ID: 1133056582

View in Genome Browser
Species Human (GRCh38)
Location 16:3148388-3148410
Sequence AGCCGCAGAGGGTAAGGAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 284}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133056572_1133056582 23 Left 1133056572 16:3148342-3148364 CCCCTCCAGGGAGCTCTGACCAA 0: 1
1: 0
2: 0
3: 15
4: 220
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284
1133056577_1133056582 4 Left 1133056577 16:3148361-3148383 CCAAGCAGACATCCTGACGGTCT 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284
1133056578_1133056582 -8 Left 1133056578 16:3148373-3148395 CCTGACGGTCTACTCAGCCGCAG 0: 1
1: 0
2: 0
3: 2
4: 30
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284
1133056575_1133056582 18 Left 1133056575 16:3148347-3148369 CCAGGGAGCTCTGACCAAGCAGA 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284
1133056574_1133056582 21 Left 1133056574 16:3148344-3148366 CCTCCAGGGAGCTCTGACCAAGC 0: 1
1: 0
2: 2
3: 24
4: 221
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284
1133056573_1133056582 22 Left 1133056573 16:3148343-3148365 CCCTCCAGGGAGCTCTGACCAAG 0: 1
1: 0
2: 1
3: 21
4: 293
Right 1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG 0: 1
1: 0
2: 2
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133056582 Original CRISPR AGCCGCAGAGGGTAAGGAGA TGG Exonic
900475270 1:2873489-2873511 AGCCTCAGAGGGCAAGTGGAAGG - Intergenic
900529594 1:3146194-3146216 ACCCTCCGAGGGTAAGGAGTTGG - Intronic
900662008 1:3789482-3789504 AGCAGCAGAGGCGAAGGAGGCGG + Intronic
900912972 1:5615201-5615223 AGCCCCAGAGGGTAGAGACAGGG + Intergenic
901127400 1:6939173-6939195 AGCGTCAGAGGTCAAGGAGATGG + Intronic
901727802 1:11255980-11256002 AGTGGTACAGGGTAAGGAGATGG - Exonic
902394983 1:16127677-16127699 AGAGGCAGAGGGGAAGGAGGAGG + Intronic
903849860 1:26299584-26299606 AGAAGCAGAGGGTAATGGGAGGG + Intronic
906068054 1:42996375-42996397 AGCCTGAGAAGGTAAGGAGAGGG + Intergenic
907016973 1:51025388-51025410 AGTCTCAGAAGGAAAGGAGAGGG + Intergenic
907373059 1:54015458-54015480 AGCTGCAGAGGGCAAGGACCAGG - Intronic
909793182 1:79701053-79701075 TGCCACTGAGGGGAAGGAGAAGG + Intergenic
910175947 1:84430325-84430347 AGGCAGAGAGGGTAAGGAGTTGG + Intergenic
912079576 1:105918446-105918468 AGACCCAGAGGGAAAAGAGAGGG + Intergenic
913054722 1:115147772-115147794 AGACTCAGAGGGTAAGGGGGTGG + Intergenic
914813810 1:151048427-151048449 AGCCGCAGATCCTCAGGAGATGG - Exonic
915571828 1:156749057-156749079 GGCGGAAGAGGGAAAGGAGAAGG + Intronic
915845460 1:159259412-159259434 AGCCGCAGGAAGTAAGGTGAAGG - Intergenic
915950781 1:160188661-160188683 AGCCAGAGAGGGCAACGAGAGGG + Intergenic
917372120 1:174305117-174305139 AGCAGAAGAGGGTAAGAAGTTGG + Exonic
917722115 1:177795881-177795903 GGCCGCAGTGGGTAAGGGGTGGG - Intergenic
918071997 1:181139903-181139925 AGCCGCACAGGGGCAGGAAAGGG + Intergenic
