ID: 1133098119

View in Genome Browser
Species Human (GRCh38)
Location 16:3461351-3461373
Sequence ACCTCTCTGCCCACCTCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098119_1133098127 28 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098119_1133098120 -7 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098120 16:3461367-3461389 GAGAGGTGCCAGTCACCCCAAGG 0: 1
1: 0
2: 1
3: 20
4: 197
1133098119_1133098125 17 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098119_1133098128 29 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098119 Original CRISPR ACCTCTCTGCCCACCTCCGC AGG (reversed) Intronic