ID: 1133097685

View in Genome Browser
Species Human (GRCh38)
Location 16:3458321-3458343
Sequence GCGCCCGCGCCCCCGGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133097673_1133097685 22 Left 1133097673 16:3458276-3458298 CCAGCGCCCACCGGGTACGAGCG 0: 1
1: 0
2: 0
3: 16
4: 400
Right 1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG 0: 1
1: 0
2: 2
3: 23
4: 256
1133097677_1133097685 12 Left 1133097677 16:3458286-3458308 CCGGGTACGAGCGCGCTGGTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG 0: 1
1: 0
2: 2
3: 23
4: 256
1133097676_1133097685 15 Left 1133097676 16:3458283-3458305 CCACCGGGTACGAGCGCGCTGGT 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG 0: 1
1: 0
2: 2
3: 23
4: 256
1133097674_1133097685 16 Left 1133097674 16:3458282-3458304 CCCACCGGGTACGAGCGCGCTGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG 0: 1
1: 0
2: 2
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133097685 Original CRISPR GCGCCCGCGCCCCCGGCGCA CGG Intronic
900367671 1:2317877-2317899 CGGCCCGCGCCCTCAGCGCAGGG + Intergenic
901109961 1:6785943-6785965 GCCCCCGCACCCCCGGCGCTGGG + Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
904528772 1:31154949-31154971 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
905202154 1:36322606-36322628 CCGCCCGCGGCCCCGGGGCCCGG - Exonic
905862644 1:41361510-41361532 GAGCCCGCGCCGCCGCCGCCCGG - Intergenic
906044502 1:42817323-42817345 GCGCCCCTCCCCCCGGCGCGCGG - Intronic
906306731 1:44724465-44724487 ACCCCCGCCCACCCGGCGCACGG - Intronic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
906720009 1:47997456-47997478 GCCCCCCCGCCCCCCGCGCCAGG - Intergenic
908355421 1:63322385-63322407 GCGCCAGCATCCCCGGGGCACGG - Intergenic
912798553 1:112707052-112707074 CCGCCCGCAGCCCCGGCCCAGGG + Intronic
913979632 1:143497648-143497670 GCCCCCGCCGCCCCGGCGCCAGG + Intergenic
914869050 1:151458608-151458630 CCGCCCGCCCCTCCGCCGCACGG + Intronic
915636947 1:157194193-157194215 GCGCCCGTGTCCTCGGGGCAGGG + Intergenic
919991487 1:202710633-202710655 GCGCCCCCGCCTCCTGCTCAAGG + Intergenic
921152741 1:212414789-212414811 CCGCCCCAGCCCGCGGCGCACGG + Exonic
921882720 1:220272518-220272540 GCCCCCGCGCCCTAGGCGCCTGG - Intergenic
922440703 1:225653198-225653220 GCCCCCTCGCCCCCGGGGGAAGG - Intergenic
922753667 1:228082611-228082633 GCGCCTGCGTCGCGGGCGCACGG + Intergenic
923986437 1:239387237-239387259 GCGCCCGCCACCCAGGCGCTGGG + Intronic
1064167863 10:13001789-13001811 CCGCCCACGCCCCAGCCGCAGGG - Intronic
1065637451 10:27745623-27745645 GCACCGGCGCCCAGGGCGCAGGG + Intronic
1066022773 10:31319583-31319605 GCCGCCGCATCCCCGGCGCAGGG + Intronic
1067694318 10:48524110-48524132 CCGCCCGCGGCCCCGCCGCTCGG + Intronic
1070280378 10:75044007-75044029 GCGCCGTCGCCCTGGGCGCAGGG + Exonic
1073325576 10:102642677-102642699 GCGCCCTCGCCGCCGCCGCGAGG - Intergenic
1073432228 10:103494096-103494118 GCGTCCCCGGCCCCGGCCCAGGG + Exonic