920089394 1:203441525-203441547 AGCCACAGAGGCTAAGGTGAAGG + Intergenic
920649573 1:207826699-207826721 AGCCTCTGAGGGTGAGTAGAAGG - Intergenic
923498587 1:234545683-234545705 AGCAGCACAGAGAAAGGAGAGGG + Intergenic
923740632 1:236651709-236651731 AGAAGCAGAGGACAAGGAGATGG - Intergenic
1063882191 10:10542592-10542614 AGCCGCACAGGCTAACTAGAGGG + Intergenic
1064461963 10:15543911-15543933 AGACACAGAGGGAAAGGTGATGG + Intronic
1065758515 10:28958841-28958863 GGCTGCAGAAGGTAGGGAGAAGG + Intergenic
1067026286 10:42846669-42846691 AGACGGAGAGGGAAGGGAGAGGG - Intergenic
1071163196 10:82776528-82776550 AGTTTCAGAGGGTAAAGAGATGG - Intronic
1075901279 10:126044406-126044428 AGCTGCAGAGGACAAGGAGGAGG + Intronic
1076468625 10:130703030-130703052 GGCCTCAGAGGGGAATGAGATGG + Intergenic
1076809937 10:132881275-132881297 ATCTGCAAAGGGTGAGGAGACGG - Intronic
1077724433 11:4660215-4660237 TGCAGCATAGGGTAAGAAGAGGG - Intergenic
1078039780 11:7849245-7849267 AGCAGGAGAGGGCCAGGAGAGGG - Intergenic
1078733922 11:14002490-14002512 ATCTGCAGAGGGAAAGGACAGGG + Intronic
1079233462 11:18669994-18670016 AGCTGTAGAGGGCAGGGAGAGGG - Intergenic
1083593490 11:63908411-63908433 GGCCCCAGAGGGTAGGGACAGGG - Intronic
1083758500 11:64803600-64803622 ATCTGCAGAGGGTTAGGAGTGGG - Exonic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084270148 11:68024933-68024955 AGCACCAGAGGGGAAGGAGGTGG - Intronic
1084325082 11:68395639-68395661 GGCCACAGAGGGTAAAGAAAGGG - Intronic
1084633465 11:70373064-70373086 AGCTGCTTAGGGTAAGGAAAAGG + Intronic
1085790533 11:79493713-79493735 AGCCCAAGAGACTAAGGAGAGGG - Intergenic
1089500664 11:118929580-118929602 AGCCGCGGAGGGGGAGGAGGGGG - Intronic
1089735893 11:120550094-120550116 GGCGGCAGAGGGTCAGGAGTGGG + Intronic
1090207197 11:124891887-124891909 AGCAGAAGAGGGCAAGGAGATGG + Intronic
1090441776 11:126730374-126730396 AGACGTATAGGGTGAGGAGAGGG - Intronic
1092091708 12:5809111-5809133 AGGAGCAGAGGGTGGGGAGAGGG + Intronic
1092947344 12:13469018-13469040 AGCAGCAGAGGGGACAGAGATGG + Intergenic
1093016541 12:14161142-14161164 AGGAGAAGAGGGTCAGGAGAGGG + Intergenic
1094083808 12:26566377-26566399 AGAGGCAGAGGGAGAGGAGAAGG + Intronic
1094199222 12:27780108-27780130 TGGCGCTGAGGGAAAGGAGAAGG + Exonic
1095491480 12:42739159-42739181 AGCTGCAGAGCACAAGGAGATGG - Intergenic
1096581718 12:52590056-52590078 TGCAGGGGAGGGTAAGGAGATGG + Intronic
1096829702 12:54304570-54304592 AGCCACAGGGGGCAAGGGGAGGG + Intronic
1097032224 12:56097947-56097969 AGACACAAAGGGTAAGGAGGCGG + Intronic
1099055942 12:77840810-77840832 AGACTCAGAGAGTAAGGACAGGG - Intronic
1099063627 12:77945204-77945226 AGCAGTAGAGGGAAAGGAAAGGG + Intronic
1099641649 12:85296336-85296358 AGCAGTAGAGAGGAAGGAGAAGG - Intronic
1100451268 12:94708990-94709012 AGACACAGAGAGCAAGGAGAGGG + Intergenic
1101499774 12:105292193-105292215 GGCTGCAGAGGGTAGGGAGGAGG + Intronic
