ID: 1133091482

View in Genome Browser
Species Human (GRCh38)
Location 16:3407731-3407753
Sequence CCTTCTGTAATTAGGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133091474_1133091482 18 Left 1133091474 16:3407690-3407712 CCCATAGGCCGTTCCAGCTCATC 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091477_1133091482 5 Left 1133091477 16:3407703-3407725 CCAGCTCATCTCCATCCAGACTG 0: 1
1: 0
2: 5
3: 30
4: 295
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091475_1133091482 17 Left 1133091475 16:3407691-3407713 CCATAGGCCGTTCCAGCTCATCT 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091479_1133091482 -10 Left 1133091479 16:3407718-3407740 CCAGACTGTCAATCCTTCTGTAA 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091476_1133091482 10 Left 1133091476 16:3407698-3407720 CCGTTCCAGCTCATCTCCATCCA 0: 1
1: 0
2: 4
3: 43
4: 452
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091478_1133091482 -6 Left 1133091478 16:3407714-3407736 CCATCCAGACTGTCAATCCTTCT 0: 1
1: 0
2: 1
3: 12
4: 193
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138
1133091473_1133091482 28 Left 1133091473 16:3407680-3407702 CCTGTGATTTCCCATAGGCCGTT 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133091482 Original CRISPR CCTTCTGTAATTAGGATACA TGG Intronic
908028207 1:59972752-59972774 CCTTGTGTATTTAGAATGCATGG - Intergenic
909239093 1:73190084-73190106 CATTCTTTAATCAGGATACCAGG + Intergenic
909756472 1:79231847-79231869 CCATTTGTAATTAGGATGCCTGG - Intergenic
912241935 1:107920040-107920062 GCTTCTGTAATAAGGAGATAAGG - Intronic
918184981 1:182119212-182119234 CCTTCTCTTATCTGGATACAGGG + Intergenic
920393096 1:205623214-205623236 CAGTTTGGAATTAGGATACAAGG - Intronic
921298529 1:213727327-213727349 CCTTCTGAGATGAGGGTACAGGG + Intergenic
922181036 1:223233049-223233071 CCTTATGCAATTAGGATACCTGG + Intronic
1065696362 10:28384207-28384229 CCTTCTGTTATTTAGGTACATGG + Intergenic
1066798553 10:39155597-39155619 CATTCAGCAATTAGGAAACACGG + Intergenic
1067983722 10:51117157-51117179 TTCTCTATAATTAGGATACAGGG - Intronic
1068193141 10:53680376-53680398 ACTTTTGTAATTAGGCTAGAAGG + Intergenic
1071544396 10:86517456-86517478 CTTTCTGCACTTATGATACATGG - Intronic
1072365540 10:94705037-94705059 CCCTCTGTAAATAGGAACCAGGG + Intronic
1074137392 10:110639678-110639700 CCTCTGGAAATTAGGATACAAGG - Intergenic
1076066729 10:127454209-127454231 CCTTCTGGAATGTGGATCCAGGG + Intergenic
1076212203 10:128657746-128657768 CCCTCTGTGATTTGGTTACAAGG - Intergenic
1077638236 11:3857872-3857894 CCATGTGTAAGTAGGATACCTGG + Intronic
1077794038 11:5472293-5472315 CCTTTAGTGATTAGGGTACAGGG - Intronic
1080297714 11:30749577-30749599 CCTGGTGTGATTAGGAAACAGGG - Intergenic
1080683157 11:34494646-34494668 CCTTCTGTTCTTAGGAGAAATGG + Intronic
1083087367 11:60164052-60164074 TCTTCCGAAATGAGGATACAAGG + Intergenic
1085185347 11:74571257-74571279 CCTACTGAAATCAGGACACAAGG + Intronic
