + Intergenic
1088663810 11:112074413-112074435 CCCAGCGGCCTCGGAGCTCCCGG - Exonic
1089454538 11:118618315-118618337 CTCCCCCTCCCCTGGGCTCCAGG + Intronic
1089599642 11:119605473-119605495 CCCAGCCACCTCTGGCCTCCCGG + Intergenic
1089606621 11:119645124-119645146 CCCAGCCTGCTCTGAGCTCCTGG - Intronic
1089802306 11:121043568-121043590 TTCAGCCTCTTCAGGGCTACTGG + Intronic
1091405994 12:209918-209940 CTCTCCCTCCTCGGGGACCCAGG + Exonic
1091616401 12:2053742-2053764 CTCCGCCTCGTCGGAGCGCCCGG + Intronic
1091688276 12:2578994-2579016 CTCAGAATGCTTGGGGCTCCAGG - Intronic
1091987941 12:4928295-4928317 CTCAGCCTCCCTGGGACTACAGG - Intronic
1092260575 12:6951498-6951520 CTCACCATCCTGGGGGCTTCCGG - Exonic
1092401195 12:8180495-8180517 CTCAGCCTCTGCGGGGCTCTGGG - Intronic
1092786316 12:12030207-12030229 CCCAGGCTCCTCTGTGCTCCAGG + Intergenic
1094348461 12:29497579-29497601 CTCAGCCTCCTCCGCAGTCCTGG + Intronic
1094418401 12:30242456-30242478 AGCAGCCTCCTGGGGGCTCTAGG + Intergenic
1095099265 12:38163611-38163633 CTCGGCCGGCTCGGGGATCCCGG - Intergenic
1095939321 12:47715938-47715960 CTCAGCCACCTCCGCGATCCTGG - Intronic
1096203804 12:49705684-49705706 CCCAGCCTCCTCGGGGGATCGGG - Intronic
1096487957 12:51996336-51996358 CTCAGGCTCCCCAGTGCTCCTGG + Intronic
1097123945 12:56758278-56758300 CTCAGCCTCCCTGGGACTACAGG - Intronic
1101409622 12:104457631-104457653 TTCGGCCTCTTCGGGGCTCCTGG + Intronic
1102527241 12:113520645-113520667 CTTACCCTCCTGGAGGCTCCTGG + Intergenic
1102559200 12:113750011-113750033 CGCAGCCTCCTCCAGGCTCTGGG + Intergenic
1103474627 12:121209712-121209734 CTCAGCCTCCCTGGGACTACAGG + Intergenic
1103572389 12:121853818-121853840 CTCAGCCTCCTGGGGATTACAGG - Intronic
1103931422 12:124452969-124452991 CAGAGCCTCCCCTGGGCTCCTGG - Intronic
1104288222 12:127444845-127444867 CTCAGCCTCCCCAGGACTACAGG + Intergenic
1104602260 12:130162051-130162073 CTCGGCGTCCTCGGGGTGCCGGG + Intergenic
1104725247 12:131071683-131071705 CTCTCCTTCCTCGGGCCTCCTGG - Intronic
1104806246 12:131591337-131591359 CTCAGCATCCTCTGAGCCCCAGG - Intergenic
1106099580 13:26682775-26682797 CCCACCCTCCACCGGGCTCCTGG + Exonic
1107036641 13:35909210-35909232 CTGAGCCTCCTGGGGGCTCCTGG + Intronic
1109262738 13:60163605-60163627 CCCAGGCTCCTCGGGGCCACTGG + Exonic
1110810599 13:79807668-79807690 CTCAGCCCCCTCTGGGCTTTGGG + Intergenic
1111802769 13:92999841-92999863 CTCAGCCTCCCTGGGACTACAGG - Intergenic
1112291006 13:98143699-98143721 CTCGGGGGCCTCGGGGCTCCGGG + Intronic
1113053195 13:106237078-106237100 CACTGCCGCCTCGTGGCTCCAGG + Intergenic
1113117228 13:106886359-106886381 CTCAGCCTCGTCTTAGCTCCTGG + Intergenic
1113546202 13:111153373-111153395 CTCGGCCTCCTCCCTGCTCCAGG - Intronic
1113643318 13:111973738-111973760 CTCAGCCCCCTGGGTTCTCCAGG - Intergenic
1113730876 13:112640780-112640802 CTCAGCCTCTTTGGGACTTCAGG - Intergenic
1113774177 13:112933317-112933339 CACAGCTTCCACGGAGCTCCTGG - Intronic
1114485177 14:23057693-23057715 GTCCGCCCCCTCGGCGCTCCTGG + Intergenic
1116308361 14:43288339-43288361 CTCAGCCTCCCTGGGACTACAGG + Intergenic
1117340114 14:54785147-54785169 CTCAGCCTGCTTTGGGCTCCAGG - Intronic
1119535766 14:75401378-75401400 CTCGGCCTCCTCTGGGCTTTTGG + Intergenic
1120453087 14:84695814-84695836 CTCAGCCTCCTGAGGACTACAGG - Intergenic
1120949248 14:90026026-90026048 CTCAGCCTCTTCTGAGCCCCAGG + Intronic
1120997847 14:90430020-90430042 CTCAGCCTCCATGGGTTTCCTGG - Intergenic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1121288081 14:92752087-92752109 CTCAGCCTCCTCCCTGCTGCTGG - Intergenic
1121317689 14:92971877-92971899 CCCACCCTCCTCGGGGTGCCTGG + Intronic
1121613938 14:95300175-95300197 CTCAGCCACCTCTGGGAGCCTGG - Intronic
1122267654 14:100554179-100554201 CTCAGCGCCCTCTGAGCTCCGGG - Intronic