1101881504 12:108629075-108629097 AGACTCAGAGGGTATGGAGATGG + Intronic
1101902873 12:108804305-108804327 AGCCGCTGAGGCTGAGGAGTGGG + Intronic
1102598667 12:114012664-114012686 AGGAGGAGAGGGGAAGGAGAGGG + Intergenic
1103610607 12:122122002-122122024 TCCCACAGAGGGTGAGGAGAGGG + Intronic
1103781577 12:123402308-123402330 GGCCGCAGTGGGAATGGAGATGG + Intronic
1103826687 12:123744752-123744774 ACCCGCAGAGCATAAGAAGATGG + Exonic
1103930061 12:124445309-124445331 AGCCGCAGAGGGGCAGGAGATGG - Intronic
1104351853 12:128050949-128050971 AGGCGCAGGGGGAAAGGATATGG + Intergenic
1104613035 12:130245134-130245156 AGCCGCAGAAGGTCAAGTGAAGG - Intergenic
1104946897 12:132419086-132419108 GGCTGCAGAGGGTATGGAGGAGG - Intergenic
1108261159 13:48658209-48658231 AGCCACAGAGGGTACCCAGATGG - Intronic
1110418680 13:75279958-75279980 TGAGGCAGAGGGTAAGGAGTAGG + Intergenic
1110778918 13:79441739-79441761 AGAGGCAGAGGGCAAGGAGTAGG + Intergenic
1112256235 13:97834028-97834050 ATCCTCAGAGGCTCAGGAGAAGG + Intergenic
1112414372 13:99192108-99192130 AGGGGTAGAGGGGAAGGAGAAGG + Intergenic
1113725752 13:112599922-112599944 AGCTGCAGGGGGTGGGGAGATGG - Intergenic
1113850375 13:113414346-113414368 ATCCGCAGAGGGGCAGGAAATGG - Intergenic
1113899341 13:113788023-113788045 TGCCGCAGAGGGGAAGGCGGAGG + Intronic
1114317666 14:21523252-21523274 AGCCACAGCTGGGAAGGAGATGG - Exonic
1115211008 14:30967208-30967230 AGACACAGAGGGGAAAGAGAGGG + Intronic
1115475499 14:33809427-33809449 AGGAGCAGAGAGTAAGGAGGTGG + Intergenic
1118141752 14:63091648-63091670 AGCAGCAGAGAGAGAGGAGAGGG + Intronic
1118560315 14:67072515-67072537 AGCAGCAGAGGGTAAGTATCAGG + Intronic
1118748613 14:68791304-68791326 AGCTGCAGATGGAAAGGAAAAGG + Intronic
1120411545 14:84163396-84163418 AGCAGTAGAGGTTAAGAAGAAGG - Intergenic
1121226064 14:92322927-92322949 AGCCTCAGAGGGTAAAGGAAGGG + Intronic
1121231875 14:92364386-92364408 AGCCACAGAGGGAAGGGAGGTGG + Intronic
1121594824 14:95153859-95153881 AGCCCCACAGGCTAAGGAGGTGG + Intronic
1122405532 14:101498639-101498661 AGCTGGAGAAGGCAAGGAGATGG - Intergenic
1122774942 14:104112968-104112990 AGGCGCAGGAGGTAAGGAGATGG - Exonic
1125603963 15:40929750-40929772 CGCGGCAGAGGGGACGGAGAGGG - Intronic
1126102758 15:45129694-45129716 AGGCGGAGAGGGTATGGGGAGGG - Intronic
1131002461 15:88949756-88949778 ACTTGCAGAGGGTAAGAAGAAGG - Intergenic
1131559996 15:93431248-93431270 ACCCGCAGAGGGTGGGGAGGGGG - Intergenic
1133056582 16:3148388-3148410 AGCCGCAGAGGGTAAGGAGATGG + Exonic
1136174167 16:28506151-28506173 AGCTGCAGAGGGTAAGGAGGGGG - Intronic
1136233851 16:28903009-28903031 GGCTGCAGAGGGGAAGGGGAGGG - Exonic
1137539164 16:49350189-49350211 AGAGGGAGAGGGGAAGGAGAGGG - Intergenic
1137561138 16:49503148-49503170 AGCCGCACAGGGTAGACAGAAGG - Intronic
1137729645 16:50680300-50680322 TGCTACAGAGGGTGAGGAGAGGG - Intronic
1137944959 16:52725060-52725082 AGCCGCAGAGGGAAGGAAGGAGG + Intergenic