1086944897 11:92835239-92835261 CCTTCTGTAATTTGTATATTAGG + Intronic
1088291944 11:108248526-108248548 CTTTCTGAAATGAAGATACAGGG - Intronic
1093000461 12:13990174-13990196 CCTTAAGTTATTAGGAAACAGGG - Intergenic
1094155100 12:27330901-27330923 CCATCTGGAATTAGGAACCACGG - Intergenic
1097726349 12:63079698-63079720 CCTTCTGGTAATTGGATACAAGG - Intergenic
1099256522 12:80321121-80321143 ACTTCTGTCATTTGAATACAAGG + Intronic
1100235507 12:92656807-92656829 GCTTCTGTAGTTAAAATACAGGG - Intergenic
1101230926 12:102740098-102740120 GCTTTTGTAATTCTGATACAGGG + Intergenic
1102338113 12:112100026-112100048 TCTTCTGTAATTTGTATTCATGG - Intronic
1104031733 12:125069642-125069664 CCCTCTGTAATTAGGAGGCAGGG + Intronic
1110011262 13:70337126-70337148 CCTTCTGTCAGAAGGAGACAGGG - Intergenic
1114838510 14:26233623-26233645 CCTCCTGTAATAATGATAGATGG + Intergenic
1117065753 14:52012065-52012087 CCTTCAGTAATTAGAGGACATGG + Intronic
1120404190 14:84073589-84073611 ACCTCTGGAATTAGGATTCATGG + Intergenic
1121381724 14:93476364-93476386 TGTTCTGTAATTAGGCTAAAAGG + Intronic
1128597850 15:68968274-68968296 CCCTCTGGAATCAGGAAACAGGG - Intronic
1133091482 16:3407731-3407753 CCTTCTGTAATTAGGATACATGG + Intronic
1133111998 16:3553489-3553511 TCTGCTGTATTTAGGATAAACGG + Intronic
1136740555 16:32519284-32519306 CATTCAGCAATTAGGAAACACGG - Intergenic
1139940270 16:70600581-70600603 CCCTCTGAAATTAGGATCAATGG + Intronic
1203029050 16_KI270728v1_random:555950-555972 CATTCAGCAATTAGGAAACACGG + Intergenic
1203042671 16_KI270728v1_random:778481-778503 CATTCAGCAATTAGGAAACACGG - Intergenic
1146895379 17:36537027-36537049 TCTTGTGTAATTAGCATACCTGG - Intronic
1150174029 17:63031325-63031347 CCTTCTGTGGTTAGGATGAAAGG - Intronic
1152416104 17:80163150-80163172 CCTTCTGTCTTTGGGACACAGGG - Intergenic
1153116655 18:1665270-1665292 CCTTCTGAATTTATGAGACAGGG - Intergenic
1155500527 18:26482758-26482780 CCCTCTGTAATTACCATGCATGG - Intronic
1157059515 18:44271394-44271416 CTTTCTGTTACAAGGATACATGG + Intergenic
1157558534 18:48629813-48629835 CCTTCTCTAATTAGCAAACATGG - Intronic
1158899801 18:61952071-61952093 CCTTATCTAATTAGGAAACAAGG - Intergenic
1159110886 18:64055230-64055252 GAGTCTGTAATTAGGATACCAGG - Intergenic
1161445140 19:4314154-4314176 TTATCTGTAATTAGCATACATGG + Intronic
1161473052 19:4470605-4470627 TTTTTTGTAATTAGGATCCATGG - Intergenic
1164424043 19:28124445-28124467 CCTTCTGTCATCAGAAGACATGG - Intergenic
927420259 2:22923752-22923774 GCCTCTGTGATGAGGATACATGG - Intergenic
928434452 2:31245294-31245316 CCATCTGTAAATAGGATAATAGG + Intronic
933240122 2:79911104-79911126 CTTTCTGTAATTTTGATCCATGG + Intronic
934970358 2:98758456-98758478 ATTTTTGTAATTAGGATATACGG - Intergenic
935944387 2:108271993-108272015 CCTTCTGTAATTGAGAGACCCGG + Intergenic
941731463 2:168922463-168922485 CCTTCTGGAAGGAGGAGACAAGG - Intergenic