1122337653 14:101004480-101004502 CAGAGCCTCCCCGGGTCTCCGGG + Intergenic
1122581861 14:102776627-102776649 CCCAGCGTCCTCGGCGGTCCTGG - Intergenic
1122907489 14:104808459-104808481 CCCAGCCTCCCTGGGGCGCCAGG + Intergenic
1123004541 14:105314937-105314959 CTCGGCCTCCCCGGCGCGCCCGG + Exonic
1123057100 14:105575746-105575768 CTCAGCCTCCTTGGGGCTTCTGG - Intergenic
1123081146 14:105696145-105696167 CTCAGCCTCCTTGGGGCTTCTGG + Intergenic
1123449132 15:20349428-20349450 GTGGGCCTCCTGGGGGCTCCTGG - Intergenic
1123804349 15:23855575-23855597 CAAAGCCTTCTCTGGGCTCCTGG - Intergenic
1124023445 15:25944302-25944324 CTCTGCTTCCTCTGGGCTGCTGG - Intergenic
1125475383 15:40044733-40044755 CTCAGCCAACTCAGGGCTCCAGG + Intergenic
1127360181 15:58238224-58238246 CTGAGCCTCCTCGGCTCCCCAGG - Intronic
1128089727 15:64911576-64911598 CTCATCCTCCTCGCGCCTCTCGG - Intronic
1128459968 15:67859697-67859719 CTGAGCCTCCTCTGTGTTCCAGG + Intergenic
1128771804 15:70288431-70288453 CCCAGACACCTCCGGGCTCCTGG + Intergenic
1129862542 15:78873501-78873523 CGCAACCACCCCGGGGCTCCAGG - Intronic
1130151323 15:81313768-81313790 TGCAACCTCCTGGGGGCTCCTGG + Intronic
1130351012 15:83091798-83091820 CTCAGCCTCCTGAGGACTACAGG - Intergenic
1130784718 15:87083450-87083472 CTCCTGCTCCTCGAGGCTCCAGG - Intergenic
1131157159 15:90082301-90082323 CTCAGCCTCCCCCGGGCCCTGGG - Intergenic
1131541155 15:93276506-93276528 CTCAGCCTCCTCTTGGCTCTGGG + Intergenic
1132419335 15:101652196-101652218 CCCGGCCTCCTCGCAGCTCCCGG + Intronic
1132583259 16:694808-694830 CCCAGCCGCCTCCCGGCTCCGGG - Intronic
1132855852 16:2044263-2044285 AGCAGCCTCCCCAGGGCTCCTGG + Intronic
1132973349 16:2699732-2699754 CTCAGCCTCCCTGGGTCACCTGG + Intronic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133783623 16:8958346-8958368 CCCAGCCTCCTTGGTGCTGCCGG - Intronic
1135555868 16:23436103-23436125 CTCAGCCTCCTGGGGTTTACAGG - Intronic
1136409946 16:30070277-30070299 GGCCGCCTCCTCGGGGCTCCAGG + Exonic
1137660738 16:50203924-50203946 CAGAGCCTCCTGGGGGCTCCTGG - Intronic
1138125528 16:54435497-54435519 CCCACCCTCCTATGGGCTCCAGG + Intergenic
1138549383 16:57739299-57739321 CTCTGGCTCCTTGTGGCTCCAGG + Intronic
1138560528 16:57798256-57798278 AGCAGCCTCCTCGGGGCACCAGG + Exonic
1139470322 16:67174765-67174787 CTCTGGCTCCTCCGGGGTCCCGG - Exonic
1139545450 16:67647715-67647737 CTGAGTCTCCTCAGGGCTCCTGG - Exonic
1139591738 16:67936713-67936735 AGAAGCCCCCTCGGGGCTCCAGG + Exonic
1139659688 16:68412111-68412133 CCCAGCCTCCTCTGGCCTCCCGG - Intronic
1139868375 16:70082453-70082475 CTCAGCCTCCTGAGGACTACAGG - Intergenic
1139922773 16:70470376-70470398 CTCACACTCCCCGGGGCTCCTGG + Exonic
1139938949 16:70591007-70591029 CCCAGCCTGCTCGGGTCTCCGGG + Intronic
1140386957 16:74549408-74549430 CTCAGCCTCCTGAGGACTACAGG + Intronic
1140648941 16:77065834-77065856 CTCATCCTCCTCTGTCCTCCAGG + Intergenic
1141113406 16:81288725-81288747 CTTAGCCTCCTCAGGGCTGTGGG - Intronic
1142031465 16:87840621-87840643 CTCAGCCTCCTGCGTGTTCCGGG + Intronic
1142242100 16:88952260-88952282 CACAGCCTCCCCGGGTGTCCTGG - Intronic
1142413145 16:89926237-89926259 CACCGCCTCCTCGCGGCTGCGGG + Intronic
1142794721 17:2299043-2299065 CTCTACCTCCTCGGGACTCATGG + Exonic
1143181480 17:4986921-4986943 CTCTGCCTCCCCTGGCCTCCAGG + Intronic
1143540924 17:7568470-7568492 CTCAGCCTCCCGGGGACTACAGG - Intronic
1143847379 17:9782839-9782861 TTCAGCCTCCACTGGGCACCAGG - Intronic
1144157327 17:12518536-12518558 CTCAGAGTCCTAGGGTCTCCAGG - Intergenic
1145359713 17:22202245-22202267 CTCAGCCTCCCCAGGACTACAGG + Intergenic
1145755921 17:27390016-27390038 CTCAGCCTCCACCAGGCCCCAGG + Intergenic
1147140821 17:38459714-38459736 CACAGCCTCCTCCTGCCTCCAGG - Intronic
1147741644 17:42673802-42673824 CCCCTCCTCCGCGGGGCTCCCGG + Exonic
1147925358 17:43942389-43942411 CTCAGCCTGCCTGGGGCTCTGGG - Intronic