1138161086 16:54755357-54755379 AGAGGAAGAGGGTAAGGATAGGG + Intergenic
1138580330 16:57936948-57936970 ATCGGCAGAGGAAAAGGAGATGG + Intronic
1141151905 16:81570222-81570244 AGCCACAGAGGGGGTGGAGAAGG + Intronic
1141471766 16:84243517-84243539 AGCTGGAGAGGGTACGGAAACGG - Intergenic
1141574874 16:84957443-84957465 AGACTCAGAGGATAGGGAGAGGG - Intergenic
1141848822 16:86630212-86630234 AGCATCAGAGGCTAAGGAGGAGG + Intergenic
1142496855 17:310532-310554 ATCCGCAGAAGGTGAGGAGGCGG + Intronic
1142697228 17:1640250-1640272 AGCCTCAGAGGGGAGGGAGCTGG + Intronic
1143769787 17:9161300-9161322 AGCCCCAGAGGGGCAGGCGAGGG + Intronic
1145259936 17:21348764-21348786 GGCCCCAGAGGGGAAGGAGAAGG - Intergenic
1145312418 17:21707889-21707911 TGCAGCAGAGGGTCAGGAGCAGG - Intergenic
1145316680 17:21739174-21739196 GGCCCCAGATGGGAAGGAGAAGG + Intergenic
1145911540 17:28546237-28546259 GGCAGCTGAGGGCAAGGAGATGG + Intronic
1148256391 17:46136425-46136447 AGCAGAAGAGGGTAACGATATGG - Intronic
1149458458 17:56808502-56808524 AGGCCCAGAGGGGATGGAGAGGG - Intronic
1149594134 17:57853843-57853865 AGAAGCAGAGGGCAAGGAGCTGG - Intergenic
1149776773 17:59364461-59364483 AGACGCAGGGGGGAAGTAGAAGG - Intronic
1149985057 17:61340972-61340994 AGTGGCAGAGGGGATGGAGAAGG + Intronic
1150143592 17:62750262-62750284 AGCCGGAGTGGGGCAGGAGATGG + Intronic
1152078866 17:78174418-78174440 AGCCGCAGAGGGGAAGAAGCAGG + Exonic
1152554494 17:81046118-81046140 AGCTGCAGGGGGTAAGGAGGAGG + Intronic
1153535972 18:6101601-6101623 AGCTGGAGAGGGTAAGGATTGGG - Intronic
1154380902 18:13848971-13848993 AGCCACAGAGGGCGTGGAGAGGG - Intergenic
1154385668 18:13889722-13889744 AGGCTCCAAGGGTAAGGAGAAGG + Intronic
1154970864 18:21407958-21407980 GGCTGCAAAGGGTGAGGAGATGG + Intronic
1155697216 18:28697806-28697828 TGCCACTGAGGGGAAGGAGAAGG + Intergenic
1155927493 18:31672580-31672602 TGCTGCAGATGCTAAGGAGAAGG + Intronic
1156480088 18:37430829-37430851 ATCCCCATGGGGTAAGGAGAAGG - Intronic
1156684391 18:39627229-39627251 AGCTGCAGAGGGGATGGAGTGGG + Intergenic
1157713606 18:49866878-49866900 AGGGCCAGAGGGTAAGGGGAGGG + Intronic
1157783656 18:50462659-50462681 AGCCACTGATGGTAATGAGATGG + Intergenic
1160186859 18:76682492-76682514 TACCGCACAGGGTATGGAGAGGG + Intergenic
1160196112 18:76756995-76757017 AGTCGCAGAGTGGGAGGAGAAGG - Intergenic
1160223955 18:76998114-76998136 AGCTGGAGAGGGTGTGGAGATGG - Intronic
1160694697 19:477872-477894 AGCGGCAAAGGGGAAGGAGCAGG - Intergenic
1161369888 19:3905201-3905223 AGCCTCAGAGATTAAGGGGATGG - Intronic
1161398090 19:4055249-4055271 TGCAGCAGTGGGGAAGGAGAGGG + Intronic
1162018447 19:7857923-7857945 AGCCAGAGTGGGGAAGGAGATGG + Intronic
1162052591 19:8043700-8043722 TGCCGCAGAGGGTGAGGTGAGGG - Intronic
1163095680 19:15055377-15055399 AGCTTCAGAGGGTAGGTAGAGGG - Intronic
1164619695 19:29687288-29687310 AGCAGCAGAGGAGATGGAGAAGG + Intergenic
