ID: 1133098117

View in Genome Browser
Species Human (GRCh38)
Location 16:3461350-3461372
Sequence CCTCTCTGCCCACCTCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098117_1133098127 29 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098117_1133098120 -6 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098120 16:3461367-3461389 GAGAGGTGCCAGTCACCCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 197
1133098117_1133098128 30 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098117_1133098125 18 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098117 Original CRISPR CCTCTCTGCCCACCTCCGCA GGG (reversed) Intronic