1073503894 10:103967238-103967260 CCGTCCGCTCCCGCGGCGCAAGG - Exonic
1075485404 10:122818614-122818636 CCGCCCGCCCGCCAGGCGCAGGG - Intergenic
1076721831 10:132396487-132396509 GCGGGCGCGCGCCCGGCTCAGGG - Intergenic
1076749856 10:132537317-132537339 GCGCACCCGCCGCCGGCGCCCGG + Intergenic
1076792534 10:132784926-132784948 TCCCCCGCGCCGCCGCCGCACGG + Exonic
1076944971 10:133640544-133640566 CCTCCCGCGCCCCCGGGGCTGGG + Intergenic
1077081448 11:726241-726263 CTGCCCCCGCCCCCGGCCCAGGG - Intronic
1077253827 11:1571988-1572010 GGGCCCGCGCAGCCGGGGCAGGG + Intergenic
1077307806 11:1875776-1875798 ACGCCCGAGCCCCAGGCGGACGG + Intronic
1081831467 11:46119881-46119903 CCGCCCGCGCCCCCGCCGGGGGG - Intronic
1082807724 11:57461027-57461049 GGGGCCGCGCCCCCGCCGCCAGG + Intronic
1083272787 11:61580635-61580657 GATCCCGCGCCCCCGGGGCTGGG + Intronic
1083888780 11:65585451-65585473 GTGCCCCCGCCCCGCGCGCACGG + Exonic
1083904968 11:65663269-65663291 GCGGCCGCCCGCCCCGCGCAGGG + Intergenic
1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG + Intergenic
1084165297 11:67372611-67372633 CCGCCCCCGCCCCCGCCGCGGGG - Intronic
1084192199 11:67504361-67504383 CCGCCCGCGCCGCCGGGGCCGGG + Intronic
1085396885 11:76210851-76210873 CCGCCCCCGCCCCCCGCGCGCGG - Intergenic
1086484714 11:87286467-87286489 CCGCCCGTGGCCCTGGCGCAGGG - Intronic
1088223180 11:107591052-107591074 GCGCCCGCGCCCCCGGCTCCCGG + Intergenic
1088279486 11:108121763-108121785 GCTCCCGCGGCCCGGGCGCGCGG + Intronic
1088462238 11:110093518-110093540 GCGCCCGGGCGCCAGGCGGAGGG + Intronic
1089046018 11:115503247-115503269 GCGCCAACGCGCCCGGCACACGG + Intronic
1089287816 11:117419159-117419181 GCGCCCTCCCTCCCGGCACAGGG + Intergenic
1090285607 11:125496320-125496342 GCGGGCGCGCCCCCGGAGCCCGG - Intronic
1090636725 11:128694404-128694426 GCGCCGGCTCCTCCGGCGCTCGG + Intronic
1091243267 11:134069305-134069327 GCGCCCGCGTCCCCGCAGCCAGG + Intronic
1091550109 12:1530468-1530490 GAGCCCGCGCCTCGGGCCCAGGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1094218574 12:27970542-27970564 GCGCCCACGCCCCCGGCACGGGG - Intronic
1095810676 12:46371499-46371521 GCGCCCCCGCCCCTCGCGCGCGG - Intronic
1096627376 12:52903970-52903992 CCGCCCACGCTGCCGGCGCAGGG + Intronic
1098255477 12:68611211-68611233 GCGCTCGCGGGCCCGGCGCCTGG - Intronic
1098369287 12:69739362-69739384 GGTCCCGCGCGCCCGGGGCAGGG + Intronic
1105512124 13:21060604-21060626 GCGGCCGCGCCGCCGGCTCACGG - Intronic
1106735922 13:32587142-32587164 GCGCCCGCGGCCCCGACCCGCGG - Intronic
1106735925 13:32587161-32587183 GCGCTCTCGCCCCCGCCGCCGGG + Intronic
1110119535 13:71865565-71865587 GCGCCCGCGCGCCCGGGGCAGGG + Intronic
1110318437 13:74135049-74135071 CCGCCCGCCCCACCGGCGCGCGG - Intergenic
1110442195 13:75538182-75538204 GCGACCGCACCCCCGGCACATGG + Intronic
1112365491 13:98752396-98752418 GCTTCCGCGCCCCGGCCGCACGG + Intronic