1165163050 19:33829383-33829405 TGCAGCAGAGGGTTTGGAGAAGG + Intergenic
1166951184 19:46428938-46428960 GGCCGCAGAGCGGAAGGAGGCGG - Intergenic
928084784 2:28339212-28339234 AGGCCCAGAGGGGATGGAGAGGG - Intergenic
929151356 2:38751626-38751648 GGAGGCAGAGGGTAGGGAGACGG - Intronic
931021135 2:58046612-58046634 AGACGCCCAGGGGAAGGAGAGGG - Intronic
931759320 2:65402580-65402602 GCCTGCAGAGGGAAAGGAGAAGG + Intronic
932083052 2:68732667-68732689 AGCAGCAGTGGGGAGGGAGAAGG - Intronic
932238653 2:70141053-70141075 AGCCCCAGAGGGCAAAGACAGGG - Intergenic
932801737 2:74747521-74747543 AGCCCCTGTGGGTAAGGGGAGGG - Intergenic
933119639 2:78520965-78520987 ATCCAGGGAGGGTAAGGAGATGG + Intergenic
933600476 2:84324298-84324320 TGCAGCAGATGGTAGGGAGAGGG + Intergenic
934662805 2:96152321-96152343 TGCCGCAGAGGGGCATGAGATGG + Intergenic
935051497 2:99528761-99528783 AGCCCTAGAGGGGAAGAAGAAGG - Intergenic
935632473 2:105223577-105223599 AGGCGCAGAGGGTCAAGGGAAGG - Intergenic
935635988 2:105250351-105250373 AGCAGCAGAGAGAACGGAGATGG - Intergenic
936935694 2:117836549-117836571 AGCCGCAGACGGGAGGGCGATGG + Intergenic
937476284 2:122218305-122218327 AGCCTCAGAGGGAATGGAGGGGG - Intergenic
937604495 2:123781190-123781212 AGCAGCAGAGGATAAGGCAAGGG + Intergenic
937729900 2:125216354-125216376 AGCTGCAAAGGGTGGGGAGAAGG - Intergenic
940119010 2:150242015-150242037 ACCCACAGAGAGTATGGAGATGG - Intergenic
941809258 2:169739060-169739082 AGTCGAGGAGGGGAAGGAGAGGG - Intronic
944945313 2:204677515-204677537 AACCACAAAGGTTAAGGAGATGG - Intronic
947182475 2:227423747-227423769 TGCAGCAGAGGGTCATGAGATGG + Intergenic
947963341 2:234258412-234258434 GGAGGCAGAGGGTAGGGAGAGGG + Intergenic
947993168 2:234503416-234503438 GGATGCAGAGGGTAAGCAGAGGG - Intergenic
948301185 2:236908710-236908732 AGCTGCAGAGTGTCAGGAGGTGG - Intergenic
948464029 2:238143651-238143673 AGCCGCTGACGCCAAGGAGATGG - Intronic
1170747732 20:19115653-19115675 AGCAACAGATGGGAAGGAGAGGG + Intergenic
1173424562 20:42931547-42931569 GTGGGCAGAGGGTAAGGAGATGG + Intronic
1173439681 20:43065095-43065117 AGATGCAAAGGGGAAGGAGATGG - Intronic
1173546818 20:43904053-43904075 AGCAGCACTGGGTAAGCAGATGG - Intergenic
1174200844 20:48805456-48805478 AGCCGCAGAAGGTAGGGTGGAGG - Intronic
1174462124 20:50690543-50690565 AGCAGCAGGGGTGAAGGAGAAGG - Intronic
1174611581 20:51801964-51801986 AGGGGCAGAGGACAAGGAGAAGG + Intronic
1174823028 20:53743975-53743997 GGCCGCAGAGGCTAAGGAAGAGG + Intergenic
1175967349 20:62666142-62666164 TGCCTCAGAGGGGAAGGGGAAGG - Intronic
1176093941 20:63331016-63331038 AGCCGCAGTGGGGAAGGGGAGGG + Intronic
1177023592 21:15894092-15894114 AGCTGCAGAGGGTCACTAGAGGG + Intergenic
1178336735 21:31750115-31750137 AGAAGCAGTGGGTAGGGAGAAGG - Intergenic
1181939416 22:26463879-26463901 GGCCGCAGAGGGGCAGGAGAAGG + Intronic
1182041745 22:27243427-27243449 AGCCACAGAGGGCCATGAGAGGG + Intergenic