1148451135 17:47778452-47778474 CTCGGCTTCCTGGGGGCTGCCGG + Intergenic
1148741739 17:49897105-49897127 CCCACCCTCCACGGGGTTCCTGG + Intergenic
1148847540 17:50538172-50538194 CTCTGCCTCCTCACGGCTCATGG - Exonic
1149598976 17:57881118-57881140 CACAGCCTCCCAGGGGCACCTGG + Intronic
1150447649 17:65239714-65239736 CACAGCCTCCTTGGGGGTCAGGG + Intergenic
1150809698 17:68346853-68346875 CTCAGGCTTCTCCGGGCTCCTGG + Intronic
1151161041 17:72166165-72166187 CTGTGCCTCCACGGGCCTCCTGG + Intergenic
1151224875 17:72640589-72640611 CTGGGCCTCCCCGGGGCGCCGGG - Intergenic
1151323472 17:73365253-73365275 CTCACCATCCACGGGGCTGCAGG + Exonic
1151398924 17:73843036-73843058 CTCATCCTCCCCGTGTCTCCTGG - Intergenic
1151460214 17:74249842-74249864 CTCAGCCACTGTGGGGCTCCTGG + Intronic
1151556923 17:74851397-74851419 CTCACCCACCCCGGGGCACCTGG + Intronic
1151564635 17:74891063-74891085 CTCAGCTGCCTCTAGGCTCCTGG + Intronic
1151708383 17:75784910-75784932 CGCAGCTTCCTCGGCGCCCCCGG + Exonic
1151724398 17:75876029-75876051 CTGAGCTCCCTCGGGGGTCCAGG + Exonic
1151736829 17:75947792-75947814 CTCCGCCTCCTGGGTTCTCCTGG + Intronic
1152007142 17:77689619-77689641 CTCAGCCCACTCAGGTCTCCAGG + Intergenic
1152171934 17:78756851-78756873 CTCAGCATCCTTGTGTCTCCTGG - Intronic
1152272337 17:79332027-79332049 TCCAGACTCCTTGGGGCTCCAGG + Intronic
1152576572 17:81143805-81143827 CCCTGCCTGCCCGGGGCTCCAGG + Intronic
1152591852 17:81217485-81217507 CTCAGTCTCATCGGGATTCCTGG - Intronic
1152683803 17:81683924-81683946 CCCCGCCTCCTCGCGGCTCTAGG + Exonic
1152733208 17:81983640-81983662 CTCAGGCCCCTCACGGCTCCGGG - Exonic
1152937666 17:83149938-83149960 CTCACTCTCCACGGGCCTCCTGG + Intergenic
1153308461 18:3654212-3654234 CTCAGCCTCCTCTGAGTCCCTGG - Intronic
1155053550 18:22167359-22167381 CTCGATCTCCTCGGGGCTCAGGG + Intergenic
1158505633 18:58044276-58044298 CCGAGCCTCCTCTGCGCTCCCGG - Intergenic
1160017775 18:75157616-75157638 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1160392037 18:78541173-78541195 CTCAGCCCCCTCGTGCCTCCCGG + Intergenic
1160444320 18:78915311-78915333 CTCAGCCTCCGGGTGGCTGCAGG + Intergenic
1160845239 19:1163401-1163423 CTCAGCTTCCTGTGGCCTCCAGG + Intronic
1160852538 19:1199831-1199853 ATGAGACTCCTGGGGGCTCCAGG + Intronic
1161202882 19:3025632-3025654 CTCAGCCTCTTTGGGGCACCTGG - Intronic
1161404617 19:4084472-4084494 CTCAGCCTCCTGGAGGCCCTGGG - Intergenic
1161998988 19:7731302-7731324 CTCAGCCTCCACGGAGCGCGCGG - Exonic
1162043146 19:7982398-7982420 CTCTGCCTCAGTGGGGCTCCAGG - Intronic
1162067223 19:8133160-8133182 CTCTCCCTCCTCCAGGCTCCAGG + Intronic
1162299391 19:9835584-9835606 CTCAGCTTCCTCAGGCTTCCCGG - Intronic
1162830896 19:13283560-13283582 CTCTGCCTTCTTGGGGTTCCAGG - Intronic
1162846519 19:13396942-13396964 CTCTGCCTCCACTGGGTTCCAGG + Intronic
1163577259 19:18118075-18118097 GTCCGGCTCCGCGGGGCTCCTGG + Intronic
1164435261 19:28223197-28223219 CTCAGCATCCTCAGTCCTCCAGG + Intergenic
1165108454 19:33487791-33487813 CACAGGCTCCTCTGGGCTCTTGG + Intronic
1165463554 19:35958935-35958957 GACTGCCTCCTCTGGGCTCCTGG + Intergenic
1165621438 19:37251883-37251905 CCCAGCGTCCGCCGGGCTCCCGG - Intergenic
1165741387 19:38207129-38207151 CTCGGCCTCTTCTGGGTTCCAGG + Exonic
1166072248 19:40394284-40394306 CTCCTCCTCCTCGGGGCTGGGGG + Exonic
1166077287 19:40421107-40421129 CTCTGCCTCCCCGAGGCTTCTGG + Intergenic
1166304153 19:41928165-41928187 CTCTGCCTCCCCGGGGCTCCGGG - Intronic
1166467005 19:43041228-43041250 CTCATCCTCCACGGGGTTGCTGG + Intronic
1166486808 19:43220853-43220875 CTCATCCTCCGCGGGGTTGCTGG + Intronic
1166493920 19:43284300-43284322 CTCATCCTCCGCGGGGTTGCTGG + Intergenic
1166655937 19:44611888-44611910 ACCAGCCTCCTCATGGCTCCAGG - Intergenic
1166698990 19:44871181-44871203 CTCAGCCTCCTCTAGGCTTTTGG + Intronic