1112570348 13:100588492-100588514 GCGCCCGTGGCCCCCGCGCGGGG + Intronic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1113841533 13:113364125-113364147 GCGCCCGCGGTCCCGCCGGAAGG - Exonic
1113936181 13:113996262-113996284 CCTCCCGCTCCCCCGGGGCAGGG + Intronic
1114485171 14:23057656-23057678 CCGCCCCCGCCCCCGCCGCGCGG - Intergenic
1114674178 14:24430041-24430063 TTGCCCGCGCCCCCAGCCCAGGG - Intronic
1115474512 14:33800462-33800484 GCGGCCGCGCCGTCGGCGCCGGG - Exonic
1116835800 14:49768215-49768237 GGGCCCGCGCCGCCGCCGCCCGG + Exonic
1116844667 14:49853898-49853920 GCGCCACCGCGCCCGGCGCTCGG + Intergenic
1117072579 14:52069537-52069559 GCGCCCGGGACCCCAGGGCAGGG - Intergenic
1117478134 14:56118203-56118225 GCGCCCCCTCCCCCGGCGCGTGG - Intronic
1118749486 14:68795641-68795663 GAGCCCGCGCCCCCGGGGAGAGG - Intronic
1118809040 14:69260524-69260546 GCGCCCTCGGCCGCCGCGCAGGG - Intronic
1119650103 14:76377175-76377197 CCGCCCGCGCCCACGCCGCTCGG - Intronic
1121253007 14:92513631-92513653 GCGGCCGCGCCCCCGGGGCCGGG - Intergenic
1122204866 14:100143311-100143333 GCTCCCGGGCCCCCGGCACCTGG + Intronic
1122736751 14:103847752-103847774 GCGTCCGCGCTCCCGGCGGCGGG + Intergenic
1122888893 14:104723738-104723760 GCGCCCGCGCCCAGGGCACTCGG + Intergenic
1125180998 15:36880724-36880746 GCGCCCCAGCCCCGGGCGGAGGG + Intergenic
1125536064 15:40441610-40441632 ACGCCCGCGCCGCCGCCGCCCGG - Intronic
1127867297 15:63042964-63042986 GCGCCCGCGCCCAGAGCGCCGGG + Intronic
1129352649 15:74965764-74965786 GAGCCACCGCGCCCGGCGCAGGG - Intronic
1130023693 15:80252095-80252117 GAGCCCGCGCCCCCGTCACCGGG - Intergenic
1130656418 15:85794695-85794717 GCGCCCCCGCTCCCTGCGCTGGG - Intronic
1131517604 15:93089309-93089331 CCGCCCGCGGCCCGGGCGCCCGG - Intergenic
1132891091 16:2205298-2205320 GCGGCCGCGGGCCCGGCGCGAGG - Exonic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1133219917 16:4315644-4315666 GCGGCCCCGCCCCCGGCCCGAGG - Intronic
1133259424 16:4538559-4538581 CCGCCCCCGCCCGCGGCGCCTGG - Intronic
1133270618 16:4609418-4609440 GCCCCAGCGGCCCCGGCACATGG - Exonic
1135517702 16:23149297-23149319 GCGCCCGCCCGCCCGGCCCGCGG + Intergenic
1135521795 16:23183297-23183319 GCGCCCGCTCGCTCCGCGCAGGG + Intronic
1136591325 16:31219413-31219435 GCTCCCCAGCTCCCGGCGCAAGG - Exonic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1137617153 16:49855151-49855173 GCGCCCTCGCCCCGGCCGCCTGG - Intronic
1137926604 16:52546990-52547012 CGCCCCGCGCCCCCGGCGCCCGG - Exonic
1138360641 16:56425041-56425063 GCGGCCGGGCCCGCGGGGCAGGG - Intronic
1138426049 16:56932543-56932565 GCGCCCGCGTCGGCGGGGCAGGG - Intronic
1139882742 16:70188313-70188335 GCGGCCGCGGCCCCGGCCAAGGG - Intergenic
1140369768 16:74407206-74407228 GCGGCCGCGGCCCCGGCCAAGGG + Intergenic
1140478821 16:75251727-75251749 GCGCCCGCGCCCCCGACAGGCGG - Intronic
1141989550 16:87602405-87602427 CCGCCCCCGCCCCCGGAGCGCGG - Intronic
1142339064 16:89508690-89508712 GCGCAGGCTCCCCCGCCGCAGGG - Intronic