1182753672 22:32661261-32661283 AGCCCCAGAGGGGAAGGTGGAGG - Intronic
1183654613 22:39177373-39177395 AGCAGGAGAGGGGAGGGAGAGGG - Intergenic
1183670797 22:39271332-39271354 AGCCGGAGAAGGCAAGGAAACGG - Intergenic
1184107115 22:42374342-42374364 AGCAGGAGAGGGCAAGGAAACGG - Intergenic
1184281733 22:43441263-43441285 AGCCTCAAAGGGAAAGGAGAGGG - Intronic
1184384531 22:44166740-44166762 AGCCGCAGAGATTTATGAGATGG + Intronic
1184968180 22:47996526-47996548 AGCCCCAGAGGTGAAGGAGTGGG + Intergenic
949822886 3:8135126-8135148 AGCTGGAGAGGGTAAGGTCAGGG + Intergenic
949903018 3:8835607-8835629 AGGAGCAGCGGGTAAGCAGAAGG - Intronic
950879784 3:16313968-16313990 ACCTGCAGAGGCTCAGGAGAGGG - Intronic
951371676 3:21857627-21857649 AGCCTCAGAGGGAAAGAAAATGG + Intronic
952168416 3:30777267-30777289 TCCCCCTGAGGGTAAGGAGAGGG + Intronic
952382252 3:32814791-32814813 GGCCCCAGAGGGTCAGAAGAGGG - Intergenic
954578822 3:51691998-51692020 AGCCAGAGAGGCTAAGGAGCAGG - Intronic
955379306 3:58423923-58423945 TACCGCAGTGGGCAAGGAGAGGG - Intronic
955904602 3:63793545-63793567 AGCAGCAGAGAGTGAGGAGAGGG - Intergenic
957738124 3:84227814-84227836 AGCAGGAGAGTGAAAGGAGAAGG + Intergenic
959193932 3:103152597-103152619 AGCCACAGAGGGTAATAAAATGG - Intergenic
961332754 3:126152658-126152680 AGCAGCCGGGGGTAGGGAGAGGG - Intronic
961361106 3:126367621-126367643 GGCCTCAGAGGGCAATGAGATGG + Intergenic
961494956 3:127284648-127284670 AGAAGCAGAGTGTAAGGAGATGG + Intergenic
962889128 3:139655928-139655950 AGCCGAAGAGTGTGAGGGGATGG - Intronic
963930234 3:150996506-150996528 AGCCGCAGTTGGTGAGGGGATGG - Intergenic
965210634 3:165782362-165782384 TGCCTCACAGGGTAAAGAGAAGG + Intronic
965502765 3:169476097-169476119 AGCAGCAGAGGGAGAGGAAAGGG + Intronic
967970415 3:194995000-194995022 AGGCTCAGAGGGGAAGGACACGG - Intergenic
968332123 3:197879786-197879808 AACTGCAGAGGCTGAGGAGACGG - Intronic
969492715 4:7509290-7509312 GGCCACAGAGGGGATGGAGAGGG + Intronic
970178415 4:13362713-13362735 AGCAGTAGTGGGAAAGGAGAAGG + Intronic
970400162 4:15709526-15709548 TGCTGCAGAGGGTGGGGAGAAGG + Intronic
972565519 4:40265669-40265691 AGGAGCAGAGGGAAGGGAGAGGG + Intergenic
974209342 4:58749591-58749613 AGAGGCAGAGGGCAAGGAGTAGG - Intergenic
974309253 4:60183635-60183657 CGGGGCAGAGGGTAAGGAGAGGG - Intergenic
974692439 4:65314697-65314719 TGACACAGAGGGTAAGGTGAAGG + Intergenic
976605519 4:86979079-86979101 AGAGGCAGAGGCAAAGGAGACGG - Intronic
979724630 4:123945674-123945696 AGCTGCAAAAGGCAAGGAGACGG + Intergenic
980471872 4:133263244-133263266 AGCCCCTGAGGGGAGGGAGAGGG - Intergenic
980600043 4:135011174-135011196 AAAAGCAGAGGGTAAGGTGAGGG - Intergenic
981579050 4:146233926-146233948 AGCCCCAGAGGGGAATGAGTAGG + Intergenic
982354106 4:154448079-154448101 AGCCTCAGAGGCTGAGGACAAGG - Intronic
982699354 4:158642444-158642466 GGCTGGGGAGGGTAAGGAGAAGG - Intronic
