ID: 1133098111 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:3461339-3461361 |
Sequence | ACCTCCGCAGGGGGGCACTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 92 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 82} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133098111_1133098125 | 29 | Left | 1133098111 | 16:3461339-3461361 | CCAGAGTGCCCCCCTGCGGAGGT | 0: 1 1: 0 2: 0 3: 9 4: 82 |
||
Right | 1133098125 | 16:3461391-3461413 | GCCACAGCTCTAAGCTGAGATGG | 0: 1 1: 0 2: 1 3: 22 4: 290 |
||||
1133098111_1133098120 | 5 | Left | 1133098111 | 16:3461339-3461361 | CCAGAGTGCCCCCCTGCGGAGGT | 0: 1 1: 0 2: 0 3: 9 4: 82 |
||
Right | 1133098120 | 16:3461367-3461389 | GAGAGGTGCCAGTCACCCCAAGG | 0: 1 1: 0 2: 1 3: 20 4: 197 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133098111 | Original CRISPR | ACCTCCGCAGGGGGGCACTC TGG (reversed) | Intronic | ||