ID: 1133090702

View in Genome Browser
Species Human (GRCh38)
Location 16:3401573-3401595
Sequence GTCGGTTTCCGCCAGGATGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133090693_1133090702 5 Left 1133090693 16:3401545-3401567 CCGTTTAGCACCCGGCGACATGC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
1133090695_1133090702 -5 Left 1133090695 16:3401555-3401577 CCCGGCGACATGCACCCGGTCGG 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
1133090691_1133090702 20 Left 1133090691 16:3401530-3401552 CCTCGCTTAGCTCTACCGTTTAG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 35
1133090697_1133090702 -6 Left 1133090697 16:3401556-3401578 CCGGCGACATGCACCCGGTCGGT 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133090702 Original CRISPR GTCGGTTTCCGCCAGGATGC GGG Exonic
908177175 1:61567072-61567094 GTATGTTTCAGCCAGGATGTTGG - Intergenic
913111456 1:115660961-115660983 GTCAGTTTCCTCCTGGATGTGGG + Intronic
1063121392 10:3107337-3107359 CTCGGTTTCTGCCTGGAAGCAGG + Intronic
1066221252 10:33336973-33336995 GTCGGGTCCCCCCAGGACGCAGG - Intergenic
1076401348 10:130187481-130187503 CTCAGCTTCTGCCAGGATGCTGG + Intergenic
1081621996 11:44624196-44624218 GTGGGCTTCCTGCAGGATGCTGG + Intergenic
1099295098 12:80820772-80820794 GTGGGTTTCACCCAGGAAGCAGG + Intronic
1101381340 12:104216164-104216186 TTCGGTTTCCGACAGGTTTCCGG - Intronic
1109261565 13:60150695-60150717 AGTGGTTTCCACCAGGATGCAGG + Intronic
1115307871 14:31950997-31951019 GTCGGCAACTGCCAGGATGCAGG + Intergenic
1123121534 14:105919115-105919137 GTCGGTGTCCCCCAGGGTACTGG + Intronic
1128237533 15:66078328-66078350 GCGTGTTTCCGCCACGATGCAGG - Intronic
1128448155 15:67783160-67783182 CTCGGTGTCAGGCAGGATGCTGG - Intronic
1133090702 16:3401573-3401595 GTCGGTTTCCGCCAGGATGCGGG + Exonic
1138448520 16:57079214-57079236 GTTGTTTTCCGCCAAGCTGCAGG - Exonic
1140466835 16:75189560-75189582 ATCGGTATCCCCGAGGATGCTGG + Intergenic
1141154634 16:81588700-81588722 GTCTGTCTCCCCCAGCATGCAGG + Intronic
1146286102 17:31575117-31575139 TTGGGATTCCACCAGGATGCTGG + Intronic
1148945808 17:51260714-51260736 GGCGGTTTCCGCTGGGATGAAGG - Exonic
1151498631 17:74474646-74474668 CTCAGTTTCCTCCTGGATGCTGG - Exonic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1166141599 19:40808178-40808200 GTCACTTCCCACCAGGATGCAGG + Exonic
924962746 2:47870-47892 GATGGTTTCCTACAGGATGCGGG + Intergenic
938296546 2:130182612-130182634 GTCTGTCCCCGCCAGGATCCTGG + Exonic
938460202 2:131492017-131492039 GTCTGTCCCCGCCAGGATCCTGG - Exonic
957344126 3:78940281-78940303 GTCTCTTTCCACCAGGATGTAGG + Intronic
965638069 3:170804449-170804471 GTAGATTTCCTCCAGGATGAAGG - Intronic
968541060 4:1168661-1168683 CTCGGTTTCAGTCAGGAAGCTGG - Intronic
969639277 4:8387348-8387370 GTCAGCTCCCGCCAGGCTGCCGG - Intronic
974062667 4:57049724-57049746 TTCTGATTCCGACAGGATGCTGG - Intronic
982329204 4:154162477-154162499 GTGTGTTTCTGCCAGGATCCGGG + Intergenic
1005395024 6:25373078-25373100 GTGGGTTTCATCCAGGATGTAGG - Intronic
1014605355 6:123467126-123467148 GTCTGTTTCAGCCAGTATGTTGG - Intronic
1051681964 9:19616716-19616738 GCCTGTTTCTGCCAGGATACAGG - Intronic
1198033687 X:132780334-132780356 GTTGTTTTCAGCCAGGATGAAGG - Intronic
1200935440 Y:8734387-8734409 CTCCTTTTCCGCCAAGATGCAGG + Intergenic