1142670628 17:1485933-1485955 CCGCCCCCGCCCCCGGCCCGCGG - Intronic
1142757580 17:2025038-2025060 GCGCCGGTGCCCTCGGCGCGGGG - Exonic
1144847054 17:18225571-18225593 GCGCCCGCGCCCGGGCCGCCTGG + Exonic
1145248270 17:21283955-21283977 GCGCCCGCGCTCCAGGCGCCCGG - Intergenic
1146445292 17:32928087-32928109 GCGCCCCGGCCCCCGGCCCCCGG - Exonic
1146794284 17:35770221-35770243 GCGCCCGCGGCGGCGGCTCAGGG + Exonic
1147168561 17:38605582-38605604 CCGCCCCCGCCCCCGGCCGAGGG + Intronic
1148206841 17:45784604-45784626 GCGCTGGCGCCCCCGGCCCCTGG + Intronic
1148323705 17:46771703-46771725 GCGCCCCCGGCCCCGGCGCCGGG + Intronic
1150273668 17:63882465-63882487 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
1151210441 17:72540380-72540402 GCGTCCGCCCTCCCGGCGCGCGG - Intergenic
1151537783 17:74748580-74748602 GCGGCCCCGCCCCCGGGGTAAGG + Intergenic
1151780273 17:76240668-76240690 ACGCCCACGCCCCCGCCGCGAGG - Intergenic
1152352242 17:79790396-79790418 GCGCCAGCGGCCCGGGCGCATGG + Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152831172 17:82497658-82497680 GCGCCCACACCCCCCGCGCTCGG + Intergenic
1156350485 18:36297806-36297828 GGGCCCGCGCCCCCGCGGCAGGG + Intronic
1157095159 18:44680413-44680435 GCGCCCGGGCTCCCGGGCCAAGG - Intronic
1157529537 18:48409500-48409522 GCGCCCGCGCCGCCGGCTCGGGG + Intronic
1160163400 18:76491733-76491755 GCGCTCTCGCCCCCGGCCCCTGG + Intronic
1160499124 18:79393899-79393921 GTGGCCGCGCGCCAGGCGCAGGG - Intergenic
1160680348 19:409230-409252 GCGCCCCCGCCCCCGCGGGAAGG + Intergenic
1160719162 19:589996-590018 GCGGCGGCGGCCCCGGCGCGGGG - Exonic
1160991863 19:1863388-1863410 GGGCCCGCGCCCTCGGGGCCGGG + Exonic
1162018569 19:7858374-7858396 GCGCCCCCGCCCCCGCCCAACGG + Intronic
1162033127 19:7925847-7925869 GCGGCCGCGGCCCGGGCGCGCGG + Intronic
1162413098 19:10517995-10518017 CCGCTCCCGCCCCCGGCTCAGGG + Intergenic
1163138592 19:15331802-15331824 GCGCTCGCGGCCCCCGCGCCAGG + Intronic
1163262275 19:16198335-16198357 GAGCCCCCGGCCCCGGCGCCGGG - Intronic
1163304937 19:16471965-16471987 GCCCCCGTTCCCCCGGCGCTCGG - Exonic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165305484 19:35000444-35000466 GTGGGCGCGCCCCGGGCGCAGGG - Exonic
1166759798 19:45217612-45217634 GCGCAGGCGCCCACGGAGCAGGG + Exonic
1166807671 19:45496876-45496898 GCGCCCGCGACCCCGGGCCCAGG - Exonic
1167261569 19:48461855-48461877 GCGACCGCGGCGCCGGCCCACGG - Exonic
1167267532 19:48491115-48491137 CCGCCCGGGCCCCCGACGCCCGG - Exonic
924985015 2:263460-263482 GGCCCCGCGACCCCGGCGCCAGG + Intronic
926914337 2:17878497-17878519 CCGCCCGCGCCCTCGGCCCGGGG + Intronic
927159219 2:20242387-20242409 GCCCCCGGACCCGCGGCGCAGGG + Intergenic
927215778 2:20667212-20667234 CCGCCCGCCCGCCCGGCCCACGG + Exonic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932562807 2:72887681-72887703 GCGCGAGCTCCCCCGGCCCAAGG + Exonic
