ID: 1133098125

View in Genome Browser
Species Human (GRCh38)
Location 16:3461391-3461413
Sequence GCCACAGCTCTAAGCTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 290}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098115_1133098125 20 Left 1133098115 16:3461348-3461370 CCCCCTGCGGAGGTGGGCAGAGA 0: 1
1: 0
2: 2
3: 22
4: 202
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098119_1133098125 17 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098121_1133098125 -7 Left 1133098121 16:3461375-3461397 CCAGTCACCCCAAGGTGCCACAG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098117_1133098125 18 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098111_1133098125 29 Left 1133098111 16:3461339-3461361 CCAGAGTGCCCCCCTGCGGAGGT 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098114_1133098125 21 Left 1133098114 16:3461347-3461369 CCCCCCTGCGGAGGTGGGCAGAG 0: 1
1: 0
2: 1
3: 26
4: 241
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290
1133098116_1133098125 19 Left 1133098116 16:3461349-3461371 CCCCTGCGGAGGTGGGCAGAGAG 0: 1
1: 0
2: 4
3: 30
4: 233
Right 1133098125 16:3461391-3461413 GCCACAGCTCTAAGCTGAGATGG 0: 1
1: 0
2: 1
3: 22
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098125 Original CRISPR GCCACAGCTCTAAGCTGAGA TGG Intronic