1167679631 19:50911338-50911360 CCCGGCCACCTCTGGGCTCCTGG + Intergenic
1168004618 19:53476736-53476758 CTCCGCCTCCTCCCGCCTCCTGG + Intronic
1168101191 19:54141971-54141993 CTCAGTCTTCTCTGGGTTCCAGG + Exonic
1168280810 19:55304633-55304655 CGCTGCCTTCTCGGGGCCCCAGG + Exonic
1168641778 19:58035448-58035470 CTCAGCATCCTCCAGGGTCCTGG - Intronic
925303083 2:2830699-2830721 CTCAGGCTCTTCAGGGCTCCAGG + Intergenic
926934389 2:18072577-18072599 CTCCCCCTCCTCTGGGCTCCTGG + Intronic
927017765 2:18984142-18984164 CTCAGCCTCCTTGAGACTACAGG - Intergenic
927896518 2:26786224-26786246 CTGCGCCTCCTCGGGGCCTCGGG - Exonic
928066493 2:28169657-28169679 CTCAGCCTCCCAGGGACTACAGG - Intronic
930728960 2:54709479-54709501 CTCAGCCTCCTCTGGGCTTTGGG + Intergenic
932456371 2:71852319-71852341 TTGGGCCTCCTCGGGGCTCCTGG + Intergenic
934525319 2:95048257-95048279 CTGAGCCTGCCCAGGGCTCCTGG + Intronic
935081875 2:99806453-99806475 CTCATCCTCCTCCATGCTCCTGG - Intronic
936154899 2:110041124-110041146 CTCAGCCAGCCCAGGGCTCCAGG - Intergenic
936189783 2:110330290-110330312 CTCAGCCAGCCCAGGGCTCCAGG + Intergenic
937863345 2:126730396-126730418 ACCAGCCTCCTCTGGGCTCCAGG + Intergenic
938088353 2:128416582-128416604 CTCAGCCTGCAGGGGACTCCAGG - Intergenic
938317978 2:130343011-130343033 CTCAGCGGCTCCGGGGCTCCGGG + Intronic
938788957 2:134659818-134659840 TTCAGCCTCCTTGGGACTACAGG - Intronic
941291469 2:163680734-163680756 TGCAGCCTCTTTGGGGCTCCCGG + Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
946710172 2:222497367-222497389 CTCTGCCTCCCCGGGTCTCCTGG + Intronic
947956548 2:234197012-234197034 CTCAGCCTCCCTGGGACTACAGG - Intergenic
948139631 2:235662811-235662833 CTCACCCTGCTCAGTGCTCCTGG + Intronic
948590226 2:239044535-239044557 CTCAGCCTCCCAGGGGCCCTCGG - Intergenic
948797730 2:240413238-240413260 CTCAGCCTCCTCCGGACTTGAGG - Intergenic
948797737 2:240413271-240413293 CTCAGCCTCCTCCGGACTTGGGG - Intergenic
948830188 2:240594837-240594859 ATCACCCTCCTCCCGGCTCCTGG - Intronic
948844542 2:240676853-240676875 CTCAGGGTTCTTGGGGCTCCTGG - Intronic
948849318 2:240698026-240698048 CTCAGGGTTCTTGGGGCTCCTGG + Intronic
1169130286 20:3163289-3163311 CTGAGCCACCTCAGGGCGCCAGG + Exonic
1169144544 20:3243848-3243870 CTCCGCCTCCTCGCTGTTCCTGG + Intergenic
1169219238 20:3811925-3811947 CTCTGCCTCGTGGGGCCTCCTGG + Intergenic
1170554345 20:17503689-17503711 CTCAGCCTCCTCCCTGCTGCAGG + Intronic
1170567356 20:17614672-17614694 TCCTGCCTCCCCGGGGCTCCCGG + Intronic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1170816220 20:19716755-19716777 CTCAGCCTCCTGAGGACTACAGG - Intronic
1171034287 20:21703729-21703751 CACAGTATGCTCGGGGCTCCGGG - Intergenic
1171223409 20:23421110-23421132 CTGGGCGTCCTGGGGGCTCCAGG + Intronic
1171263239 20:23750786-23750808 ATCCTCCTCCTTGGGGCTCCAGG + Exonic
1171266519 20:23776089-23776111 TTCCTCCTCCTCGGGGCTCCAGG + Intergenic
1171272302 20:23826580-23826602 GTCCTCCTCCTGGGGGCTCCAGG + Exonic
1172128279 20:32638517-32638539 CTCAGACTCCTCTGGTGTCCTGG - Intergenic
1172146740 20:32762708-32762730 CCGAGCCTCCCCGGGGCCCCGGG - Intronic
1172875043 20:38158909-38158931 CTCAGGCTTCTCCGGGCCCCGGG + Intronic
1173545415 20:43894035-43894057 CCCAGACTCCTCGTTGCTCCAGG + Intergenic
1174362936 20:50039951-50039973 CTTCTCCTCCTCGGGGCTTCAGG - Intergenic
1174380758 20:50153930-50153952 CTCAGCCCCGGCAGGGCTCCCGG + Intergenic
1174550953 20:51361172-51361194 CTGATCCTCCTGGAGGCTCCAGG + Intergenic
1175487790 20:59357700-59357722 CTCAGCCTTCTTGGGCCACCAGG - Intergenic
1175492772 20:59390229-59390251 CTCTGCCTCCTCCAGCCTCCTGG + Intergenic
1175805962 20:61829682-61829704 GGGAGCCTCCTGGGGGCTCCTGG - Intronic
1175987199 20:62770072-62770094 CTCAGCCTCCTCCCCGCTCCAGG + Intergenic
1175991779 20:62793460-62793482 CTCAGCACCCTCGGGTCTCCTGG + Intergenic