942774992 2:179570735-179570757 GCTTCTTAAATTAGGATCCATGG + Intronic
1169740925 20:8893480-8893502 CCATCTGTAAGTAACATACACGG + Intronic
1170101775 20:12709002-12709024 CCTTCTGAAATTTGGAAAGACGG - Intergenic
1170488263 20:16842695-16842717 CCTTCCTTACTTAGGGTACAGGG + Intergenic
1173265631 20:41477479-41477501 CCTTCTGTAATTTTGGTAAATGG - Intronic
1176916738 21:14634856-14634878 CATTCTGTTATAAAGATACATGG + Intronic
1181957858 22:26601271-26601293 CCTTATGTCATGAGAATACATGG - Intronic
1182383425 22:29913403-29913425 CCTTCTGTAACTAAGATTTAGGG + Intronic
951755239 3:26083961-26083983 CCTGCTCAATTTAGGATACAAGG - Intergenic
954093944 3:48307843-48307865 CATTCTGTACTTGGGATACCTGG + Intronic
955833585 3:63029802-63029824 CCTTCCTTAATTAGGCTCCAGGG + Intergenic
956997700 3:74847005-74847027 CCTTCTGTGAATATGATAAAAGG - Intergenic
959232635 3:103675400-103675422 ACTTCTGTGATTAGGCTACAAGG + Intergenic
959247086 3:103884834-103884856 AGTTTTGTATTTAGGATACAAGG + Intergenic
963374668 3:144448921-144448943 CCTTCTCTATAAAGGATACATGG + Intergenic
965779086 3:172264873-172264895 CCTTCTTTAATAAGGGTGCATGG + Intronic
966343046 3:178946599-178946621 CTGTCTGTAATTACTATACAGGG + Intergenic
971767876 4:30857045-30857067 CATTCTGAAATTAGAAAACAAGG + Intronic
971919336 4:32916463-32916485 CCTTCTGTAAATAAAAAACAAGG + Intergenic
972540982 4:40039236-40039258 CCTTCTTTAATTATGAGCCATGG + Intergenic
972694565 4:41433095-41433117 CCTTCTCCAATTAGCATGCAAGG - Intronic
974028966 4:56758715-56758737 CTCTCGGTAATTAGGATAAATGG + Intergenic
975530233 4:75392897-75392919 CCTGCTAGACTTAGGATACAGGG - Intergenic
977787330 4:101052678-101052700 CCTGATGTAATTAGGGTACAGGG - Intronic
978911921 4:114073975-114073997 CCTACTGAAACTAGGATAAAGGG + Intergenic
979791224 4:124783876-124783898 CCTTGTGTCTGTAGGATACATGG - Intergenic
981695994 4:147559311-147559333 TCTTCTGGAATTATGATTCATGG - Intergenic
986299969 5:6470791-6470813 CCTATGGTAATTAGGGTACAAGG - Intronic
986647036 5:9927499-9927521 CCTTCTGTAATGATCATGCATGG + Intergenic
992877954 5:81076420-81076442 ACTTCTGTAGTTAGGAGGCAAGG + Intronic
994957285 5:106548930-106548952 ACTTCTGTAATAAAGAGACAAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1005253107 6:23970503-23970525 CCTTCTTCAATTAGGGCACAAGG - Intergenic
1005379394 6:25218074-25218096 CCTTTTGTAATCAGGATCTATGG - Intergenic
1007644704 6:43370745-43370767 ACTTTTGTATTTAGGATGCAGGG - Intergenic
1008040065 6:46788171-46788193 GCTTCTGAAATAAGGGTACAAGG - Intergenic
1008565126 6:52760518-52760540 CCATCTTTAATTAGGATAATAGG - Intronic
1008571220 6:52818902-52818924 CCATCTTTAATTAGGATATTAGG - Intergenic
1009658967 6:66585309-66585331 GTTTCTGTAATTGGTATACAGGG - Intergenic
1010881099 6:81173067-81173089 ACTATTGTAATTAGAATACAAGG + Intergenic
1012047427 6:94295625-94295647 ACTTCTGTAATTAGGATCCCAGG + Intergenic
1014326194 6:119997862-119997884 CATTTTGTAAATAAGATACAAGG + Intergenic