984860761 4:184235898-184235920 AGATGCACAGGGCAAGGAGAGGG - Intergenic
986232013 5:5874197-5874219 AGCTGCAGGAGGTAGGGAGATGG - Intergenic
986830822 5:11575796-11575818 AGCCACAGAGGAAAATGAGAGGG - Intronic
987222702 5:15806835-15806857 AGTCACAGAGGGAGAGGAGAAGG - Intronic
987472984 5:18355369-18355391 AGCCTCAGAAGGTAGGGAGATGG - Intergenic
989172272 5:38484116-38484138 AGTTCCAAAGGGTAAGGAGAGGG - Intronic
989576313 5:42991721-42991743 ATTCGCAGAGGGAAAGGAGCTGG - Intergenic
989579370 5:43017648-43017670 ATTCGCAGAGGGAAAGGAGCTGG - Intergenic
992606557 5:78463209-78463231 AGCTACAGAGGTTAAGGAGGAGG - Intronic
992956747 5:81917769-81917791 AGAGGCAGAGGGTAGGGAAATGG - Intergenic
993378317 5:87176271-87176293 AGTCGGAGAGGGAATGGAGAAGG - Intergenic
996075232 5:119185157-119185179 AGAAGTAGAGGGAAAGGAGAAGG - Intronic
996437095 5:123446507-123446529 AACTGTAGAGGGTAGGGAGACGG + Intergenic
997806468 5:136923030-136923052 AGCCTCAAAGGTTGAGGAGAAGG - Intergenic
998463617 5:142326160-142326182 AGCCGCAGAGGAAATGGAAATGG + Intronic
998861476 5:146447848-146447870 AGCCGCGGAGGGCGTGGAGAAGG - Intronic
1000329866 5:160198019-160198041 AGCTGGAGAGGGAAGGGAGAAGG + Intronic
1001130799 5:169061871-169061893 GGCCCCAGAGGGTAGGGAGTGGG - Intronic
1001801503 5:174548241-174548263 AGGGGCTGAGGGTGAGGAGAAGG - Intergenic
1002066196 5:176652997-176653019 AGCCCAGGTGGGTAAGGAGATGG - Intronic
1005399382 6:25415903-25415925 ACCAGAAGAGGGAAAGGAGATGG + Intronic
1006616040 6:35327576-35327598 TGCAGCAGAGGGGAAGGAGAGGG + Intergenic
1006757641 6:36430577-36430599 AGCCGAAAAAGATAAGGAGATGG + Intronic
1013826688 6:114219484-114219506 AGGGGTAGAGGGAAAGGAGAGGG + Intronic
1014617545 6:123622077-123622099 AGCAGAAGAGGTTAAGGAGTTGG - Intronic
1019083389 6:169452229-169452251 AGCCGCAGTGAGTAAGGCGTGGG - Intergenic
1019173718 6:170149180-170149202 GGCCTCAGAGGGTAAGGGCAGGG + Intergenic
1019210108 6:170397962-170397984 AGCCAAAGAGGGTAAGCAGAAGG - Intronic
1019531783 7:1506843-1506865 AGAGGAAGAGGGGAAGGAGACGG - Intergenic
1021179472 7:17489109-17489131 AGGCTCAGAGGGTAAGCAAAGGG - Intergenic
1022781929 7:33594376-33594398 AGCTGCAGAGGGGCAGGTGAAGG - Intronic
1023877430 7:44294643-44294665 AGGAGCAGAGGGCCAGGAGATGG - Intronic
1026195956 7:68173938-68173960 AGCAGCAGTGGGGAAGGTGATGG - Intergenic
1027360749 7:77406801-77406823 AGGAGCCGAGGGTAGGGAGAGGG + Intronic
1028893422 7:96013835-96013857 AGCCTCAGAAGGGCAGGAGATGG - Intronic
1032876812 7:136046745-136046767 AGCTGGAGAAGGTAAGGAAATGG - Intergenic
1035607384 8:938824-938846 TGCCTCAGAGGCCAAGGAGAGGG + Intergenic
1041428607 8:57751822-57751844 AGCTACATAGGGTGAGGAGAAGG - Intergenic
1042468341 8:69154120-69154142 AGCCGATGAGTGTAAGCAGAAGG - Intergenic
1044558274 8:93588283-93588305 AGCAGAAGAGGGAAAGGACATGG + Intergenic
1046868020 8:119172574-119172596 AGAAGCAGAAGGTAAGGAGTAGG + Intronic