1176217683 20:63956038-63956060 GGCAGGCTCCTCGGGGCTCGGGG - Intronic
1176309941 21:5144289-5144311 CCCAGCTTGCTCTGGGCTCCAGG + Intronic
1176549773 21:8216124-8216146 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176557664 21:8260353-8260375 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176568698 21:8399158-8399180 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1176576612 21:8443393-8443415 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1178453605 21:32727569-32727591 CTGGGGCTCCTCGGGGGTCCCGG + Intronic
1178562406 21:33651142-33651164 CTCAGAGCCCTCGGGCCTCCAGG - Intronic
1178680835 21:34670596-34670618 CTCAGGCTCCGCGGCGCCCCTGG - Exonic
1178686062 21:34711602-34711624 CTGAGGCTCCTGTGGGCTCCCGG + Intronic
1178804999 21:35831783-35831805 CACAGCCTCCCCGGGGACCCGGG - Intronic
1179129503 21:38622010-38622032 CTCAGGCTCCTGCAGGCTCCTGG - Intronic
1179847115 21:44117743-44117765 CCCAGCTTGCTCTGGGCTCCAGG - Intronic
1179973012 21:44846782-44846804 CTCTGCCTCCCCAGGGCTCTTGG - Intergenic
1181074869 22:20368800-20368822 CTCAGCCTCCTTGGGATTACAGG - Intronic
1181349590 22:22245402-22245424 CTCAGCCTCCTCGGCGCTTCGGG - Exonic
1182677367 22:32050147-32050169 CTCATGCTCATCGGGTCTCCTGG + Intronic
1183073552 22:35412528-35412550 CTCCTCCTCCTGGGGGCTCACGG - Exonic
1183484698 22:38082617-38082639 CTCCGCCTCCCCGGGACCCCTGG - Intronic
1184379189 22:44134420-44134442 CTGAGCCTGCACAGGGCTCCTGG - Intronic
1184416206 22:44353132-44353154 AGCTCCCTCCTCGGGGCTCCTGG - Intergenic
1184446395 22:44549849-44549871 CTGAGCCTGCTGGGGGCCCCAGG - Intergenic
1184654270 22:45933277-45933299 ATCAGCCTCCTCTGAGCTGCAGG + Intronic
1184699891 22:46163710-46163732 CACATCCTGCCCGGGGCTCCTGG + Intronic
1185239584 22:49735412-49735434 GTCGGCCTCCTCGGGGTTCTGGG + Intergenic
1185344081 22:50303904-50303926 CTCAGCCCCCTAAGGTCTCCTGG - Intronic
1185382734 22:50517633-50517655 CTCTGCCTCCTGGGGGACCCCGG - Exonic
1203254662 22_KI270733v1_random:132450-132472 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1203262718 22_KI270733v1_random:177529-177551 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
950140106 3:10609426-10609448 CCAAGCCTCCTCGGCGCGCCTGG + Intronic
951264770 3:20552676-20552698 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
951576567 3:24120614-24120636 CTTAGCCACCTCTGTGCTCCAGG - Exonic
952088400 3:29854149-29854171 CCCAGCCTCCTCCCAGCTCCAGG + Intronic
952753716 3:36847427-36847449 CTAAGCCTCATCGGGGGACCAGG + Intronic
955996748 3:64686686-64686708 GTCACCCTCCTCGGGACGCCCGG - Exonic
957350587 3:79018687-79018709 CTGAGCCTCCTCGGAAATCCTGG - Intronic
959087011 3:101862230-101862252 CTCAGGCTCGTAGGGGCTTCAGG + Intergenic
960333804 3:116392479-116392501 CTCAGCCTCCTCTGGACTTAGGG + Intronic
960989448 3:123301290-123301312 CTCAGCCTCCTCAGGCCTTCTGG + Intronic
961487523 3:127227293-127227315 CTCCTCCTCCTCGCAGCTCCAGG + Intergenic
961529692 3:127533004-127533026 CTCAGGCTACTGGGGGCTGCAGG - Intergenic
961825780 3:129598343-129598365 CTCACCATTCTGGGGGCTCCTGG + Intronic
962121064 3:132560534-132560556 CTCAGCCTCCCTGGGACTACAGG + Intronic
962263388 3:133928718-133928740 CTCAGCCTAGTCCCGGCTCCTGG - Exonic
962432825 3:135335815-135335837 CTAAGCCACATCTGGGCTCCAGG + Intergenic
962866452 3:139451563-139451585 CTCCGCCTCCTCCGTTCTCCCGG + Intergenic
962956767 3:140274019-140274041 CTCAGCCTCCTCCCGGCTCCAGG + Intronic
963006125 3:140727602-140727624 CACATCCTCCTATGGGCTCCTGG + Intergenic
963068757 3:141284990-141285012 CTAAGCACCCTCTGGGCTCCAGG + Intronic
966113555 3:176432926-176432948 CTCTGCCACTTAGGGGCTCCTGG - Intergenic
966846571 3:184135221-184135243 CTCAGACCCCTGTGGGCTCCCGG + Intronic
966982603 3:185152527-185152549 CTCTGCGGCCGCGGGGCTCCGGG - Intronic