1015448392 6:133335248-133335270 CCTTCTGTAATTAGCCAAAAAGG - Intronic
1016494664 6:144647020-144647042 TCTTCTGGAATTAGGATGAAGGG - Intronic
1016788941 6:148046112-148046134 TCTTATATAATTAGGATCCAAGG + Intergenic
1016885463 6:148955593-148955615 CCTTCTGGAATTAAGAGGCAGGG - Intronic
1017086087 6:150714322-150714344 CTTTCTTTGATTAGGATACTTGG - Intronic
1019143066 6:169960487-169960509 CCGTTGGTAATTAGGAAACATGG + Intergenic
1023080873 7:36524952-36524974 CCTGCTGTTATTAGCATACCTGG - Intronic
1024291674 7:47809065-47809087 ACTTTTGGAATTAGGATATAAGG - Intronic
1025530444 7:61874701-61874723 CATTCAGCAATTAGGAAACACGG - Intergenic
1026167816 7:67926098-67926120 ACTACTGCAATTAAGATACATGG + Intergenic
1027959289 7:84923418-84923440 CCTTCTATAATTAGAATCAAAGG + Intergenic
1029811600 7:103054660-103054682 CCTTCTCAGATTAGGTTACAGGG - Intronic
1030229384 7:107190879-107190901 CCTTCTGGAGTCAGGACACATGG - Intronic
1030749588 7:113214734-113214756 CCTTCTTTAAATATGATTCAAGG + Intergenic
1031288528 7:119902695-119902717 ACTTCTGAAATTTGGACACAAGG + Intergenic
1031404854 7:121372699-121372721 CCTACTATAATTATGATAGATGG - Intronic
1031971628 7:128068808-128068830 TCCTCGGTAATTAGGAGACATGG + Intronic
1033062805 7:138124083-138124105 CTTTAGGTAATTGGGATACAGGG + Intergenic
1033277479 7:139983511-139983533 CCCTCTGTCATCAGGATGCAGGG + Intronic
1034747928 7:153539989-153540011 CCTGCTCTAATTTGGACACATGG - Intergenic
1037135114 8:15451095-15451117 CCCTCTGTAGCTAGGATGCAGGG - Intronic
1037304149 8:17487297-17487319 CCCTCATTAATGAGGATACATGG + Intergenic
1038316230 8:26486705-26486727 CCTGCAGTAATTAGAATAGAAGG - Intronic
1040350857 8:46566037-46566059 CCTTCTATCATAAAGATACATGG + Intergenic
1041555315 8:59147367-59147389 CCTTCTTTAATTTAGCTACATGG + Intergenic
1043228139 8:77760865-77760887 ACTTCAGTTATTAGGAAACATGG + Intergenic
1044338077 8:91013261-91013283 CCTTTTGTAATGTGGCTACAAGG + Intronic
1050064761 9:1747951-1747973 CCTTCTGTAACTAGCATGCCTGG - Intergenic
1051859278 9:21606138-21606160 CCCTCAGTAGTTAGGGTACAGGG - Intergenic
1052493999 9:29203482-29203504 GCTTGTGTAAATAAGATACATGG - Intergenic
1055688826 9:78808139-78808161 CTTTCTGTAAATATAATACAGGG - Intergenic
1055988616 9:82080530-82080552 ACATCTATAATTAGGAAACAAGG - Intergenic
1060289419 9:122286704-122286726 CCTTGTTTATTTAAGATACAAGG - Intronic
1186118787 X:6335034-6335056 CCTTCTGCAATAAGTATTCAAGG + Intergenic
1190251569 X:48730947-48730969 CCTTCTGAAAGTAGAATTCAGGG - Intergenic
1192111288 X:68367585-68367607 CCCTCTGGAATCAGGGTACAGGG - Intronic
1193973847 X:88092525-88092547 CCTTGTGTCATTAAGTTACAGGG - Intergenic
1194810483 X:98381895-98381917 CCTTCTGACATTAGGATTCCAGG - Intergenic
1198316198 X:135469032-135469054 CCTTCTGTAGTGAGGAAACTTGG + Intergenic
1199725908 X:150580629-150580651 TCTTCTGTAACAAGGATACGTGG + Intronic
1201378826 Y:13350346-13350368 ACTTCTGTAACTAGAACACATGG + Intronic