ID: 1133098127

View in Genome Browser
Species Human (GRCh38)
Location 16:3461402-3461424
Sequence AAGCTGAGATGGTCAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098121_1133098127 4 Left 1133098121 16:3461375-3461397 CCAGTCACCCCAAGGTGCCACAG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098116_1133098127 30 Left 1133098116 16:3461349-3461371 CCCCTGCGGAGGTGGGCAGAGAG 0: 1
1: 0
2: 4
3: 30
4: 233
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098124_1133098127 -5 Left 1133098124 16:3461384-3461406 CCAAGGTGCCACAGCTCTAAGCT 0: 1
1: 0
2: 2
3: 11
4: 172
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098117_1133098127 29 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098119_1133098127 28 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098122_1133098127 -3 Left 1133098122 16:3461382-3461404 CCCCAAGGTGCCACAGCTCTAAG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196
1133098123_1133098127 -4 Left 1133098123 16:3461383-3461405 CCCAAGGTGCCACAGCTCTAAGC 0: 1
1: 0
2: 1
3: 17
4: 178
Right 1133098127 16:3461402-3461424 AAGCTGAGATGGTCAGATAGAGG 0: 1
1: 0
2: 0
3: 10
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133098127 Original CRISPR AAGCTGAGATGGTCAGATAG AGG Intronic