967894106 3:194383101-194383123 CTCTGCTTCCCCGGGGCCCCTGG - Intergenic
968073258 3:195801426-195801448 CGCACCCTCCCCGGGGCCCCGGG + Intronic
968549596 4:1215249-1215271 CTCATCCTCCTTGTGGCTACAGG + Intronic
968610254 4:1553837-1553859 CGCACCCACCACGGGGCTCCTGG + Intergenic
968613969 4:1569089-1569111 CACAGCCCCCATGGGGCTCCTGG - Intergenic
968630760 4:1649793-1649815 CTGAGCCACCTCAGGGGTCCCGG - Intronic
968904764 4:3446094-3446116 GCCAGCCTCCCCGGGGCGCCAGG + Exonic
968950220 4:3687653-3687675 CTTGGCCTCCTAGGGCCTCCTGG - Intergenic
969114038 4:4860300-4860322 CTCGGGCTTCTCGGGGCTCTCGG - Exonic
969350269 4:6594313-6594335 CTCAGCCTCCCTGAGGCTGCAGG - Intronic
969778913 4:9381085-9381107 CTCAGCCTCTGCGGGGCTCTGGG + Intergenic
972478999 4:39480220-39480242 CTCAGCCTCCTCAGTGCCACAGG - Intergenic
973620618 4:52722239-52722261 CCCAGCCACCTCCTGGCTCCAGG + Intergenic
973959043 4:56091167-56091189 CTCAGCCTCCTCAGGACTATAGG + Intergenic
974686875 4:65242321-65242343 CTCAGCCCCCTCTGGACTTCGGG - Intergenic
975661098 4:76689652-76689674 CCCGGGCTGCTCGGGGCTCCAGG - Intronic
976989399 4:91346138-91346160 CTCAGCCTCCTTGGGACTACAGG + Intronic
977263132 4:94822355-94822377 CTCTGCCTTCTAGGGGCTCATGG - Intronic
977743502 4:100516386-100516408 CTTAGCCTGCTCGCTGCTCCAGG - Intronic
982021796 4:151212268-151212290 CTCAGCCTCCCTGGGACTACAGG + Intronic
982055076 4:151540807-151540829 CCCAGACTTCTCAGGGCTCCAGG + Intronic
982128247 4:152203149-152203171 CTCAGCCTCCCAGGGGTTACAGG - Intergenic
983635221 4:169891319-169891341 CTCAGACTACTCTGGGCACCCGG - Intergenic
985575169 5:670510-670532 CCCAGCCTCCTCAGGTCTCAGGG - Intronic
985645716 5:1083856-1083878 CTCAGCCACCTCCGCGCTCTGGG - Exonic
986145227 5:5071549-5071571 GTGGGCCTCCTGGGGGCTCCTGG + Intergenic
986858923 5:11904129-11904151 TGCGGGCTCCTCGGGGCTCCGGG + Intergenic
987586297 5:19861361-19861383 CCTAGCCTCCTCCCGGCTCCTGG - Intronic
988086746 5:26484022-26484044 CTCAGCGTCCTGGGCTCTCCTGG - Intergenic
990149506 5:52800444-52800466 CTCAGGCTCCTCGGGGACCAGGG - Exonic
991020406 5:61974074-61974096 TGCAGCCTCCTAGAGGCTCCTGG - Intergenic
992186715 5:74251394-74251416 CTCAGTCTCCTCTGGGCTGTGGG - Intergenic
994351411 5:98750631-98750653 CTCAGCCTCCTGGGGACTACAGG - Intergenic
994759012 5:103830115-103830137 CTCAGTCTCCTCTGGGTGCCAGG + Intergenic
995725970 5:115180364-115180386 CCCCGCCTCCTCGGGGGTCGCGG + Intronic
998480587 5:142459481-142459503 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
1000851102 5:166341151-166341173 CTCAGCCTCCCTGGGACTACAGG - Intergenic
1000924597 5:167178423-167178445 CTCATCCTGGTCGGGGCTCTTGG + Intergenic
1001264415 5:170262532-170262554 CCGAGGCTCCTCGGTGCTCCCGG - Intronic
1001309750 5:170602383-170602405 CTCTTCCTCCTGAGGGCTCCAGG - Intronic
1001382228 5:171312289-171312311 CGCATCCTCCTCGGGGGCCCGGG - Intergenic
1001434065 5:171685844-171685866 CTCAGCCTCCTCTGAGCTCAGGG - Intergenic
1002066379 5:176654116-176654138 CTCAGCCTCCACCTGCCTCCTGG - Intronic
1002414295 5:179111299-179111321 GTCTGCCTCCTCTGGGCGCCAGG + Exonic
1002451691 5:179322549-179322571 CACGGCCTCCTCGCGTCTCCCGG - Intronic
1002709430 5:181185707-181185729 CTCAGCCCCCGAGGCGCTCCTGG - Intergenic
1002823947 6:755739-755761 CTCTGCCTACTTGGGGCTACAGG + Intergenic
1003065830 6:2903071-2903093 CACCGCCTCCCCGGGGCTCTTGG + Intronic
1003086342 6:3064167-3064189 CACCGCCTCCCCGGGGCTCTTGG - Intronic
1004623498 6:17352541-17352563 CTCAGCCTCCCTGGGACTGCAGG + Intergenic
1005781881 6:29201367-29201389 CTCAGCCCCCTCTGGGCTTTGGG + Intergenic
1006122940 6:31818283-31818305 CTCAGCCTCCCTGGGACTACAGG - Intergenic
1006399346 6:33807424-33807446 CTCACACTCCTCTGGGCTGCAGG + Intergenic
1006519993 6:34565780-34565802 CTCCTCCTGCTCTGGGCTCCAGG + Intergenic
1007174875 6:39888822-39888844 CGCAGCCTCCTGGGGGCTGTTGG - Intronic