936863857 2:117055599-117055621 GTGCCCTCGCCCCCCTCGCAGGG + Intergenic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937951033 2:127388055-127388077 GCGGGCGCGCGCCCGGCCCAGGG + Intronic
943658675 2:190534832-190534854 CCGCCCGCGGCCTCGGGGCACGG + Intergenic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
944675947 2:202034245-202034267 GCGCGCACGCCCCCCGCGCCTGG - Intergenic
948402306 2:237692648-237692670 GCGCCCGCTCCCACCGCGCTGGG - Intronic
948468625 2:238163888-238163910 GCGCCCGCGGCCCCGGGGCCAGG - Exonic
948492116 2:238320479-238320501 GCGCCTGCGCGGCCGCCGCAGGG - Exonic
948750033 2:240126859-240126881 GCGCCTCCGCCCCCTGCCCATGG + Exonic
949004296 2:241636845-241636867 GCGCCCCCGCCCCCCGCGTTCGG + Intronic
1168777795 20:462402-462424 GGGCCCGGGGCCCCGGGGCATGG - Exonic
1171499831 20:25585173-25585195 GCGCCCGCGCCGCCGCCGTCGGG + Intronic
1172581356 20:36051010-36051032 GCTCGCGGGCCCCCAGCGCAAGG - Intergenic
1173548101 20:43914688-43914710 GCCCCCGGGCCCCCGGCCCTAGG + Intergenic
1173979259 20:47210615-47210637 GAGCCTGAGCCCCCGGCGCGGGG - Exonic
1175349859 20:58309951-58309973 GGGCCCGCGCCCCTGGCTCCCGG + Exonic
1175429197 20:58890644-58890666 GCGCCCGCGGCCTCTGCGCTTGG - Intronic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1176548987 21:8213474-8213496 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176556880 21:8257686-8257708 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176567916 21:8396504-8396526 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1176575820 21:8440723-8440745 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1178992438 21:37366965-37366987 GCGCCCGCACCCCCCGCTCGGGG - Intronic
1179561598 21:42219244-42219266 CCGCCGCCGCCCCCGGGGCATGG + Exonic
1180871745 22:19150435-19150457 GCGCCCCCGGCCCCCGCGCGCGG - Intergenic
1180921610 22:19524341-19524363 GCGCCCGCGCTCCCGGCTCTTGG + Exonic
1183386743 22:37519386-37519408 GCGGCGGCTCCGCCGGCGCAGGG + Exonic
1183504693 22:38202506-38202528 GCGCCCCCGCCCCCGCCGGGCGG - Intronic
1183525014 22:38317525-38317547 GGGCCCGCGCCCTCCGCGCTGGG + Intronic
1184155076 22:42662175-42662197 GGACCCGCGCCCCGGGCGCCGGG - Intergenic
1185313908 22:50170648-50170670 CCGCCCGCGCCCCCCTCGCCGGG + Intergenic
1203253871 22_KI270733v1_random:129781-129803 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203261927 22_KI270733v1_random:174860-174882 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
952942261 3:38453989-38454011 GGGCCCGGGCCCCGGGCGCAGGG - Exonic
954395725 3:50292283-50292305 GACCCCGCGCCCCCCGCGCCCGG - Exonic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
961775068 3:129278784-129278806 CAGCCCGCGCTCCCGGCGCCAGG - Intergenic
961827531 3:129606767-129606789 CCGCCCCCGACCCCGGCGCCCGG + Exonic
963038307 3:141051157-141051179 GCGCCCGCGCCCCTGTGCCAAGG - Intergenic
966108225 3:176362488-176362510 GGGCCCGCGCCGCCGGCGGGCGG + Intergenic
966181874 3:177196495-177196517 GCGCCCCCGCCCCGGACGCGCGG + Intronic
