ID: 1133056316

View in Genome Browser
Species Human (GRCh38)
Location 16:3147248-3147270
Sequence CCCACCCCAGGCTTTCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 366}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133056312_1133056316 -10 Left 1133056312 16:3147235-3147257 CCTCAACATTGTTCCCACCCCAG 0: 1
1: 0
2: 2
3: 27
4: 317
Right 1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG 0: 1
1: 0
2: 7
3: 50
4: 366
1133056311_1133056316 -5 Left 1133056311 16:3147230-3147252 CCAGGCCTCAACATTGTTCCCAC 0: 1
1: 0
2: 3
3: 31
4: 203
Right 1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG 0: 1
1: 0
2: 7
3: 50
4: 366
1133056310_1133056316 -4 Left 1133056310 16:3147229-3147251 CCCAGGCCTCAACATTGTTCCCA 0: 1
1: 0
2: 0
3: 13
4: 190
Right 1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG 0: 1
1: 0
2: 7
3: 50
4: 366
1133056307_1133056316 24 Left 1133056307 16:3147201-3147223 CCAGTGGCTGGGGAGGCGGTGGC 0: 1
1: 1
2: 9
3: 121
4: 2234
Right 1133056316 16:3147248-3147270 CCCACCCCAGGCTTTCCAGGAGG 0: 1
1: 0
2: 7
3: 50
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133056316 Original CRISPR CCCACCCCAGGCTTTCCAGG AGG Exonic