1009588573 6:65637766-65637788 CTCAGCCTCCTCCAGACTTCGGG + Intronic
1011601929 6:89067639-89067661 CTCAGCCTCCTGAGGACTGCAGG + Intergenic
1013272687 6:108558636-108558658 CCCAGCCGCCTCCGGGCTCCGGG - Intergenic
1013354083 6:109332215-109332237 CTCAGCCTTCTCTGGGCTCTCGG - Intergenic
1013908934 6:115250769-115250791 GTTAGGCTGCTCGGGGCTCCAGG - Intergenic
1014079543 6:117270883-117270905 GCCAGCCGCCTCGGGGCGCCCGG + Exonic
1014674546 6:124348259-124348281 CTCAGGCTGCTCGGGGGTCAGGG + Intronic
1016977756 6:149825770-149825792 CTCAGCCTCCCTGGGACTACAGG + Intronic
1017258972 6:152365129-152365151 CTCAGCCGACTGGGAGCTCCAGG - Intronic
1018124179 6:160665956-160665978 CTCACCCTCCTGGGGTGTCCCGG - Intergenic
1019191112 6:170251529-170251551 CCCAACGTCCACGGGGCTCCAGG + Intergenic
1019340681 7:507474-507496 CCCAGCCTCCTCAGGGGGCCGGG + Intronic
1019610033 7:1931849-1931871 CTCAGCCTTCTAGGTGCTCATGG + Intronic
1019707802 7:2504826-2504848 CCCGGCCTCCTGGGGGCTGCGGG + Intergenic
1020622410 7:10533913-10533935 CTCAGCCTACTCGGGGGTCAGGG - Intergenic
1022714925 7:32891210-32891232 CTCGGCGCCCGCGGGGCTCCCGG - Intronic
1022782688 7:33602172-33602194 CTCAGCCTCTTCATGGCTCTTGG - Intronic
1023302012 7:38783041-38783063 CTCTGCCTCCTGGGTGCTCGCGG - Intronic
1023991233 7:45130039-45130061 CTCACACCTCTCGGGGCTCCAGG + Intergenic
1024919845 7:54545171-54545193 CTCTCCCTTCTCGGGGCACCAGG + Intronic
1025263385 7:57437703-57437725 CAGCGCCTCCTCGGAGCTCCTGG + Intergenic
1025547775 7:62198830-62198852 CTCAGTCTACTCGGGGGTCAGGG + Intergenic
1027116554 7:75486048-75486070 ATCCGCCTCCCTGGGGCTCCCGG + Exonic
1029439182 7:100577843-100577865 CTCTGGGTCCCCGGGGCTCCCGG + Exonic
1029607310 7:101606663-101606685 CTGAGCCTCCTGGAGGCTTCAGG - Intergenic
1029735846 7:102465324-102465346 ATGAGGCCCCTCGGGGCTCCCGG - Intronic
1032087211 7:128890665-128890687 CTCAGCCTCCACGGAGCCCACGG - Intronic
1032530459 7:132615463-132615485 CTCAGCGTCCCTGGGGCTCTGGG + Intronic
1034917590 7:155053696-155053718 CTCGGCCTCCCCGGGGCTCAGGG + Intergenic
1034965138 7:155386185-155386207 CCCAGCCTCCTCCCAGCTCCAGG + Intronic
1035629909 8:1099121-1099143 CTCAGCCTCGCCGGTGTTCCTGG + Intergenic
1035729851 8:1846151-1846173 CTCAGCCCCTCCGCGGCTCCCGG - Intronic
1036204396 8:6794482-6794504 TTCAGCCTCTGCGGGGCTGCTGG - Intergenic
1036276358 8:7355046-7355068 CTCAGCCTCTGCGGGGCTCTGGG + Intergenic
1036344986 8:7955301-7955323 CTCAGCCTCTGCGGGGCTCTGGG - Intergenic
1036794949 8:11749100-11749122 CGCAGCCTCCTCTGGGCACCTGG + Intronic
1036840323 8:12116068-12116090 CTCAGCCTCTGCGTGGCTCTGGG - Intergenic
1036862114 8:12362305-12362327 CTCAGCCTCTGCGTGGCTCTGGG - Intergenic
1037281552 8:17247227-17247249 CTCATCCTCCTCGGGTCCACGGG - Exonic
1037305143 8:17496999-17497021 CACCGCCTCCTCCGCGCTCCCGG - Intergenic
1037614402 8:20504564-20504586 CTCAGCCTCCTGAGGACTACAGG + Intergenic
1037865823 8:22441381-22441403 CTCGGCCTCCTCCAGGCTCCAGG - Exonic
1038266964 8:26045325-26045347 CACCGCCTCCTCTCGGCTCCAGG - Exonic
1038297584 8:26309737-26309759 CTCTCCCTCCTTGGGCCTCCTGG - Intronic
1042224685 8:66505905-66505927 CTCAGCCTCCCTGGGACTACAGG + Intronic
1042378314 8:68081505-68081527 TGCAGTCTCCACGGGGCTCCAGG - Intronic
1042785012 8:72537110-72537132 CTCTTCCTCCTCAGCGCTCCCGG - Intergenic
1043708095 8:83378418-83378440 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
1043952926 8:86329382-86329404 CTCAGCCTCCTGGGCTCTCAAGG - Intergenic
1044430469 8:92102091-92102113 CTCAGCCGCCCCGGCCCTCCTGG - Intronic
1044727146 8:95203113-95203135 CTCTGCCTCCTAGGGGCCCTGGG + Intergenic
1044967225 8:97585294-97585316 CACAGCCTCCCCTGGGTTCCAGG - Intergenic
1046802399 8:118442937-118442959 CTCAGCCTCAGCTGGGCTTCAGG + Intronic
1047104720 8:121720083-121720105 CTCAGCCCCCTCTGGGCTTTTGG - Intergenic