967272658 3:187743924-187743946 GCGCCCGCTCCTCCCGCGCCGGG + Intronic
967858501 3:194135018-194135040 GTGCGCGCGCCCCGGGGGCAGGG - Intergenic
968051560 3:195658263-195658285 GTGCCCGCGCCCCCTGCCCGGGG + Intergenic
968225217 3:196968835-196968857 GGGCCGCCGCCGCCGGCGCAGGG + Intronic
968334492 3:197901420-197901442 GAGCCACCGCCCCCGGCCCAAGG + Intronic
968479162 4:826218-826240 GCGCCCGCGGCCCCGCCCCTCGG - Intergenic
968642497 4:1721594-1721616 GAGCCCGCGCCGCCGCCGCCAGG - Exonic
968699348 4:2047310-2047332 GCGCCCGGGCCTCCGCCGCTTGG - Intergenic
969053351 4:4387372-4387394 GCGCCCTTGCGCCCGGCGCTTGG + Intronic
969071328 4:4541826-4541848 CCGCCGGAGCCCCCGGCCCAAGG - Exonic
969559586 4:7939000-7939022 CCAACCGCGCCCCCCGCGCACGG + Exonic
969671519 4:8592733-8592755 GGGCTCCCGCCCCCGGCGCAGGG - Exonic
972686779 4:41360343-41360365 GCGCCCGCTCCCCCGGGCCCGGG + Intronic
973954518 4:56049416-56049438 GAGCCCACGCCCCCGGGGCCAGG - Intergenic
975612114 4:76213653-76213675 GCCCACGCCCTCCCGGCGCACGG + Exonic
980930263 4:139177360-139177382 GCCCCCGCCCCCCCGCCGCGTGG - Intergenic
985068443 4:186144972-186144994 GCCCCCGCGGCCCCGGGGCTGGG - Exonic
985448353 4:190041053-190041075 CCTCCCGCGCCCCCGGGGCTGGG + Intergenic
985640843 5:1062864-1062886 GCTCCCGTGACCCCAGCGCATGG - Intronic
985713952 5:1445549-1445571 GCGCCCCCGCCCCCGCCTCCCGG + Intergenic
985716056 5:1462442-1462464 GTGCCCGCGACCCTGGCGCTGGG + Exonic
986347287 5:6846722-6846744 GAGCCACCGCGCCCGGCGCAGGG + Intergenic
990175992 5:53109546-53109568 GCGCCCCCGCCCCCGCCCCCGGG - Exonic
990512109 5:56498737-56498759 GCGCAGGAGCCCACGGCGCAGGG + Intergenic
991435922 5:66596876-66596898 GCGCCCGGGCGCCCGCCGCGTGG + Exonic
992597317 5:78360061-78360083 GCGGCCGCGCCCCCGCCCCGGGG + Intergenic
992732788 5:79689762-79689784 GCTCGCCCGCCCCCGGCGCCGGG + Intergenic
999809566 5:155114931-155114953 GCCGCCGCGCCCCCGGCTCTGGG + Intergenic
1001021085 5:168183112-168183134 GAGCCACCGCCCCCGGCCCAGGG + Intronic
1002082086 5:176743302-176743324 GCACCCGCACCCCCGGGGCAGGG - Intergenic
1006337524 6:33428179-33428201 GCGCCCCCGCCCCACGCGCGCGG - Intronic
1011517210 6:88166855-88166877 GCGCCCCCTCCCTCCGCGCAAGG + Intergenic
1011983962 6:93419140-93419162 CCGGCCGCGCCTCCGGCGCCGGG - Intronic
1013155658 6:107489819-107489841 GCGCCGGCGCCCCTGGCGTGTGG + Intergenic
1013170722 6:107634669-107634691 GCGCCCACGCCCGCCGAGCATGG + Exonic
1013459002 6:110357954-110357976 GCGCGGGCGCCCCCGCCGGAAGG - Exonic
1014079467 6:117270605-117270627 GCGCCAGTGCCCCCGCCGCTGGG + Exonic
1014230287 6:118894975-118894997 GGGCCAGCGACCCCGGCGCACGG + Intronic
1017163857 6:151390529-151390551 CCACCCCCGCCCCCGGCGCCGGG - Intronic
1019279467 7:192745-192767 CCGCCCGCCCGCCCGGCGCCTGG + Intergenic
1027138255 7:75639351-75639373 GCGCCCGAGCCCCCGGGGACCGG + Intronic
1028364703 7:90013912-90013934 GCCCCCGCTCCCCCTGCCCAGGG - Intergenic
1028841638 7:95435071-95435093 GCCTCCGCGGCCCCGACGCAGGG - Exonic
