ID: 1133098116

View in Genome Browser
Species Human (GRCh38)
Location 16:3461349-3461371
Sequence CTCTCTGCCCACCTCCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098116_1133098127 30 Left 1133098116 16:3461349-3461371 CCCCTGCGGAGGTGGGCAGAGAG 0: 1
1: 0
2: 4
3: 30
4: 233
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098116_1133098120 -5 Left 1133098116 16:3461349-3461371 CCCCTGCGGAGGTGGGCAGAGAG 0: 1
1: 0
2: 4
3: 30
4: 233
Right 1133098120 16:3461367-3461389 GAGAGGTGCCAGTCACCCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 197
1133098116_1133098125 19 Left 1133098116 16:3461349-3461371 CCCCTGCGGAGGTGGGCAGAGAG 0: 1
1: 0
2: 4
3: 30
4: 233
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098116 Original CRISPR CTCTCTGCCCACCTCCGCAG GGG (reversed) Intronic