1048303184 8:133266183-133266205 ATCAGCCTCCGCGGGGCCCCAGG + Intronic
1049030335 8:140031833-140031855 CTCAGCCACCACGGGACTCCTGG - Intronic
1049218555 8:141418571-141418593 CTCAGCCTCCTCGGGCCAGCAGG - Intronic
1049245747 8:141561378-141561400 AGGAGCCTCCTCGGGGCACCTGG - Intergenic
1049367641 8:142248422-142248444 CTCAGCACCCACGGGGCTCCTGG + Intronic
1049699622 8:144004192-144004214 CTCAGCCTCCTGAGGACTACAGG - Intronic
1052739787 9:32382383-32382405 CTTAGCCTCATCTTGGCTCCCGG - Intergenic
1053483909 9:38437739-38437761 TTCAGGCTCCTCTGGGCTCTTGG - Intergenic
1055308572 9:74954569-74954591 CTCAGCCTCCCTGGGACTACAGG - Intergenic
1055309894 9:74967706-74967728 CTCAGCCTGGTCTCGGCTCCTGG + Intergenic
1056654933 9:88501439-88501461 CTCAGCCTCCCTGGGACTACAGG - Intergenic
1057128537 9:92637893-92637915 CACAGCCTCCTGGGGGCTCTGGG - Intronic
1057548069 9:96032683-96032705 CTCTGCCAGCTCCGGGCTCCTGG - Intergenic
1060343979 9:122800812-122800834 CTCAGCCTCTGGGAGGCTCCGGG + Exonic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1061029491 9:128071522-128071544 CTCAGCCTCCCTGGGACTACAGG + Intronic
1061329043 9:129880830-129880852 CTCCGAGTCTTCGGGGCTCCGGG - Exonic
1061385169 9:130285355-130285377 CCCAGCTTCCTCGGGACCCCCGG - Intronic
1061391952 9:130321645-130321667 CTCAGCCTTCTCTGAGCCCCCGG + Intronic
1061500307 9:130998050-130998072 CTCAGCCTCCATGGGGCGGCCGG - Intergenic
1062022491 9:134326142-134326164 CGCCGCCTCCTCGCGGCTCCCGG + Intronic
1062115286 9:134805306-134805328 CCCAGGCTCCTCGGGGGTCTGGG - Intronic
1062200920 9:135302165-135302187 CTCACCCTCCTGGGGGCTCAGGG + Intergenic
1062540784 9:137040832-137040854 CTTGCCCTCCCCGGGGCTCCAGG + Exonic
1062731125 9:138109935-138109957 CTCAGCCTCCCAGGGACTACAGG - Intronic
1203471063 Un_GL000220v1:115595-115617 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1203478884 Un_GL000220v1:159567-159589 CGTAGCGTCCGCGGGGCTCCGGG - Intergenic
1185504171 X:619580-619602 CCCAGGCTCCTGGGCGCTCCTGG - Intergenic
1185599514 X:1329358-1329380 TCCCGCCTCCTGGGGGCTCCAGG - Intergenic
1185621966 X:1455480-1455502 CTCCCGCTCCTGGGGGCTCCAGG + Intergenic
1185888203 X:3801832-3801854 CTCCAGCTCCTGGGGGCTCCCGG - Intergenic
1186223712 X:7375566-7375588 CTCAGCCCCCTCTGGGCTTTAGG - Intergenic
1189369589 X:40417135-40417157 CTCAGGCACCCTGGGGCTCCTGG + Intergenic
1189391137 X:40577792-40577814 CTTCGCCTCCACAGGGCTCCTGG + Intergenic
1189996857 X:46647218-46647240 CTTCGCCTCCTTGTGGCTCCCGG + Intronic
1190596879 X:52060218-52060240 CACGGCCTCCTCAGGCCTCCAGG - Intergenic
1190611945 X:52193855-52193877 CACGGCCTCCTCAGGCCTCCAGG + Intergenic
1192204178 X:69085376-69085398 CTCAGCATCCTCCTGCCTCCAGG - Intergenic
1192795246 X:74420734-74420756 CTGAGGCTCCTCCGGGCTCCAGG + Intergenic
1195259029 X:103115064-103115086 CTCTGCATCCTCTGGGCTACTGG + Intergenic
1196801966 X:119552015-119552037 CTCAGCCTCCTGAGGACTACAGG + Intronic
1198395876 X:136218815-136218837 CTCAGACTCCTCTGAGCTCCTGG - Intronic
1199992571 X:152995782-152995804 CTCAGTCACCTCTGGGCTACTGG + Intergenic
1200180021 X:154144401-154144423 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200185849 X:154182795-154182817 CCCAGCCTCCACGGGCCTGCTGG - Intergenic
1200191501 X:154219933-154219955 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200197256 X:154257737-154257759 CCCAGCCTCCACGGGCCTGCTGG - Intronic
1200209733 X:154341923-154341945 CTCAGGCTCCTAGGCGTTCCCGG - Intergenic
1200221119 X:154390169-154390191 CTCAGGCTCCTAGGCGTTCCCGG + Intronic
1200751935 Y:6954102-6954124 CTCAGGCTACTCGGGGGTCAGGG + Intronic
1200883586 Y:8245825-8245847 CTCTGCCTGCTAGGGTCTCCGGG + Intergenic
1201589662 Y:15601222-15601244 CTCAGCCTCCTCTGCCCTCCAGG + Intergenic
1201593218 Y:15637813-15637835 CTCAGCCCCCTCTGGGCTTTAGG - Intergenic