1029456598 7:100675133-100675155 GCGCCCGGGCCCCAGGGGCCCGG - Intronic
1031051863 7:116953402-116953424 GAGCCCGCGTCCCCGGCGGCGGG + Exonic
1034446083 7:151115010-151115032 GCGCCCGCGCCTCGGCCGCCGGG + Intronic
1035187714 7:157139166-157139188 GCGCCCGCCCGCCCGGCCCGGGG - Exonic
1039476375 8:37841342-37841364 ACGCCCGGGCCCCCGGAGGATGG + Exonic
1042253037 8:66775293-66775315 GGGCACCCACCCCCGGCGCATGG - Exonic
1042532887 8:69833046-69833068 GCCCCCCCACCCCCGGCGCAGGG - Exonic
1048345422 8:133571647-133571669 GCCCCCGCGCACCCCGAGCAGGG + Intronic
1048554035 8:135457774-135457796 CCGCCCGCGCCCCCAGCGGCGGG - Exonic
1049109908 8:140635919-140635941 GCGCCCGCCCCCGCGCCACACGG - Intergenic
1049585087 8:143429310-143429332 GAGCCCGCGCCGCCGTCGCCGGG - Exonic
1049694546 8:143976957-143976979 ACACCTGAGCCCCCGGCGCACGG + Intergenic
1049724191 8:144137919-144137941 CCGCCCGCGCGCCCGGCGCCAGG - Exonic
1049726203 8:144147666-144147688 GAGCCCGCGTCCCCGGCGTCTGG + Intergenic
1049784585 8:144444349-144444371 GCCTCCGCGCCCCCGGAGGAAGG + Intronic
1049896238 9:113901-113923 GCGCCGCCGCCCCCGGTGCCAGG - Intergenic
1051170090 9:14313252-14313274 GCGCCCGCGCTCCGTGCCCAGGG + Intronic
1053206586 9:36191231-36191253 GCCCCCGGGCCCCAGCCGCACGG + Exonic
1054798625 9:69325370-69325392 GCGCCCGGGCCCCCGGCCTGCGG - Intronic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1057669648 9:97076856-97076878 GCTCCTGCGCCCACGGGGCAGGG + Intergenic
1059251454 9:112890793-112890815 ACACTCGCGCTCCCGGCGCACGG - Exonic
1059251459 9:112890819-112890841 GCCGGCGCGCTCCCGGCGCACGG - Exonic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061181627 9:129028051-129028073 ACATCCGGGCCCCCGGCGCACGG + Intronic
1061280965 9:129597470-129597492 GCGCCAGCGGCCCCAGCGCTCGG - Intergenic
1061990866 9:134157836-134157858 GCGTCCCCGACCCAGGCGCAGGG + Intronic
1062230386 9:135479250-135479272 CCGCCCCCGACCCCGGCCCAAGG + Intronic
1062389296 9:136327677-136327699 GCTCCCGCGTCCCCGACCCATGG + Exonic
1062628754 9:137454360-137454382 GCCCCCCCACCCCCGCCGCACGG + Intronic
1203470271 Un_GL000220v1:112925-112947 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1203478092 Un_GL000220v1:156897-156919 GCGCCCGTGGCCGCGGCGCCGGG + Intergenic
1185747384 X:2583913-2583935 GCGCCCGCGCCCCCTACTCCGGG - Intergenic
1186496427 X:10015491-10015513 GCCCCCGCGCCCCGGGCGCCGGG + Intergenic
1189114285 X:38327310-38327332 GCGCCCGCGCCGGTGGCGGAAGG - Intronic
1190246927 X:48696886-48696908 GCGTCCGAGGCCCCGGCGCCGGG + Intronic
1191251979 X:58264124-58264146 ACCCCCGCGGGCCCGGCGCAGGG - Intergenic
1195923183 X:110002672-110002694 GCGGCCGCCGCCGCGGCGCACGG - Intronic
1196734965 X:118975144-118975166 GCGCCGGCGCCCCCGGACGAGGG + Exonic
1199978318 X:152907216-152907238 GCCCCCGCTCCTCCAGCGCACGG + Intergenic
1200173779 X:154097710-154097732 GCGCGCGCGCCGCCGACGCCGGG + Exonic
1200229453 X:154436890-154436912 GCGCGCGCGGCTCCCGCGCACGG + Intergenic