1047337433 8:123950256-123950278 AGCTGTAGAGGGTGAGGAGCAGG + Intronic
1047482229 8:125295223-125295245 GGCCCCAGAAGGTAAAGAGATGG - Intronic
1048927875 8:139286889-139286911 AGACAAACAGGGTAAGGAGATGG - Intergenic
1048968394 8:139630276-139630298 AGCCTCAGAGGATAAGGAAGTGG + Intronic
1051031099 9:12679824-12679846 AAACACAGAGGCTAAGGAGAGGG - Intergenic
1052357830 9:27524171-27524193 AGCCTCAGAGGCAAAGGAAAGGG + Intronic
1055371395 9:75603463-75603485 AGCGGGGGAGGGAAAGGAGATGG - Intergenic
1059433112 9:114261485-114261507 AGCCCCACAGGGCAGGGAGAGGG - Intronic
1059737784 9:117119496-117119518 TGCAGGAGAGAGTAAGGAGAAGG - Intronic
1059739982 9:117140701-117140723 AGCAGCAGAGGAAAAGGAGCAGG + Intronic
1060545435 9:124456497-124456519 AGCCACGGAGGGTCTGGAGAGGG + Intronic
1060982334 9:127800585-127800607 AGGCGCAGAGGCTAAGAATAAGG + Intronic
1061047978 9:128177638-128177660 AGCCGCAGGGGTGGAGGAGACGG + Exonic
1061925624 9:133804814-133804836 AGCCCCAGAGGGTTAAGAGTGGG - Intronic
1062199065 9:135291369-135291391 AGCCGCAGAGCCGAAGCAGATGG + Intergenic
1185851102 X:3489446-3489468 AGCGGCAGAGGAGAAGGAGGAGG + Intergenic
1185858763 X:3559024-3559046 TGCTGCTGAGGGGAAGGAGAAGG + Intergenic
1187553328 X:20327494-20327516 AGGCTGAGAGAGTAAGGAGAGGG + Intergenic
1191675255 X:63785883-63785905 AGCCGCAGAGGGTAAAGTCGAGG - Intergenic
1191851300 X:65588208-65588230 TGCAGCAGAGGGAAAGGAGGAGG - Intergenic
1192157737 X:68759010-68759032 AGCTGTAGAGGAGAAGGAGATGG + Intergenic
1196510077 X:116499217-116499239 AGCCACAGGGAGAAAGGAGAGGG - Intergenic
1196951682 X:120931289-120931311 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196952366 X:120936150-120936172 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196953051 X:120941011-120941033 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196953736 X:120945871-120945893 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196954421 X:120950732-120950754 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196955104 X:120955592-120955614 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196955792 X:120960475-120960497 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196956473 X:120965336-120965358 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196957155 X:120970196-120970218 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196957837 X:120975056-120975078 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196958519 X:120979916-120979938 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1196959200 X:120984776-120984798 GGCCCCAGAGGGTAAGGAACGGG - Exonic
1197373652 X:125655902-125655924 AGAAGCAGAAGGTAGGGAGAAGG - Intergenic
1199814691 X:151387085-151387107 AGCTGCAGGGGGTGAGGAGAGGG - Intergenic
1200052720 X:153443532-153443554 AGCCGCGGAGGGTCATGAGCAGG - Intergenic
1200062103 X:153488296-153488318 GGAGGCAGAGGGGAAGGAGAGGG - Intronic