ID: 1133098115

View in Genome Browser
Species Human (GRCh38)
Location 16:3461348-3461370
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098115_1133098125 20 Left 1133098115 16:3461348-3461370 CCCCCTGCGGAGGTGGGCAGAGA 0: 1
1: 0
2: 2
3: 22
4: 202
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098115_1133098120 -4 Left 1133098115 16:3461348-3461370 CCCCCTGCGGAGGTGGGCAGAGA 0: 1
1: 0
2: 2
3: 22
4: 202
Right 1133098120 16:3461367-3461389 GAGAGGTGCCAGTCACCCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098115 Original CRISPR TCTCTGCCCACCTCCGCAGG GGG (reversed) Intronic