ID: 1133098128

View in Genome Browser
Species Human (GRCh38)
Location 16:3461403-3461425
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133098119_1133098128 29 Left 1133098119 16:3461351-3461373 CCTGCGGAGGTGGGCAGAGAGGT 0: 1
1: 0
2: 2
3: 27
4: 249
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098121_1133098128 5 Left 1133098121 16:3461375-3461397 CCAGTCACCCCAAGGTGCCACAG 0: 1
1: 0
2: 2
3: 14
4: 179
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098124_1133098128 -4 Left 1133098124 16:3461384-3461406 CCAAGGTGCCACAGCTCTAAGCT 0: 1
1: 0
2: 2
3: 11
4: 172
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098123_1133098128 -3 Left 1133098123 16:3461383-3461405 CCCAAGGTGCCACAGCTCTAAGC 0: 1
1: 0
2: 1
3: 17
4: 178
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098122_1133098128 -2 Left 1133098122 16:3461382-3461404 CCCCAAGGTGCCACAGCTCTAAG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214
1133098117_1133098128 30 Left 1133098117 16:3461350-3461372 CCCTGCGGAGGTGGGCAGAGAGG 0: 1
1: 0
2: 3
3: 28
4: 334
Right 1133098128 16:3461403-3461425 AGCTGAGATGGTCAGATAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type