ID: 1133072516

View in Genome Browser
Species Human (GRCh38)
Location 16:3255947-3255969
Sequence TGCAATCATATGAACGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133072516 Original CRISPR TGCAATCATATGAACGGGGT TGG (reversed) Intronic
917537045 1:175881978-175882000 TGCAGTCCTAGGAAGGGGGTGGG - Intergenic
918389980 1:184049417-184049439 TGCCATCATATGAACTGATTTGG + Intergenic
922239928 1:223748847-223748869 TTCAAGCATTTGAACGGGGTAGG + Intronic
922319725 1:224475672-224475694 TGGAATCATTTGAGCAGGGTTGG - Intronic
1066044492 10:31583892-31583914 TGCAATCGTATGCATGTGGTGGG + Intergenic
1067342532 10:45417429-45417451 TGCAACCATATGTGGGGGGTGGG - Intronic
1069210439 10:65751865-65751887 TGCAATCATATGAATGTGTTTGG + Intergenic
1091918943 12:4289196-4289218 AGCAAGCAGATGAAGGGGGTGGG + Intronic
1098787899 12:74782381-74782403 TGCAATCAGCTGCAGGGGGTTGG + Intergenic
1107228230 13:38076567-38076589 TGCAATCACATGAAGGGGAGTGG - Intergenic
1108371631 13:49775295-49775317 TGCCATGATATGAAAGTGGTTGG - Intronic
1116459785 14:45159513-45159535 TGGAATTATATTAACTGGGTTGG + Intronic
1120550133 14:85860495-85860517 TGCAATCATAAGAACTGTTTAGG - Intergenic
1120787873 14:88553525-88553547 TGCAATAATATGAAAGTGATTGG + Intronic
1122300712 14:100729489-100729511 TGCAAACAAACAAACGGGGTGGG + Intronic
1122647530 14:103205331-103205353 TACAATCACATGGAGGGGGTTGG + Intergenic
1126585819 15:50285346-50285368 TGAAATCAAATGAACTGAGTTGG - Intronic
1129198756 15:73986238-73986260 TGCAATGATATGAGAGGGGGCGG + Intronic
1133072516 16:3255947-3255969 TGCAATCATATGAACGGGGTTGG - Intronic
1134612575 16:15621622-15621644 TGCAATCATCACAAGGGGGTGGG + Intronic
1142841115 17:2631393-2631415 TGTAACCATCTGAATGGGGTGGG - Intronic
1149131027 17:53302738-53302760 TGCAAACATTTGAACTGGCTTGG + Intergenic
1149199529 17:54166696-54166718 TGCAATAATATGAACAGAGCTGG + Intergenic
1158077142 18:53544002-53544024 AGCAATCAGATGAACAGGCTTGG + Intergenic
1164492798 19:28729827-28729849 TGTATTCACATGCACGGGGTTGG + Intergenic
928847332 2:35692912-35692934 TGCAACAATATGAATGGAGTTGG - Intergenic
935133965 2:100282559-100282581 TCCAATCAAATGATCGGGTTAGG + Exonic
935915146 2:107941598-107941620 TGCAAACATATGCAGGGGGCTGG + Intergenic
936725236 2:115306305-115306327 TGGATGCATATGAAAGGGGTTGG + Intronic
939054018 2:137340724-137340746 TGCAATCATATGAATGGAACTGG - Intronic
939181726 2:138810918-138810940 TGCAACTATATTAACAGGGTAGG - Intergenic
1172731398 20:37091797-37091819 TGCAATAATCTAAAAGGGGTGGG + Intronic
1174743486 20:53039246-53039268 TTTAATCAGATGATCGGGGTAGG - Intronic
1177572917 21:22910841-22910863 TGAAATTATATGAACTGTGTAGG - Intergenic
1182043400 22:27255811-27255833 TGCAATCATACCAACGTAGTTGG - Intergenic
951446880 3:22792728-22792750 AGCATTCATATGAATGGGCTGGG + Intergenic
954227942 3:49194953-49194975 TACAAACATATGAACTGGCTGGG + Intergenic
962684255 3:137831405-137831427 TGCTGTCATATGAACAAGGTAGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
975934896 4:79567228-79567250 TGTAATCATTTGACCTGGGTTGG - Intergenic
981820604 4:148882335-148882357 TGCAATGATATCTAAGGGGTGGG + Intergenic
982385047 4:154791562-154791584 TGCAGTTATATGAAAGGGGCAGG + Intronic
993066308 5:83102597-83102619 TGCAATCATATGAGATGTGTGGG - Intronic
999321920 5:150620684-150620706 TGCTATCAAATGAACTGGCTTGG - Intronic
999443816 5:151622890-151622912 TGCACTCATACTAACTGGGTGGG - Intergenic
1007126182 6:39427485-39427507 TCCAATCCTAAGAAAGGGGTAGG + Intronic
1008758917 6:54830818-54830840 TGGAATCACATGAATGGGGAAGG + Intergenic
1020915185 7:14184260-14184282 TGTAACAATTTGAACGGGGTGGG + Intronic
1021840431 7:24717777-24717799 TGGAGTGATATGCACGGGGTAGG - Intronic
1028953764 7:96665981-96666003 TGAAGTCATATGAACTTGGTTGG - Intronic
1045156832 8:99485580-99485602 TGCAATGATATGAAAAAGGTTGG + Intronic
1052257045 9:26469422-26469444 TTCCAACATATGAACTGGGTGGG + Intergenic
1055941676 9:81656189-81656211 TGTGATCAAATGAACTGGGTGGG - Intronic
1203723540 Un_GL000216v2:31129-31151 TGCAATCATATGGACTCGATTGG - Intergenic
1187367359 X:18675942-18675964 TGCAATCATTTGGGCGGGGGGGG + Intronic
1193864538 X:86714947-86714969 TGCAATCATGTGCACAGTGTGGG + Intronic
1197010846 X:121561299-121561321 TGCCATCATGTGAAGGTGGTTGG + Intergenic
1198993810 X:142548928-142548950 TTTAATCATGTGAATGGGGTTGG + Intergenic
1199596576 X:149510742-149510764 TGCATTCATCTGAATGGAGTGGG + Intronic
1199811246 X:151351910-151351932 TGCAATCATATGGATGGAATGGG - Intergenic